The regulation of nuclear factor erythroid derived 2 related factor 2 (NRF2) in the phase 2 response 2

1.1.1 The role of oxidative stress in carcinogenesis 1 1.2 Nrf2 Nuclear factor erythroid-2 NF-E2-related factor 2 4 1.3 The antioxidant response mechanism by Nrf2 4 1.5.1 Post-translatio

THE REGULATION OF NUCLEAR FACTOR ERYTHROID-2 (NF-E2)-RELATED FACTOR 2 (NRF2) IN THE PHASE 2 RESPONSE

DAPHNE WONG PEI WEN

Acknowledgements

I am grateful to A/P Thilo Hagen, my supervisor, for the

opportunity to conduct my research in his lab My work would not have

been possible without his guidance and patience Thank you for

patiently teaching me and being so understanding and helpful

I would like to thank Christine Hu Zhi-Wen for her emotional

support and encouragement; as well as Chua Yee Liu, Hong Shin Yee,

Michelle Fong, Dr Tan Chia Yee, Regina Wong Wan Ju and Jessica

Leck Yee Chin for making my lab experience an enjoyable one I am

grateful to Dr Boh Boon Kim and Dr Choo Yin Yin for providing the

Keap1 plasmids I am also grateful to the endophyte team: Tan Shi

Hua, Lim Shu Ying, Lim Ee Chien, Seah Wen Hui, Christine Hu, Ng Mei

Ying and Daphne Ng Hui Ping for their contribution in the endophyte

project I would also like to thank all other members of the lab, past and

present, for their help and support

Last but not least, I am deeply grateful to my husband Moses

Tan, my parents and my sister for their love and encouragement

throughout the duration of my PhD

DECLARATION

I hereby declare that the thesis is my original work and it has been written by me in its entirety I have duly acknowledged all the sources

of information which have been used in the thesis

This thesis has also not been submitted for any degree in any

university previously

Daphne Wong Pei Wen

21 August 2014

1.1.1 The role of oxidative stress in carcinogenesis 1 1.2 Nrf2 (Nuclear factor erythroid-2 (NF-E2)-related factor 2) 4 1.3 The antioxidant response mechanism by Nrf2 4

1.5.1 Post-translational modification of Nrf2 9 1.5.2 Degradation of Nrf2 : Keap1 and Cullin3 E3 Ubiquitin Ligase 9 1.5.3 Accumulation of Nrf2 : Keap1 as a sensor for electrophilic and

1.6 The role of Nrf2 inducers in cancer chemoprevention 16

2.11 Molecular identification of isolated endophytes 23 2.12 Organic extraction of secondary metabolites from endophytes 23

3.0 The Induction of Phase 2 response by Heteroaromatic Quinols 26

3.2.1 Heteroaromatic quinols increase Nrf2 protein concentrations 29 3.2.2 Heteroaromatic quinols increase Nrf2 transcriptional activation 32 3.2.3 Effect of quinol analogues on Nrf2 transcriptional activation

when Nrf2 ubiquitination is prevented 35 3.2.4 PMX290 markedly increases the interaction of Keap1 with

3.2.5 PMX290 increases Keap1 autoubiquitination 42 3.2.6 Effect of PMX290 on Keap1-dependent nuclear shuttling of Nrf2 44 3.2.7 Effect of PMX290 is independent of cysteine 151 in Keap1 48

4.2.1 Andrographolide induces the accumulation of Nrf2 in a

Keap1 cysteine 151-dependent manner 56

58 4.2.3 Effect of andrographolide on Keap1-Cullin3 interaction 60 4.2.4 Correlation between the dependency of Nrf2 inducers on

cysteine 151 of Keap1 and their effect on the Keap1-

4.2.5 Proposed model through which Keap1 Cys151-independent

Nrf2 inducer compounds inhibit Nrf2 ubiquitination 63

5.0 Investigating novel Nrf2 inducer compounds in endophytes 69

5.2.1 Isolation and identification of bacterial and fungal endophytes

5.2.2 Investigating the effect of organic extracts isolated from

the endophytes on Nrf2 transcriptional activation 81 5.2.3 Investigating the effect of organic extracts isolated

