biochemical and structural studies of escherichia coli leucine-responsive regulatory protein

Transcription at the pap operon is regulated by a large number of proteins including the global regulator Lrp leucine-responsive regulatory protein and the pap-specific regulator PapI..

Santa Barbara

Biochemical and Structural Studies of Escherichia coli

Leucine-responsive regulatory protein

A Dissertation submitted in partial satisfaction

of the requirements for the degree of

Doctor of Philosophy

in Biochemistry and Molecular Biology

By Stephanie Snyder de los Ríos

Committee in charge:

Professor John J Perona, Chair Professor David Low Professor Kevin Plaxco Professor Herbert Waite March 2006

3206417 2006

UMI Microform Copyright

All rights reserved This microform edition is protected against unauthorized copying under Title 17, United States Code.

ProQuest Information and Learning Company

300 North Zeeb Road P.O Box 1346 Ann Arbor, MI 48106-1346

by ProQuest Information and Learning Company

Acknowledgements

Graduate school has been a long, hard road – one that I could not have traveled alone I would like to thank my advisor John Perona and all the past and present members of the Perona lab for their camaraderie, helpful advice, and friendship over the years Particularly, I’d like to thank Kate Newberry for her patience, sound advice, willingness to answer my (seemingly) constant questions, and great friendship I’d also like to acknowledge Kent Rossman for his willingness to teach me all about biochemistry, for pushing me to be independent, for setting a good example of optimism in the face of hardship, and for many years of friendship Above all, I’d like to thank my husband, Miguel, whose encouragement, enthusiasm, care, and concern makes everything better

Department of Chemistry and Biochemistry University of California, Santa Barbara Winter 2003 Teaching Assistant

Department of Chemistry and Biochemistry University of California, Santa Barbara

Winter 2005 Teaching Assistant

Department of Chemistry and Biochemistry University of California, Santa Barbara

2000-2006 Research Assistant

Department of Chemistry and Biochemistry University of California, Santa Barbara

de los Rios, S and Perona, J.J Crystal structure of Escherichia coli responsive Regulatory Protein Manuscript in preparation

Leucine-Youngblood, B., Shieh, F.-K., de los Rios, S., Perona, J.J., and Reich, N.O

Specificity Engineering of the DNA Methyltransferase HhaI Manuscript submitted

Fields of study

Major field: X-ray crystallography

Professor John J Perona

Minor field: Protein biochemistry

Professor John J Perona

Biochemical and structural studies of Escherichia coli Lrp

Transcriptional regulation of gene expression is an essential component for

the life of any organism For uropathogenic Escherichia coli, expression of the pap

genes, generating the structural and regulatory components of pap pili, has been seen

to be correlated with the ability of these bacteria to colonize and infect the urinary

tract Transcription at the pap operon is regulated by a large number of proteins

including the global regulator Lrp (leucine-responsive regulatory protein) and the

pap-specific regulator PapI Transcription activation is sensitive to the methylation states of the two GATC sequences contained within the pap promoter We have been

interested in studying specifically how these two regulators, Lrp and PapI, interact

with the pap promoter DNA using x-ray crystallography

Biochemical studies of Lrp and PapI were initiated to learn more about these proteins and enhance our ability to crystallize them A crystal structure of Lrp in

complex with one of its binding sites from the pap promoter has been solved to 3.2Å

While there is no clear electron density in the structure for the DNA, comparison of the Lrp structure and the homologous LrpA structure, crystallized in the absence of DNA, provide insight into conformational changes that may be related to DNA binding In addition, several Lrp mutants were made, with the goal of aiding crystal growth, that have shed light on the ability of Lrp to bind DNA and the role of cooperativity in this process

List of Figures and Tables………… ……… ix

1 Introduction………….………1

1.1 Overview of transcription regulation………… ……… …….1

1.2 The pap operon… ………4

1.3 Leucine-responsive regulatory protein (Lrp)……… 15

2 Purification and characterization of Lrp and PapI ……… ……… 19

2.1 Purification and characterization of Lrp … ……… …….20

2.1.1 Materials and Methods ……….20

Purification of Lrp………20

Biochemical characterization of Lrp……….… 21

Determination of Lrp activity……… 23

Purification and characterization of Selenomethionine Lrp…24 2.1.2 Results and Discussion 25

2.2 Purification and characterization of PapI ……… …….43

2.2.1 Materials and Methods 43

Purification of PapI……… 43

Biochemical characterization of PapI……… 44

Determination of PapI activity……….45

2.2.2 Results and Discussion 45

3 Crystal structure of Lrp …… ……… 56

3.1 Materials and Methods ……… ……… 56

Protein expression and purification……….56

DNA oligonucleotide purification……… 57

Crystallization and diffraction data collection……….58

Structure determination and refinement……… 59

Structure analysis……… … 60

Molecular replacement solution of alternate crystal form………… 62

Structure of the E coli Lrp dimer………63

Monomer Comparisons………69

Dimer Comparisons……… 73

Octamer Comparisons……… 77

Lrp Quaternary Structure……….85

Electrostatic Potentials and Putative DNA Binding Locations…… 87

DNA Binding Model……… 87

Conformational flexibility as related to DNA binding potential…….94

4 Purification and characterization of Lrp mutants ……… …97

4.1 Purification and characterization of Lrp truncation mutants …… 97

4.1.1 Materials and Methods 97

Mutation of Lrp and purification of truncation mutants… …97

Characterization of oligomerization state for LrpMN and LrpMC……… ……… ……100

Activity assays for truncation mutants……… 100

4.1.2 Results and Discussion 101

4.2 Purification and characterization of an apparent oligomer-breaking mutant of Lrp ……… 109

4.2.1 Materials and Methods 109

Mutation and purification of S110E and V148R Lrp…… 109

Characterization of V148R Lrp……… 109

Activity of V148R Lrp……… 112

4.2.2 Results and Discussion 112

5 References 123

Figure 1.1 Diagram of the pap operon……… … 5

Figure 1.2 Protein binding sites within the pap promoter………….………… …6

Figure 1.3 DNA sequence of the pap promoter region 8

Figure 2.1 SDS-PAGE gel of purified Lrp ………26

Figure 2.2 Mass spectrum of Lrp ……… 27

Figure 2.3 CD Wavelength scan of Lrp …… ………… 28

Figure 2.4 Thermal melting and unmelting of Lrp ……… 30

Figure 2.5 Chemical melt of Lrp ……….31

Figure 2.6 Gel filtration elution profile of Lrp ……….…33

Figure 2.7 Batch light scattering of Lrp ……… …34

Figure 2.8 On-line light scattering of Lrp.……… …35

Figure 2.9 Sedimentation equilibium analysis of Lrp ……37

Figure 2.10 Gel shift of 456 pap operon DNA by Lrp ……… 38

Figure 2.11 Lrp and 456 pap operon DNA binding curve ……… ….39

Figure 2.12 Mass spectrum of selenomethione-substituted Lrp … …41

Figure 2.13 SeMet Lrp and 456 pap operon DNA binding curve …… … … 42

Figure 2.14 SDS-PAGE gel of purified PapI ……….… 46

Figure 2.15 Mass spectrum of PapI ……… ….48

Figure 2.16 CD wavelength scan of PapI ……… ……50

Figure 2.18 Chemical unmelt of PapI.……… ……… … …52

Figure 2.19 Chevron plot for PapI ……54

Figure 2.20 Binding curves for 456 pap operon DNA and Lrp with or without PapI……… 55

Figure 3.1 Representations of the Lrp monomer, dimer, and octamer… … ….64

Figure 3.2 Superposition of E.coli Lrp, P Furiosus LrpA, and P OT3 FL11 monomers … 70

Figure 3.3 B Factor plot for 4 separately-built monomers of Lrp………….……72

Figure 3.4 Representation of the C-terminal dimer interface of Lrp … 74

Figure 3.5 Superposition of the Lrp and LrpA dimers ……….76

Figure 3.6 Comparison of the Lrp and LrpA octamers 78

Figure 3.7 Representation of the Lrp and LrpA octamer interfaces … 81

Figure 3.8 Superposition of Lrp and LrpA tetramers ……….83

Figure 3.9 Electrostatic surface potential diagram of Lrp 88

Figure 3.10 Lrp DNA binding model … 90

Figure 4.1 Sequence alignment of N- and C-terminal portions of Lrp with its homologs … ……… ……… ………… 99

Figure 4.2 Batch light scattering of LrpMN ……….103

Figure 4.3 On-line light scattering of LrpMN ………… ………104

Figure 4.4 Gel shift of Lrp truncation mutants with pap 456 DNA ….….…106

Figure 4.5 Representation of the four separately-built monomers of the Lrp crystal structure… … …… 108

of Lrp and LrpA ….……….110

Figure 4.7 Gel filtration elution profile for V148R Lrp…….……….113

Figure 4.8 On-line light scattering of V148R Lrp ………… 115

Figure 4.9 Sedimentation equilibrium results for wild-type and V148R Lrp….116

Figure 4.10 Comparison of gel shift for wild-type vs V148R Lrp with 456 pap

1 Introduction

The process of transcription is an integral part of life It is the method by which the genetic information stored in DNA is put to active use in the cell The DNA contains all the information that specifies the make-up of an organism Through the process of transcription, an exact copy of the information encoded in the DNA is made in the form of RNA The ribosomes then read the genetic code embedded in the RNA and synthesize the proteins specified by the DNA sequence It

is important for all life that proteins are made at the proper time Untimely production of proteins can be harmful to cells because some proteins can cause damage in the cell if produced at the wrong time, cells waste their energy supply producing unnecessary proteins, and production of unneeded proteins reduces production of other necessary proteins For these and other reasons, transcription is a highly regulated process