from the endophytes on Nrf2 protein concentration 85

Summary

The detrimental effects of oxidative stress have been linked to

major diseases such as cancer and neurodegenerative diseases

Oxidative stress can be sensed by the Keap1-Nrf2 system in the cell,

which triggers cytoprotection via the phase 2 response Nrf2, a

transcription factor, binds to the antioxidant response element (ARE) to

induce the expression of phase 2 detoxifying and antioxidant enzymes

Nrf2 is regulated at the protein level by Keap1, a substrate receptor for

the Cullin3 E3 ubiquitin ligase Binding of Keap1 to Nrf2 facilitates the

Cullin3-mediated ubiquitination and subsequent degradation of Nrf2

We have identified a class of heteroaromatic quinol compounds

as novel Nrf2 inducers We also characterized the activation of Nrf2 by

the diterpenoid andrographolide The quinol compounds as well as

andrographolide were shown to increase the Nrf2 protein concentration

and Nrf2 dependent transcription Nrf2 inducers are expected to

covalently modify critical cysteine residues in Keap1, resulting in the

inhibition of the Keap1-mediated Nrf2 ubiquitination and degradation

Our results show that andrographolide exerts its effect by targeting

cysteine 151 in the BTB domain of Keap1 On the other hand, the

quinol compounds function independently of cysteine 151 in Keap1

Interestingly, the quinol compounds markedly increased the binding

between Keap1 and Cullin3 whereas andrographolide did not Given

these observations and reports on the mechanism of other Nrf2

inducers, we suggest a correlation where Cys151-independent Nrf2

inducers cause an increase in the Keap1-Cullin3 interaction whereas

Cys151-dependent Nrf2 inducers promote the dissociation of Keap1

from Cullin3 Thus, we propose that Cys151-independent Nrf2 inducers

function via a novel mechanism that is distinct from Cys151-dependent

Nrf2 inducers The elucidation of the mechanism of action of

Cys151-independent Nrf2 inducers is expected to improve our understanding of

the regulation of the Keap1-Cullin3 E3 ubiquitin ligase

Since secondary bioactive metabolites isolated from endophytes

are a useful source of novel bioactive compounds in drug discovery, we

also aimed to discover and investigate novel Nrf2 inducers from

endophytes Here, we demonstrated the presence of a potential novel

Nrf2 inducer in the organic extract of a fungal endophyte, Phomopsis

sp The understanding of novel Nrf2 inducers would provide useful

insights for the development of therapeutics against oxidative

stress-related diseases

List of Tables

Table 1 List of target genes of Nrf2 based on chromatin

immunoprecipitation (ChIP) analysis

Table 2 Correlation between the dependency of Nrf2 inducers on

cysteine 151 of Keap1 with Keap1-Cullin3 interaction

Table 3 List of isolated fungal and bacterial endophytes

List of Figures

Figure 1.1 Schematic representation of the domains

and conserved regions in Keap1 and Nrf2

pg 12

Figure 1.2 Schematic representation of the binding of

Keap1 to Nrf2 which targets Nrf2 for ubiquitination

Figure 3.3 Western blot analyses of the effect of the

quinol compounds on Nrf2 protein

pg 31

transcriptional activation

pg 34

Figure 3.5 Effect of quinol compounds when Nrf2

ubiquitination is inhibited by dnUbc12

pg 36

Figure 3.6 PMX290 may have an inhibitory effect on

Nrf2 transcriptional activity

pg 38

Figure 3.7 Effect of the quinol compounds on binding

of Keap1 to Nrf2, Cullin3 and Keap1

homodimerization in vivo

pg 41

Figure 3.8 Effect of PMX290 and sulforaphane on

Keap1 ubiquitination in vivo

Figure 3.11 Effect of PMX290 on Nrf2 protein

interaction when Cys151 of Keap1 is mutated

pg 51

Figure 4.1 Chemical structure of Andrographolide pg 55

Figure 4.2 Western blot analysis of Nrf2 protein

concentrations in HEK293T cells after treatment with andrographolide

Figure 4.5 Proposed model through which

Cys151-independent Nrf2 inducer compounds inhibit Nrf2 ubiquitination

pg 66

Figure 5.1 Schematic representation of ITS regions

and ribosomal rDNA of fungus

pg 73

Figure 5.2 Screening of 49 organic extracts isolated

from the endophytes for Nrf2 transcriptional activation

Figure 5.5 Western blot analysis of the effect of

organic extracts isolated from the endophytes on Nrf2 protein concentration

pg 86

List of Abbreviations

Keap1 Kelch-like ECH-associated protein 1

MAPK Mitogen-activated protein kinases

NF-E2 Nuclear factor erythroid-2

Nrf2 Nuclear factor erythroid-2 (NF-E2)-related factor 2

1.0 Introduction

1.1 Oxidative stress and its implications

Maintaining redox homeostasis is important for normal cellular

function Pathology occurs when cellular redox homoestasis is

disrupted - when reactive species are in excess of antioxidants

Reactive species causes oxidative damage to biomolecules such as

nucleic acids, proteins and lipids resulting in cellular membrane

damage, DNA mutations and apoptotic cell death (Sies, 1997) The

accumulated oxidative damage is believed to be the cause of a range

of health problems such as cancer, neurodegenerative diseases,

chronic inflammation and metabolic disorders

1.1.1 The role of oxidative stress in carcinogenesis

Many studies have suggested that chronic oxidative stress is

associated with cancer initiation and carcinogenesis For example,

oxidative stress contributes to the development of chronic gastritis, a

condition that frequently progresses to gastric cancer (Konturek et al.,

2006) Similarly, oxidative stress is involved in the pathogenesis of

ulcerative colitis, which is known to be strongly associated with

colorectal cancer (Seril et al., 2003)