1.1 Overview of Transcription Regulation

Regulation of transcription is an essential process for the life of any organism The regulation is complex and involves many different processes Many factors influence the ability of a gene to be transcribed including: (1) specific sequences encoded within the DNA which serve as protein binding sites, (2) specific chemical modifications of the DNA which can alter protein recognition of these sequences, (3)

environmental factors which can influence protein binding to DNA sites, and (4) the overall structure (topology) of the DNA itself

Regulatory regions of DNA sequences, which are bound by proteins during transcription initiation, are called promoters There are some general promoters that occur with similar sequence in most genes and there also exist gene-specific promoters In prokaryotes, there are 3 promoter regions just upstream of the transcription start site: the TATA box at –10, the –35 element, and the UP element usually located at –40 to –60 These sequences are recognized directly by the RNA polymerase

The prokaryotic core RNA polymerase consists of 5 subunits: O2PP’Q Each Osubunit consists of a N-terminal domain, which self-dimerizes and interacts with the Pand P’ subunits, and a C-terminal domain, which binds DNA The P and P’ subunits constitute the catalytic domain of the enzyme The small Q subunit is not involved in transcription directly, but appears to serve as a chaperone for the P’ subunit (reviewed

in Browning and Busby, 2004) The core RNA polymerase is sufficient for transcription elongation, but not initiation For initiation, the core RNA polymerase requires a R subunit to make the holoenzyme The R factor is required for recognition

of specific promoter sequences, and there exist many distinct R factors within bacterial cells

In eukaryotic systems, transcriptional regulation is more complex Eukaryotic chromosomes are highly packaged, in contrast to prokaryotic DNA which is packed

to a lesser extent Therefore, the DNA needs to be unwound from its tightly coiled state in order for transcription factors or RNA polymerases to recognize their target sequences within the genome Specifically, the nucleosome structure, which comprises ~200 bp of DNA wound around an octameric histone core, must be released in order for eukaryotic genes to be transcribed In addition to the core subunits, RNA polymerase II (pol II), the enzyme responsible for synthesis of all mRNAs, also requires a host of general transcription factors in order for transcription

to occur at any promoter Specifically, 23 additional polypeptides are required to interact with the 12 subunits of pol II to initiate transcription, all of which show a one-to-one correspondence in yeast and human (reviewed in Kornberg, 1999) In addition to the general transcription machinery, there has recently been discovered a new complex of 20 polypeptides termed the mediator complex, which is required to mediate the interaction between the general transcription factors and gene-specific activators of transcription (reviewed in Myers and Kornberg, 2000; Kornberg, 2005)

Since eukaryotic transcription regulation is complex and involves many more variables, it is easier to study simpler systems, such as those in bacteria, to elucidate and gain knowledge of how this regulation occurs Prokaryotic transcriptional regulation is still a complex process One of the main differences from eukaryotes is that most bacterial operons are intrinsically active and must be actively repressed to

prevent transcription (reviewed in Struhl 1999) On the other hand, most eukaryotic genes are naturally repressed by the nature of DNA packaging in the nucleus and must be activated Activation of prokaryotic genes is also an important process to achieve high levels of RNA transcripts at the appropriate time

1.2 The pap operon

The transcriptional unit that I chose to use as a model system is the

Escherichia coli (E coli) pap (pyelonephritis-associated pili) operon This operon

contains structural and regulatory genes for the expression of pili on the surface of the bacteria (Figure 1.1) Pili are appendages of the bacteria that are attached to the cell wall, and that contain an adhesion protein on their tip These pili have been shown to

be involved in the ability of E coli to cause urinary tract infections (O'Hanley et al.,

1985), due to the binding of the tip protein PapG to receptors on epithelial cells of the urinary tract (Lund et al., 1987) The operon also codes for regulatory proteins that are involved in the transcriptional control of its two divergent promoters These promoters are separated by a distance of ~400 base pairs in which regulation of the

operon takes place (Figure 1.2) The expression of pap genes is controlled by a

mechanism of phase variation (reviewed in (van der Woude et al., 1996 and Hernday

et al., 2002)) The transcription of pap genes cycles between a phase OFF state and a

phase ON state This variation is regulated by a number of proteins Upstream of the pBA promoter, there are six binding sites for the leucine-responsive regulatory

Figure 1.1

Figure 1.1 Diagram of the pap operon The majority of the pili genes are transcribed

from the pBA promoter while only the small regulator PapI is transcribed from the divergent pI promoter The regulatory region that controls both promoters is

approximately 400 base pairs

Figure 1.2

Figure 1.2 Protein binding sites within the pap promoter The 400 base pair

promoter region for the pap operon contains binding sites for many regulatory

proteins Lrp binding sites are indicated in green, the CAP binding site is in red, and the PapB binding sites are blue Lrp binding sites 2 and 5 contain GATC sequences, the recognition sequence for Dam Note: drawing is not to scale

protein (Lrp) (Figure 1.2 and Figure 1.3) An Lrp dimer binds to each of its DNA binding sites and it binds cooperatively to three of its binding sites at a time (Nou et al., 1995) When Lrp binds to sites 1, 2, and 3, transcription at the pBA promoter is turned off When Lrp binds to sites 4, 5, and 6, transcription at the pBA promoter is turned on (Figure 1.4) Lrp binding is DNA methylation-dependent (Braaten et al., 1991) Lrp binding sites 2 and 5 both contain GATC sequences which can be methylated by DNA adenine methyltransferase (Dam) on the N6 position of the adenine base When Lrp is bound to sites 1, 2, and 3, Dam methylates site 5 (or GATCdist) Upon DNA replication, when the newly formed DNA is in a hemimethylated or unmethylated state, the Lrp can translocate to sites 4, 5, and 6 This opens up site 2 (or GATCprox) to Dam methylation The translocation of Lrp is

mediated by a small pap-encoded regulatory protein called PapI (Nou et al., 1995)

PapI is a small protein, ~8 kDa, which has homology to small regulatory proteins of other operons controlling pili gene expression such as DaaF, SfaC, FaeA which are involved in expression of F1845, S, and K88 pili, respectively (reviewed in Calvo and Matthews, 1994) PapI has been found to increase the affinity of Lrp specifically for the sequence ACGATC which is contained in both Lrp binding sites 2 and 5, as determined by missing contact footprinting (Hernday et al., 2003) In addition to Lrp and PapI, Dam has also been shown to be necessary for pap transcription Dam is a DNA-modifying enzyme that methylates the N6 position on adenines contained within the recognition sequence 5’-GATC-3’, using S-adenosyl-methionine as a

Figure 1.3 DNA sequence of the pap promoter region The transcription initiation

site for the pBA promoter is indicated at +1 The –10 and –35 regulatory regions are underlined for both the pBA and the pI promoters Coding sequences for gene

products are in italics while the start sites (atg) are in bold Lrp binding sites are in blue, the CAP binding site is in green, and PapB binding sites are in red Lrp binding site 3 is in purple as it overlaps with the PapB binding site

Figure 1.4

Figure 1.4 Phase ON vs Phase OFF When Lrp binds to sites 1, 2, and 3 of the pap operon, site 5 is methylated, and transcription at the pBA promoter is turned off When Lrp binds to sites 4, 5, and 6 in conjunction with PapI, site 2 is methylated, and transcription at the pBA promoter is turned on Lrp is depicted in green and PapI is depicted in red

cofactor (Geier and Modrich, 1979) Dam’s methylation of GATC sequences has roles in chromosome replication, gene expression, mismatch repair, and nucleoid

structure (reviewed in Lobner-Olesen et al., 2005) E coli strains that are Dam- are still viable, though other bacteria such as Vibrio cholerae and Yersinia pseudotuberculosis require Dam function (reviewed in Low et al., 2001)

In E coli strains that contained a function-blocking mutation of Dam (Damstrain) or overproduced Dam, transcription of the pap genes was abolished (Braaten

-et al., 1994) In addition, E coli strains that contained mutations in the GATC sequences of the pap regulatory region (GATC GCTC) showed the importance of

methylation to the phase variation system When GATCprox was mutated, transcription was in a locked OFF state, showing that methylation of this site is essential for transcription to occur When GATCdist was mutated, the cells were in a locked ON state, demonstrating that methylation of GATCdist is required for the phase OFF state (Braaten et al., 1994)

The global regulator CAP has also been shown to be necessary for transcription at the pBA promoter CAP activates transcription by binding to promoter regions in the presence of the small effector cAMP and interacting with RNA polymerase to help initiate transcription (reviewed in Lawson et al., 2004)

CAP binding at -215.5 (relative to the pBA promoter) is required for activation of pap

transcription (Forsman et al., 1992) Interestingly, the CAP binding site is located far

from the transcription start site while it is commonly located nearer to the RNA

polymerase binding site in other CAP-regulated operons It has been reported that the

promoter-proximal CAP subunit is essential for transcription at the pBA promoter, and specifically activating region 1 (AR1) of this CAP subunit is required for its activity (Weyand et al., 2001)