Induction of oxidative stress and oxidative damage has been

observed in cells exposed to pro-oxidants and electrophilic reactive

species such as heavy metals, xenobiotics and carcinogens (Sykiotis

and Bohmann, 2010) For example, radiation, barbiturates, chlorinated

compounds, metal ions, phorbol esters and various other xenobiotics

have been shown to induce oxidative stress and oxidative damage in

vitro and in vivo (Klaunig et al., 1998) Exposure to these oxidative

stress inducers have been demonstrated to cause cancer initiation and

carcinogenesis in several studies For example, arsenic was shown to

disturb redox homeostasis and induce oxidative DNA damage in Swiss

albino mice (Sinha et al., 2010; Sinha and Roy, 2011) and chronic

exposure to arsenic can lead to skin, lung, bladder, liver and prostate

cancer (Kim et al., 2011) Besides that, acrylonitrile, which induces

primary brain tumours in rats, has also been shown to induce oxidative

stress in rat brain tissue (Bigner et al., 1986; Johannsen and

Levinskas, 2002)

In cells undergoing prolonged oxidative stress, oxidative

damage to nucleic acids, proteins and lipids could result in errors in

protein synthesis and function as well as gene expression This could

lead to the dysregulation of oncoproteins and tumor suppressor

proteins In particular, oxidative damage has been associated with

aflatoxin B-induced mutations in the p53 and ras genes in

hepatocarcinogenesis (Shen and Ong, 1996)

Through various signalling pathways, cells have developed the

ability to sense oxidants and electrophiles and induce antioxidant

defense mechanisms to protect the cells against oxidative stress

(Sykiotis and Bohmann, 2010) The activation of antioxidant defense

mechanisms include the upregulation of the expression of genes

involved in the detoxification of xenobiotics and carcinogens,

maintainence of redox balance and cytoprotection Therefore,

drug-induced activation of these pathways could be a good strategy for

cancer chemoprevention The most prominent antioxidant signalling

pathway that is activated by electrophiles and oxidative stress is the

Nrf2 pathway

1.2 Nrf2 (Nuclear factor erythroid-2 (NF-E2)-related factor 2)

Nrf2 belongs to the Cap'n'Collar basic leucine zipper (CnC-bZip)

transcription factor family (Moi et al., 1994) This is due to the presence

of a conserved 43-amino acid Cap’n’Collar (CnC) domain at the

N-terminus of the Nrf2 DNA binding domain (Figure 1.1) The name

‘Nuclear factor erythroid-2 (NF-E2)-related factor 2’ is derived from

another transcription factor p45 NFE2 (nuclear factor erythroid-derived

2) from the same CnC-bZip family

Nrf2 contains a Basic Leucine Zipper Domain (bZIP domain)

which mediates sequence specific DNA binding The leucine zipper is

required to hold together two DNA binding regions (dimerization) Nrf2

dimerizes with a member of the small Maf (musculoaponeurotic

fibrosarcoma oncogene) family (Katsuoka et al., 2005; Itoh et al.,

1997; Motohashi et al., 2004) The Nrf2-Maf dimer binds to the

antioxidant response element (ARE) sequences to drive transcription of

antioxidant enzymes and detoxifying proteins The ARE consensus

sequence for Nrf2 binding has been identified to be

TMAnnRTGAYnnnGCR (where (M = A or C, R = A or G, Y = C or T)

(Wasserman and Fahl, 1997)

1.3 The antioxidant response mechanism by Nrf2

Early evidences suggesting the role of Nrf2 in the antioxidant

response mechanism originated from studies showing the upregulation

of NAD(P)H:quinine oxidoreductase 1 (NQO1) (an enzyme involved in

maintaining redox balance in the cell) by Nrf2, in response to oxidative

stress from xenobiotics and electrophiles (Venugopal and Jaiswal,

1996) In this study, overexpression of Nrf2 in cell lines was shown to

induce the expression of the NQO1 gene when subjected to

xenobiotics-induced oxidative stress

During high levels of oxidative stress, Nrf2 accumulates in the

cell and binds to the antioxidant response elements (ARE) in the

promoter of phase 2 genes to trigger the transcriptional activation of

cytoprotective drug metabolizing and antioxidant genes (Itoh et al.,

1997) This adaptive response to oxidative stress has been termed

‘phase 2 detoxification and antioxidant response’ The activation of Nrf2

upregulates the transcription of phase 2 genes including thioredoxins

and glutathione-synthesizing enzymes (to maintain redox balance),

metabolising enzymes such as glutathione S-transferases,

drug-efflux pumps and other cytoprotective proteins (Table 1) (Itoh et al.,

1997; Sykiotis and Bohmann, 2010)

Target Genes Symbol Function

Glutamate-cysteine ligase, catalytic

subunit

GCLC

Synthesis and conjugation of glutathione

Glutamate-cysteine ligase, modifier

Epoxide hydrolase 1, microsomal

(xenobiotic)