In addition to PapI, another small pap-specific regulatory protein has been shown to be involved in the regulation of pili expression, PapB PapB is an 11 kDa protein that has been shown to have two binding sites within the pap promoter region There is a high-affinity PapB site located just upstream of the CAP binding site and a lower-affinity PapB site located near the –10 region of the pBA promoter (Forsman et al., 1989; Forsman et al., 1992) The two sites with different affinities provide an explanation for how PapB can act as both an activator and a repressor of transcription

at the pBA promoter When relatively small populations of PapB are present in the cell, it will bind first to its high affinity site, where it can help induce its own transcription Mutations within the high affinity PapB binding site that disrupted PapB binding showed reduced transcription from the pBA promoter (Xia et al., 1998) Upon production of elevated quantities of PapB protein, it will then bind to its lower affinity site located at the –10 region of the pBA promoter and repress its own transcription by sterically interfering with RNA polymerase binding PapB has been seen to cover a large footprint of the promoter DNA region, and results have

suggested that PapB may bind the promoter in an oligomeric fashion (Xia et al., 1998)

Other regulatory proteins that are not required for activation or repression, yet

appear to regulate pap transcription are the histone-like protein H-NS (heat-stable

nucleoid-structuring), the 2-component regulator CpxAR, and RimJ, an

N-acetyltransferase H-NS is a universal transciption repressor in E coli that has an

affinity for binding curved DNA In addition, H-NS has been seen to self-associate as well as form interactions with other proteins (reviewed in Dorman, 2004) H-NS has

been shown to be able to repress transcription of the pap genes, although its role is

not completely understood In an hns- strain, pap transcription was seen to increase

two-fold (van der Woude et al., 1995) This mutation also abolishes the requirement

of CAP for pap transcription In the phase OFF state, both Lrp and H-NS can act as

repressors of pBA, though H-NS is not required for repression When H-NS was absent, phase variation still occurred, but the OFF to ON frequency was diminished nine-fold as compared with wild-type cells (van der Woude et al., 1995) It has also been demonstrated that H-NS can repress pBA in the absence of Lrp, but the pap regulatory regions are not required for this repression, as repression occurred even

upon deletion of the promoter upstream of the –35 region

The CpxAR two-component regulatory system, which regulates gene expression in response to a number of environmental stimuli, is involved in the stress

response for maintaining and protecting the bacterial envelope CpxA is a membrane-localized kinase which when activated leads to an abundance of phosphorylated CpxR (CpxR-P) which acts as a transcription factor to activate or occasionally repress transcription of target genes (Raivio and Silhavy, 1997) Initially, it was reported that the induction of the CpxAR response led to an increase

in pap piliated cells, or promotion of the phase ON state (Hung et al., 2001) After

more rigorous experimentation, it appears that production of CpxR-P by activation of the CpxAR regulatory system is responsible for a reduction in the phase ON state and transcription of the pBA genes (Hernday et al., 2004) Introduction of cpxA mutants that increase cellular levels of CpxR-P were shown to reduce phase OFF to ON switching Specifically, it was shown that CpxR-P competes with Lrp for binding of

both the proximal and distal Lrp sites within the pap operon, leading to a reduction in transcription (Hernday et al., 2004) UV and DnaseI footprinting of CpxR-P/pap

promoter DNA complexes containing the six Lrp binding sites indicated protection of the Lrp binding sites by CpxR-P Interestingly, the binding of CpxR-P appears to be

methylation-independent since incubation of CpxR-P with methylated pap DNA

sequences showed no effect on its binding affinity

RimJ was implicated in the regulation of the pap operon by a study of the thermoregulatory control of transcription of the operon Transcription of pap pili has

been seen to not occur at low temperatures of 23°C (Blyn et al., 1989) The RimJ protein was observed to restore thermoregulatory control of pap transcription in

mutants that did indeed transcribe pap pili at low temperatures (White-Ziegler and

Low, 1992) Further study of a RimJ deletion strain indicated that in addition to temperature responsiveness, it appears that RimJ regulates transcription of the pBA promoter in response to the richness of the media that cells are grown in or the glucose levels in the media (White-Ziegler et al., 2002) RimJ regulates transcription

by inhibiting the phase OFF to ON transition

1.3 Leucine-responsive Regulatory Protein (Lrp)

The Lrp monomer is an 18.8 kDa protein which contains a purported terminal helix-turn-helix (HTH) DNA binding domain This motif consists of a short -helix, a turn which generally includes a glycine residue, and a second short -helix called the recognition helix which forms specific base contacts with the interacting DNA molecule The Lrp sequence contains the elements of this motif, although the recognition helix consensus sequence is not evident within the Lrp sequence The other domain of the protein contains residues which are important for dimerization, oligomerization, leucine-binding, as well as transcriptional activation Mutations of the Lrp protein localized to the N-terminal purported HTH domain have been seen to abolish the DNA binding ability of the protein (Platko and Calvo, 1993) Likewise, Lrp mutations in the C-terminal domain reduce the protein’s ability to activate transcription and have decreased its responsiveness to the small molecule effector leucine (Platko and Calvo, 1993)

N-Lrp has been proposed to be both a global regulator of transcription in E coli

and possibly a packaging protein that establishes DNA conformation in the cell Lrp has a role in organizing metabolism in the cell as it regulates several dozen operons mostly relating to amino acid biosynthesis and degradation, oligopeptide transport, and nitrogen assimilation (reviewed in Calvo and Matthews, 1994) Also, it is highly conserved among other bacteria with over 90% identity to homologous proteins in

Salmonella typhimurium, Enterobacter aerogenes, and Klebsiella aerogenes (Friedberg et al., 1995) About 3000 molecules of Lrp are present in a typical E coli

cell, representing from 0.1 – 0.2% of the total protein per cell Its transcription is fairly stable under most conditions This number of molecules per cell is on the order

of non-histone DNA binding proteins such as HU, IHF, Fis, and H-NS, which are proteins that are known to establish DNA structure Add to this the fact that Lrp is capable of bending DNA and a role in chromosomal organization is not unlikely One Lrp dimer has been shown to bend DNA by 52° and 2 dimers binding at adjacent positions has been shown to bend DNA by 135° using a circular permutation assay (Wang and Calvo, 1993)

An interesting aspect of Lrp regulation is its ability to bind leucine In E coli,

Lrp is seen to behave in three different ways among the promoters to which it binds For some promoters, the binding of leucine to Lrp increases transcription levels In other promoters, leucine binding has the opposite effect and causes a decrease in

transcription levels In the third case, leucine binding has no effect at all The pap

operon falls into the third category and leucine binding is not seen to affect the rate of

transcription

Another interesting aspect of Lrp is its self-association into large oligomers Initially, it was reported that Lrp exists as a homodimer in solution (Willins et al., 1991) However, upon further investigation, it was discovered that the dimer exists mainly at concentrations less than 1 uM while at higher concentrations, there appears

to be a mixture of octamers and hexadecamers in solution (Chen et al., 2001a) Since Lrp reportedly binds to one of its DNA binding sites as a dimer (Cui et al., 1996), it is interesting to speculate whether higher order oligomeric states such as octamers or hexadecamers of Lrp dissociate upon binding of DNA or whether it uses its quaternary structure to its advantage to facilitate DNA wrapping by binding multiple

binding sites at a time

Crystal structures of two Lrp homologs from archaea, LrpA from Pyrococcus furiosus and FL11 from Pyrococcus OT3, have been solved (Leonard et al., 2001; Koike et al., 2004) The P furiosus LrpA structure reveals an symmetric octameric

form of the protein arranged as a ring of dimers with a large central hole The monomer of LrpA contains two domains, an N-terminal helix-turn-helix domain and

a C-terminal O/P domain which forms a large majority of the dimer interface The

Pyrococcus OT3 FL11 structure, while revealing very similar monomeric and dimeric

forms of the protein as in the LrpA structure, is instead orgainized as a cylindrical helix with 12 dimers of FL11 per turn Neither of these crystal structures contains the

small molecule effector, leucine, nor DNA

The role of Lrp in E coli is complex By using the pap operon as a model

system, we hope to understand its role in this particular operon and extend this

information to better understand its role on a global scale in E coli The role of Lrp

in the pap operon is very intriguing, considering the similarity of its different binding

sites, the role of DNA methylation, and the presence of other regulators such as PapI, CAP and PapB

2 Purification and characterization of Lrp

and PapI

The leucine-responsive regulatory protein is a global transcription regulator in

E coli It has been actively studied for many years, most notably with regard to its regulation of the ilvIH operon and the pap operon The solution of the crystal

structure has been sought in the past In order to generate large quantities of purified Lrp for crystal trials, the established purification protocol (Matthews et al., 2000) was modified Due to the myriad of quarternary structures that Lrp can reportedly form, further biochemical characterization of Lrp was performed in order to better understand the protein and to better identify methods for crystallization In addition,

a selenomethionine-substituted Lrp was produced and purified substituted proteins are commonly used to determine crystal structures as the selenium atoms can serve as anomalous scatterers within the crystal to enable structure solution via the method of multi-anomalous diffraction (MAD) PapI has been studied primarily by David Low and coworkers in relation to its involvement in

Selenomethionine-the switch of Selenomethionine-the pap operon In order to generate large quantities of this protein for

crystal trials and further studies, a purification protocol was generated which produced highly purified PapI protein Due to the instability of PapI, further characterizations were performed on this protein to understand more about PapI and how to better work with it