EPHX1

ATP-binding cassette, subfamily B

Solute carrier family 25 (mitochondrial

carrier; phosphate carrier), member 25

SLC25A25

Solute carrier family 44, member 3 SLC44A3

Solute carrier family 48 (heme

transporter), member 1

SLC48A1

Solute carrier family 7 (anionic amino

acid transporter light chain, xc-system),

member 11

SLC7A11

Metabolic enzymes Glucose-6-phosphate dehydrogenase G6PD

Isocitrate dehydrogenase 1 (NADP ),

Heme oxygenase (decycling) 1 HMOX1

Heme and iron metabolism

Biliverdin reductase B [flavin reductase

(NADPH)]

BLVRB

Ferritin, heavy polypeptide 1 FTH1

Ferritin, light polypeptide FTL

Aryl hydrocarbon receptor AHR

Retinoid X receptor, alpha RXRA

Table 1 List of target genes of Nrf2 based on chromatin immunoprecipitation (ChIP) analysis

Adapted from Suzuki et al., 2013 ChIP analysis data from Malhotra et al., 2010; Chorley et al., 2012; and Hirotsu et al., 2012

1.4 Nrf2 Knockout Mouse Models

Since Nrf2 plays an important role in antioxidant response

mechanism for cytoprotection and oxidative stress adaptation, various

studies has been carried out to investigate the effect of Nrf2 knockout

in mice Even though Nrf2 knockout mice were viable and fertile, they

were extremely sensitive to oxidative and ER stress (Chan et al.,

1996; Hubbs et al., 2007; Ma et al., 2006) Nrf2 knockout mice were

shown to be more susceptible to neurodegeneration and

carcinogen-induced cancers

Nrf2 knockout mice were observed to be more susceptible to

dextran sulphate sodium (DSS)-induced colitis and

azoxymethane-induced-colorectal carcinogenesis (Khor et al., 2006; Khor et al., 2008)

Besides colorectal cancer, Nrf2 deficient mice had a higher incidence

rate of liver tumours when exposed to the carcinogenic

2-amino-3-methylimidazo quinoline (Kitamura et al., 2007) Nrf2 deficient mice that

were challenged with benzo-[a]pyrene were also found to have higher

burdens of gastric neoplasias compared to wild type mice

(Ramos-Gomez et al., 2001)

Since the Nrf2 deficient mice are unable to elicit a defence

against carcinogen-induced oxidative stress, it can be concluded that

Nrf2 plays a significant role in protecting the cells against oxidative

stress-induced cancer initiation Hence, it is important to study the

regulation of Nrf2 activity

1.5 Regulation of Nrf2 activity

1.5.1 Post-translational modification of Nrf2

Protein function and activity is most commonly regulated via

post-translation modifications such as phosphorylation and acetylation

The transcriptional coactivator p300/CBP has been reported to

acetylate Nrf2 at several lysine residues (Lys438, Lys443, Lys445,

Lys462, Lys472, Lys506, Lys507, Lys518, Lys543, Lys548, Lys554

and Lys555) (Sun, Chin & Zhang, 2009) Acetylation of Nrf2 was

reported to promote binding of Nrf2 to specific ARE promoters Besides

that, Nrf2 can also be phosphorylated by PKC, Fyn and MAPKs (Bloom

and Jaiswal, 2003; Huang et al., 2002) However, the phosphorylation

of Nrf2 has been shown to have either positive or negative effects on

its function (Sun, Huang & Zhang, 2009)

Although these studies indicate that Nrf2 can be

post-translationally modified, its activity is known to be primarily regulated

via its protein levels (abundance) in the cell

1.5.2 Degradation of Nrf2 : Keap1 and Cullin3 E3 Ubiquitin Ligase

Nrf2 activity is normally kept at low levels by its cytoplasmic

inhibitor Keap1 (Kelch-like ECH-associating protein 1) (Itoh et al.,

1999) Because Keap1 is tethered to the actin cytoskeleton, it can

suppress Nrf2 activity by sequestering Nrf2 in the cytoplasm thus

preventing it from translocating into the nucleus to bind to ARE to

induce the phase 2 genes

Besides that, Keap1 was also shown to be a substrate receptor

of a Cullin-3-based E3 ubiquitin ligase Under normal conditions, Keap1

functions to anchor Nrf2 and target it for ubiquitination and

consequently 26S proteasome-mediated degradation (Figure 1.2)

(Zhang et al., 2004) Keap1 associates with Cullin3 and Rbx1 to form a

functional E3 ubiquitin ligase complex that targets Nrf2 for

ubiquitination The Cullin3 E3 ubiquitin complex, via the associated

RING domain containing protein Rbx1, recruits a ubiquitin charged E2

ubiqutin-conjugating enzyme, thus facilitating the transfer of ubiquitin to

lysine residues (Lys 44, Lys 50, Lys 52, Lys 53, Lys 56, Lys 64, Lys 68)

in the substrate Nrf2 (Figure 1.1 and Figure 1.2)

Keap1 consists of three functional domains: BTB (Broad

complex, Tramtrack, and Bric-a-Brac), IVR (intervening region) and the

Kelch repeat (Figure 1.1) (Bardwell and Treisman, 1994; McMahon et

al., 2006) The BTB domain mediates homodimerization of Keap1 as

well as binding of Keap 1 to Cullin3 In addition, it has been suggested

that the IVR of Keap1 also plays an important role in the binding to

Cullin3 (Kobayashi et al., 2004) The Kelch repeat domain of Keap1

protein binds to two specific domains in Nrf2, the ETGE motif and the

DLG motif located in the Neh2 conserved domain to target Nrf2 for

ubiquitination and proteasome-mediated degradation (Figure 1.1 and

Figure 1.2) (Tong, Katoh, et al., 2006; McMahon et al., 2006) Because

only one Keap1 protein can bind to only one of the ETGE or DLG

motifs, Keap1 binds Nrf2 as a dimer

Keap1 interacts with these two conserved motifs with different

affinities The high affinity binding of Keap1 to the ETGE motif serves

as a ‘hinge’ to pin down the Neh2 domain of Nrf2 to Keap1 (Tong,

Kobayashi, et al., 2006; Li and Kong, 2009) On the other hand, Keap1

binds to the DLG domain with lower affinity and this interaction serves

as a ‘latch’ It is likely that the high affinity interaction of Keap1 with the

ETGE motif is a prerequisite for the subsequent low affinity interaction

between Keap1 and the DLG site The positioning of the ‘latch’ may

promote the correct orientation of the lysine residues on Nrf2 for

ubiquitin binding This ‘hinge & latch’ model (Tong, Kobayashi, et al.,

2006) is a two-site binding model of Keap1 to Nrf2 and should be

distinguished from a one-site ‘hinge’ binding model The one-site

binding is a mere binding between Keap1 and the ETGE motif due to

its higher affinity and does not present Nrf2 in the correct orientation for

ubiquitination It has been shown that the deletion of the low affinity

DLG domain, which is involved in the ‘latch’ binding in Nrf2, prevented

Nrf2 degradation (McMahon et al., 2004) Therefore, only the two-sites

‘hinge & latch’ binding model would allow Nrf2 to be ubiquitinated

In summary, since Nrf2 is highly unstable under normal

conditions, Nrf2 activity is mainly regulated via regulation of its stability

Keap1 plays a significant role in the regulation of Nrf2 protein levels by

binding to Nrf2 and targeting it to the Cullin-3-based E3 ubiquitin ligase

complex for ubiquitination The poly-ubiquitination and subsequent

degradation of Nrf2 keeps Nrf2 protein levels low in the absence of

oxidative stress and this represses its ability to induce phase 2 genes

Figure 1.1 Schematic representation of the domains and conserved regions in Keap1 and Nrf2 (a) The conserved regions on

Nrf2: The Neh2 domain has two important motifs, DLG motif (amino acids 29-31) and the ETGE motif (amino acids 79-82) which are involved in the binding of Keap1 There are seven lysine residues between the DLG motif and the ETGE motif which can be ubiquitinated (b) Three functional domains in Keap1: BTB domain, IVR (intervening region) and Kelch repeat domain

Adapted from McMahon et al., 2006

BTB

IVR

Kelch repeat domain Transactivation Domain CnC bZIP

C151

C273 C288

C151 C273 C288

Ub Ub Ub Ub

BTB

C151

C273 C288

C151 C273 C288

Ub Ub Ub Ub

Figure 1.2 Schematic representation of the binding of Keap1 to Nrf2 which targets Nrf2 for ubiquitination Keap1 functions as the

substrate receptor of a Cullin-3-based E3 ubiquitin ligase and binds to ETGE domain and DLG domain of Nrf2 via its Kelch repeat domain The binding of Keap1 promotes transfer of ubiquitin from the E2 ubiquitin-conjugating enzyme to Nrf2, thus targeting Nrf2 for proteasome degradation Keap1 consists of the Kelch repeat domain, the BTB domain and the intervening region (IVR) Critical cysteine residues on Keap1 are highlighted in pink

1.5.3 Accumulation of Nrf2 : Keap1 as a sensor for electrophilic and

oxidative stress

Nrf2 is kept at low levels and rapidly degraded under normal

conditions Upon exposure to oxidative stress, however, Nrf2 protein

levels have been shown to be accumulate in the nucleus of cells

(Rushmore et al., 1991; Nioi et al., 2003) Several studies also show

that when cells were challenged with oxidative stress,

Keap1-dependent Nrf2 ubiquitination is inhibited (Zhang et al.,

2004; Kobayashi et al., 2004) Kobayashi’s work suggested that Keap1

is an oxidative stress sensor and its function to facilitate Nrf2

ubiquitination is inhibited in response to oxidative stress Moreover,

critical cysteine residues on Keap1 have also been shown to be

required for Keap1-dependent ubiquitination of Nrf2 (Zhang and

Hannink, 2003) These findings suggest that critical cysteine residues

on Keap1 could be oxidative stress sensors and under oxidative stress,

these cysteine residues could be targets for inhibition of Keap1

function, leading to the accumulation of Nrf2

Electrophilic reactive chemicals agents such as tert-butyl

hydroxyquinone (tBHQ) and diethylmalate cause oxidative stress in the

cell and consequently activate ARE-dependent genes or phase 2

genes (Huang et al., 2000) The induction of ARE-dependent genes in

response to those agents and to oxidative stress increases the ability

of cells to minimize oxidative damage, detoxify reactive carcinogens

and maintain redox homeostasis

Due to their electrophilic nature, these chemical agents are

believed to react with reactive sulfhydryl groups on cysteine residues of

Keap1 (Dinkova-Kostova et al., 2001; Dinkova-Kostova et al., 2002)