2.1 Purification and characterization of Lrp

2.1.1 Materials and Methods

Purification of E coli Leucine-resposive regulatory protein

E coli Lrp was expressed in E coli strain JM105 containing the plasmid

pJWD1 (Ernsting et al., 1993) Cells grown in LB media were induced with 0.5 mM IPTG at OD600=0.8 and then shaken for a further 2.5 hours at 37ºC Cells were pelleted, resuspended in 50 mM potassium phosphate (pH 7.4), 0.1 M NaCl, 0.1 mM EDTA, 10 mM P-ME, 10% glycerol (PC buffer), and then lysed by French press A protease inhibitor tablet (Roche) and PMSF to a final concentration of 0.05 mM were added to the lysate The cleared lysate was loaded onto a P-11 phosphocellulose column (Whatman) and washed with PC buffer Lrp was eluted with a linear NaCl gradient from 0.1 – 1 M Fractions containing Lrp were pooled and dialyzed into 10

mM Tris (pH 7.4), 200 mM NaCl, 0.1 mM EDTA, 10 mM beta-mercaptoethanol ME), 10% glycerol (Buffer A) The dialyzed sample was loaded onto a Macroprep High S Support cation exchange column (Biorad) and washed with Buffer A Lrp was eluted with a linear NaCl gradient from 0.1 – 1 M Fractions containing Lrp were pooled, concentrated, and dialyzed into 10 mM Tris (pH 7.4), 200 mM NaCl, 0.1 mM EDTA, 10 mM P-ME, 50% glycerol to a final concentration of 25 mg/ml Six liters of cells yielded about 50 mg of Lrp

(P-Biochemical characterization of Lrp

To determine if the Lrp produced and purified from E coli was the expected

molecular weight, mass spectrometry was performed on the purified sample The Lrp was extensively dialyzed into water in order to remove the salts in the sample Lrp exhibited limited solubility in the unbuffered solution as evidenced by extensive precipitation in the dialyzed sample The sample was centrifuged for 10 minutes to spin down all precipitate The final concentration of the sample to be used for mass spectrometry was at a concentration of 100 µM The sample was diluted into and injected onto the column in a 50% methanol, 2% formic acid solution and was analyzed by electrospray ionization mass spectrometry with the help of James Pavlovich in the UCSB Department of Chemistry Mass Spectrometry Facility

To determine if the purified Lrp protein was folded and to assess its overall secondary structure characteristics, a circular dichroism (CD) wavelength scan was performed on an Aviv 202 titrating CD spectrometer Lrp was diluted to 0.1 mg/ml

in a 50 mM potassium phosphate (pH 7.0) solution, and ellipticity was monitored at room temperature between 200 and 250 nm In addition, temperature and chemical equilibrium melts of Lrp were performed to assess its stability and ability to refold A 0.1 mg/mL solution of Lrp in 50 mM potassium phosphate (pH 7.0) was monitored at

220 nm by CD, incrementally increasing the temperature from 25 to 95°C, then repeating the experiment in the reverse direction A chemical equilibrium unfolding

melt for Lrp was performed and monitored at 220 nm by titrating guanidine HCl from

0 to 7 M into a 0.1 mg/ml solution of Lrp in 50 mM potassium phosphate (pH 7.0)

To determine the oligomeric state of purified Lrp, a host of experiments were performed including gel filtration, light scattering, and analytical ultracentrifugation Gel filtration was performed via FPLC using an AKTApurifier system (Pharmacia) equipped with a Superdex S-200 column (fractionation range of 10,000 to 600,000 Da) The column was run at a flow rate of 1 ml/min in the buffer 10 mM Tris (pH 7.4), 250 mM NaCl First, molecular standards (Biorad) were run to determine the average elution time with various molecular weight proteins A 2.6 mg/ml sample of Lrp was then loaded onto the column Absorbance of the resulting fractions was monitored at 280 nm

All light scattering measurements were done on a Wyatt miniDAWN equipped with a laser at 690 nm Light scattering measurements were attempted in two different ways First, a batch measurement was taken by filling a microcuvette with a 0.2 mg/ml sample of Lrp For batch measurements, Lrp was kept in its storage buffer containing 50% glycerol Data were collected at adetector 90° relative to the incident light and averaged over 5 s Light scattering was also attempted in-line following a gel filtration column For in-line light scattering measurements, Lrp was dialyzed into a buffer of 20 mM Tris (pH 7.4), 0.2 M NaCl, 0.5 mM EDTA, 1 mM DTT A Superdex 200 column (Amersham) was hooked up in line to the

miniDAWN The mobile phase for the column was the same as the buffer into which Lrp was dialyzed A Biocad HPLC was used to pump the mobile phase over the column at 0.6 ml/min The setup was normalized first with the protein standard BSA