Using kinetic, radiolabeling and UV spectroscopic methods,

Dinkova-Kostova et al first identified reactive cysteine residues in Keap1 as

direct sensors responsible for inducer compound recognition The

reactive cysteine residues identified were cysteine 257, cysteine 273,

cysteine 288 and cysteine 297, all of which are located in the

intervening region (IVR) between the BTB domain and Kelch repeat

domains of Keap1 (Figure 1.2)

Zhang et al later narrowed down the number of reactive

cysteine residues to two crucial cysteine residues: cysteine 273 and

cysteine 288 in the IVR of Keap1 (Zhang and Hannink, 2003) These

authors showed that cysteine 273 and cysteine 288 are essential for

Keap1-dependent ubiquitination of Nrf2 Their studies showed that

when cysteine 273 or cysteine 288 was mutated, Keap1 lost its ability

to target Nrf2 for degradation, suggesting that these cysteine residues

could be sensors of oxidative stress on Keap1 They proposed that

these critical cysteine residues become modified due to oxidative

stress, rendering Keap1 unable to serve its function to facilitate in Nrf2

ubiquitination They also identified a third critical cysteine residue

(cysteine 151 located in the BTB domain on Keap1), which is required

for tBHQ-induced inhibition of Keap1-dependent degradation of Nrf2

When cells were subjected to tBHQ-induced oxidative stress conditions

and lysed under reducing conditions, Western blotting analysis showed

two forms of Keap1 migrating at different molecular masses (the usual

band at 68kDa and an extra band at approximately 120kDa), which

suggested a novel oxidative stress-induced posttranslational

modification to Keap1 They also suggested that cysteine 151 is

essential for this posttranslational modification

Therefore, critical cysteine residues in Keap1 are sensors of

oxidative stress and the consequent modification to these cysteine

residues affects the ability of Keap1 to target Nrf2 for ubiquitination and

degradation via the Cullin3 ubiquitin ligase complex However, it is still

unclear how exactly these modifications can affect Nrf2 ubiquitination

or Nrf2 binding to the Cullin3 ubiquitin complex formation The

elucidation of the mechanism through which Nrf2 is induced is

expected to improve our understanding of the regulation of the

Keap1-Cullin3 E3 ubiquitin ligase The understanding of the involved

mechanisms would aid in the design of novel chemopreventive agents

and in the development of new strategies against oxidative

stress-related diseases

1.6 The role of Nrf2 inducers in cancer chemoprevention

Since it has been established that the activation of the Nrf2

pathway confers cytoprotection against oxidative stress-associated

diseases including cancer, substantial efforts have been made to

identify and develop effective Nrf2 activators for therapeutic use

Chemicals that induce ARE-dependent genes via the activation

of Nrf2 are termed ‘Nrf2 inducers’ One of the known Nrf2 inducers is

sulforaphane (Fahey et al., 2002) Sulforaphane,

[(-)-1-isothiocyanato-(4R)-(methylsulfinyl)butane], is an isothiocyanate and is found as its

glucosinolate precursor in broccoli Fahey and colleagues showed that

sulforaphane prevents benzo[a]pyrene-induced stomach tumors in an

Nrf2 dependent manner Sulforaphane was also shown to prevent the

incidence of carcinogen-induced skin tumors in mice (Hong et al.,

2005)

Besides sulforaphane, the synthetic oleanane triterpenoid

CDDO has also been shown to potently induce Nrf2 at low

concentrations (Liby and Sporn, 2012) The methyl ester derivative

CDDO-Me has been used in clinical trials for treatment of various

diseases including cancer Unfortunately, due to adverse effects, a

Phase III trial of CDDO-Me was terminated

Therefore, there is still a need to search for novel and effective

Nrf2 inducers Our study aims to discover and investigate novel Nrf2

inducers The discovery and understanding of novel Nrf2 inducers

would provide a basis for cancer chemoprevention and the

development of therapeutics against oxidative stress-related diseases

2.0 Materials and Methods

2.1 Cell culture

HEK293 and HEK293T (human embryonic kidney) cells were cultured

in Dulbecco’s modified Eagle’s medium (DMEM) HCT116 colon cancer

cells were cultured in RPMI 1640 medium Both media were

supplemented with 10% (v/v) fetal bovine serum, 4.5 g/L glucose, 4

mM L-glutamine, 1.5 g/L sodium bicarbonate, 50 U/ml penicillin and

100 mg/ml streptomycin) Nystatin, an antifungal drug, was added to

the cells at a final concentration of 0.2% (v/v) The cells were cultured

at 37ºC in an incubator containing 5% CO2 (Thermo Scientific, IGO 150

cell life) The cells were subcultured when 80% confluent

Subsequently, cells were seeded using the ratio 1:8 on 12-well plates,

24 well plates (Greiner Bio-One, Germany) or 60 mm plates (Nunc,

Denmark) as needed

2.2 DNA Transfection

Plasmid DNA transfection were performed with GeneJuice®

Transfection Reagent (Novagen) according to the manufacturer’s guide

two days prior to cell harvesting unless otherwise specified 2.7 μL of

GeneJuice reagent per 1 μg of DNA was added to serum free medium

(Invitrogen) and incubated at room temperature for 5 minutes

Subsequently, the required amount of plasmid DNA was added to the

mixture and incubated at room temperature for 15 minutes before being

added drop-wise to the cells

2.3 Plasmid constructs

The FLAG-Keap1-pcDNA3.1 and Cullin3-V5-pcDNA3 plasmids were

previously described (Chew et al., 2007) The Keap1 mutant (C151S

FLAG-Keap1) was obtained via site-directed mutagenesis The full

length Nrf2-HA-pcDNA3 was PCR amplified from the cDNA of HEK293

cells and inserted into the KpnI and SacII sites of pcDNA3 with a

C-terminal HA tag The ARE-luciferase-pGL2 reporter plasmid was a kind

gift from Dr Alan Porter (Dhakshinamoorthy and Porter, 2004) The

plasmid was generated by amplifying the 25bp sequence

(GCAGTCACAGTGACTCAGCAGAATC) of the antioxidant response

element (ARE) upstream of the Nqo1 gene (NCBI# M81596) from

SH-Sy5y cells genomic DNA The amplified product was cloned into the

NheI and XhoI sites of pGL2 Promoter (Promega) reporter plasmid

2.4 Chemicals and inducers

The quinol compounds PMX464, PMX290 and BW114 were provided

by Pharminox (Nottingham, United Kingdom) Andrographolide

(365645 Aldrich), Sodium Arsenite (35000 Fluka) and Sulforaphane

(S4441) were purchased from Sigma Aldrich

2.5 Immunoblotting

Cells were washed with cold Phosphate Buffered Saline (PBS) and

before being lysed in triton X-100 containing lysis buffer (25 mM

Tris-HCl (pH 7.5), 100 mM NaCl, 2.5 mM EDTA, 2.5 mM EGTA, 20 mM

NaF, 1 mM Na3VO4, 20 mM sodium β-glycerophosphate, 10 mM

sodium pyrophosphate, 0.5% triton X-100, Roche protease inhibitor

cocktail and 0.1 % β-mercaptoethanol) Lysates were pre-cleared by

centrifugation and total protein concentration was quantified using the

Bradford protein assay (Bio-Rad #500-0006) Equal amounts of protein

were subjected to SDS-PAGE and subsequently transferred onto

nitrocellulose membrane The antibodies used for Western blotting

were: rat monoclonal anti-HA (monoclonal antibody clone 3F10,

Roche), rabbit polyclonal anti-Nrf2 (sc722; Santa Cruz Biotechnology),

mouse monoclonal anti-α-tubulin (236-10501; Molecular Probes),

mouse monoclonal anti-FLAG (F3165, Sigma) and mouse polyclonal

anti-V5 (MCA1360; AbD Serotec) The Western blots shown are

representative of at least two independent experiments

2.6 Luciferase reporter assay

Cells transfected with 0.4µg ARE-luciferase-pGL2 reporter plasmid or

0.4µg empty pGL2 plasmid per well for 24 hours and then treated with

the various Nrf2 inducers in duplicates Cells were then lysed and were

assayed using the Steady-Glo Luciferase Assay System (Promega)

Luminescence was measured using a luminometer (Modulus, Turner

Biosystems)

2.7 Immunoprecipitation

500 µl of pre-cleared lysate from cells transfected with FLAG-Keap1

and Cullin3-V5, Nrf2-HA or V5-Keap1 was added to 30 µl of Anti-FLAG

M2 agarose beads (Sigma) The samples were tumbled at 4 °C for 2 h,

and the agarose beads were then washed four times in 1 ml of cold

buffer containing 20 mM Tris, pH 7.5, 0.6 M NaCl SDS sample loading

buffer was added to the immunoprecipitated proteins and subjected to

SDS-PAGE followed by Western blotting

2.8 Immunoflourescence

Coverslips were pre-treated with Poly-D-lysine Cells were plated on coverslips and transfected Following the various treatments, the cells were fixed with 4% formaldehyde for 15 minutes The cells were permeabilized with 0.2% Triton X-100 in PBS for 10 minutes and blocked with 0.05% Tween-20 + 5% fetal bovine serum in PBS for 30 mintues Primary and secondary antibodies were diluted 1:1500 in 0.05% Tween-20 + 1% fetal bovine serum in PBS and added to the coverslips for 1 hour each After each step, the coverslips were washed thrice with PBS for 5 minutes All steps were conducted with gentle

shaking Subsequently, the coverslips were mounted onto glass slides with VectorShield and viewed under a microscope with Leica HCX PL FLUOTAR 63x/1.25 oil objective.