An Lrp sample of 2 mg/ml was loaded onto the column

Analytical ultracentrifugation experiments were performed at Amgen Inc with the generous help of Dr Yatin Gokarn Briefly, a 2 mg/ml sample of Lrp dialyzed into 10 mM Tris (pH 7.4), 200 mM NaCl, 0.1mM EDTA, and 10 mM P-ME was spun in the AUC for 5 hours at x speed at room temperature The cell content migrations were monitored at a wavelenth of 280 nm

Determination of Lrp activity

To determine if the purified Lrp was active and able to bind to its DNA binding sites with high affinity, a gel shift assay was performed DNA containing Lrp

binding sites 4, 5, and 6 of the pap operon was labelled with 32P-ATP Primers for

amplification of the 456 Lrp binding sites of the pap promoter were obtained from

IDT The primer sequences were ACATTTTGCGTTTTATTTTTCTGC and TAATAGCAAGAGGGTACTCAGATA The 456 binding site was obtained by PCR amplification using the above primers and cycling 30 times from 92°C for 30 seconds, to 49°C for 30 seconds, and to 72°C for 90 seconds, producing a 118 bp oligomer The 456 DNA was then labeled by kinasing with ]-32P-ATP The DNA, at

5’-a fin5’-al concentr5’-ation of 10 nM, w5’-as mixed with polynucleotide kin5’-ase (PNK), PNK buffer, and ]-32P-ATP The reaction was allowed to proceed for 30 minutes at 37°C Purification of the labeled DNA was not performed before gel shift assays For the actual gel shift assay, a binding mix was prepared containing 40 mM Tris (pH 7.5),

60 mM KCl, 0.1 mM EDTA, 1 mM DTT, 5% glycerol, 80 mM NaCl, 18 µg/ml herring sperm DNA, 20 µg/ml BSA, and 0.05 fmol/µl of the labelled DNA Dilutions

of Lrp were made into 40 mM Tris (pH 7.5), 60 mM KCl, 0.1 mM EDTA, 1 mM DTT, 1 mg/ml BSA from 0 to 100 nM To the binding mix, varying concentrations

of Lrp were added and the mixture was incubated at 37°C for 20 minutes The binding reactions were loaded onto a 6% native acrylamide gel and run in 0.5X TBE for 2 hours at 250 V at room temperature An image plate was exposed overnight with the gel and was analyzed by phosphorimager The bands on the gel were quantified with the program Imagequant and the data was fit to an exponential binding curve using Kaleidagraph

Purification and characterization of Selenomethionine Lrp

Selenomethionine-substituted Lrp (SeMet) was also grown in E coli strain

JM105 Cells were grown in M9 minimal media supplemented with selenomethionine During the growth, the methionine biosynthesis pathway was inhibited by addition of high concentrations of isoleucine, leucine, valine, phenylalanine, and threonine Cells were induced with 0.5 mM IPTG at OD600 = 0.8

and shaken overnight at 37°C The purification of SeMet Lrp was identical to that of wild-type Lrp except that all buffers were degassed and contained 20 mM P-ME to prevent oxidation of selenomethionine residues To determine if the SeMet Lrp actually contained incorporated selenomethione, the protein was dialyzed extensively into water, then electrospray ionization mass spectrometry was performed with the aid of James Pavlovich in the UCSB Department of Chemistry Mass Spectrometry

Facility The ability of SeMet Lrp to bind Lrp sites 456 of the pap operon was

analyzed by gel shift as done for wild-type Lrp

2.1.2 Results and Discussion

Lrp was successfully purified from E coli cells to ~99% purity as determined

by SDS-PAGE (Figure 2.1) Mass analysis using electrospray ionization mass spectrometry showed an observed mass of 18,760 Da for Lrp (Figure 2.2) The calculated mass of an Lrp monomer is 18,887, so the observed mass can be interpreted to be the full- length Lrp protein minus the initial methionine residue (molecular weight of ~131 Da) which is probably cleaved off in the bacteria Therefore, the results of mass spectrometry demonstrate that the full length Lrp protein was indeed present after cell growth and purification CD spectroscopy was used to analyze both the folded state of Lrp as well as its ability to refold The results

of the wavelength scan from 200 to 250 nm show a single broad peak centered between 210 and 220 nm (Figure 2.3) While secondary structure predictions using

Figure 2.1

Figure 2.1 An SDS-PAGE gel of purified Lrp Lane 1 contains molecular markers, lane 2 contains 30 µg purified Lrp, and land 3 contains 50 µg purified Lrp

Figure 2.2

Figure 2.2 The mass spectrum of Lrp as obtained by ESI MS The mass/charge ratio

is plotted on the x-axis vs intensity of the signal of the y-axis A typical envelope of charged protein species is shown with 11 to 25 charges per Lrp monomer Deconvolution of the spectrum gives a molecular mass of Lrp of 18,756 Da