2.9 Collection and processing of plants

The tropical ferns and mosses were collected from Kent Ridge Park

and various locations around NUS campus with the help of Professor

Benito C Tan and Dr Ho Boon Chuan The plants were washed and

sectioned according to their different plant parts (e.g Leaves, stipe,

rhizome, roots)

Individual plant parts were further segmented and subjected to surface

sterilization to eliminate microorganisms on the outer surface of the

plant The plant segments were surface sterilized in 95% ethanol for 10

seconds, 10% Chlorox for 2 minutes, 70% ethanol for 2 minutes and

then air-dried

2.10 Growth and isolation of endophytes

Plant segments were transferred onto the 5 different agar media The

five media types were LB Agar, M2 Agar, 2% Malt Extract Agar,

Glycerol-Arginine Agar and Soy Agar as described in (Bascom-Slack et

al., 2012) The growth of the endophytes was observed over a period of

three weeks Only bacterial and fungal endophytes growing out from

the cut ends of the plant segments were isolated

2.11 Molecular identification of isolated endophytes

The 16S rDNA of bacterial endophytes was PCR amplified using

primers 27F AGAGTTTGATCCTGGCTCAG- 3′) and 1492R

(5′-GGTTACCTTGTTACGACTT-3′) PCR amplification of the ITS rDNA of

fungal endophytes was performed using forward primer ITS5

GGAAGTAAAAGTCGTAACAAGG-3’) and reverse primer ITS4

(5’-TCCTCCGCTTATTGATATGC-3’) PCR products were sequenced and

subjected through BLASTn for identification

2.12 Organic extraction of secondary metabolites from endophytes

For extraction from bacterial endophytes, a single colony of the

bacterial endophyte was inoculated in 5ml of medium for 16 hours in a

37oC shaker 2ml of the overnight culture was then sub-cultured in

100ml of fresh medium for 24 to 72 hours for the optimum production of

secondary metabolites An equal volume of dichloromethane was

added and the mixture was gently swirled for 1 hour at 100rpm for

maximum extraction before being transferred to a separatory funnel

The mixture was left to separate overnight The dichloromethane

fraction (organic fraction) was collected and dried using a rotary

evaporator 1ml methanol was added to each of the dried extracts and

stored at -20°C

For extraction from fungal endophytes, 2 agar media of 4-weeks old

fungal endophytes were cut into small pieces, immersed in 100ml

dichloromethane and gently swirled for 1 hour at 100rpm The mixture

was left to separate overnight The dichloromethane fraction was

filtered with a cheese-cloth to remove any remaining fungal or agar

remnants The dichloromethane fraction (organic fraction) was

collected and dried using a rotary evaporator 1ml methanol was added

to each of the dried extracts, which were then stored at -20°C

Chapter Three:

The Induction of Phase 2 response by Heteroaromatic Quinols

3.0 The Induction of Phase 2 response by Heteroaromatic Quinols

3.1 Introduction

Nrf2 activity is mainly regulated via regulation of its stability

Under basal conditions, Nrf2 is highly unstable Keap1 plays an

essential role in the regulation of Nrf2 protein levels by binding to Nrf2

and targeting it to the Cullin-3-based E3 ubiquitin ligase complex for

ubiquitination (Figure 1.2) The poly-ubiquitination and subsequent

degradation of Nrf2 keeps Nrf2 protein levels low in the absence of

oxidative stress

Upon exposure to electrophilic agents and oxidative stress,

ubiquitination of Nrf2 by Keap1 is inhibited As a consequence, Nrf2

accumulates and binds to the antioxidant response elements (ARE) to

promote the transcriptional activation of cytoprotective drug

metabolizing and antioxidant genes in the phase 2 response (Itoh et al.,

1997) Since the activation of Nrf2 confers cytoprotection against

oxidative stress, it would be important to investigate novel Nrf2

inducers for the development of therapeutics against oxidative

stress-related diseases and cancer chemoprevention

In this study, the effects of heteroaromatic 4-arylquinols (which

below are referred to as quinol compounds) on Nrf2 and its

transcriptional activity were investigated The quinol compounds used

were PMX464, PMX290 and BW114 (Figure 3.1)

Figure 3.1 Chemical structures of PMX464, PMX290 and BW114

Heteroaromatic quinol analogues used in this study are shown above Michael acceptor groups are highlighted in green

The quinol compounds have previously been shown to have

antiproliferative activity in vitro and antitumor activity in vivo in colon,

breast and renal tumor xenografts (Wells et al., 2003; Berry et al.,

2005; Chew et al., 2008) Based on their chemical structure, the

Michael reaction acceptor group of the quinol compounds allows them

to readily react with nucleophiles such as the thiol groups of cysteine

residues (Figure 3.1 and Figure 3.2) For example, the quinol

compounds have been reported to interact with cysteine residues in the

active site of thioredoxin reductase resulting in its inhibition (Chew et

al., 2008; Bradshaw et al., 2005) The disruption of the thioredoxin