1. Trang chủ
  2. » Luận Văn - Báo Cáo

Báo cáo nông nghiệp:" Ảnh hưởng của Mucuna pruriens đến sự biểu hiện gen tổng hợp catecholamine trên mô não chuột" doc

7 395 0
Tài liệu đã được kiểm tra trùng lặp

Đang tải... (xem toàn văn)

THÔNG TIN TÀI LIỆU

Thông tin cơ bản

Định dạng
Số trang 7
Dung lượng 0,92 MB

Các công cụ chuyển đổi và chỉnh sửa cho tài liệu này

Nội dung

J. Sci. Dev. 2011, 9 (Eng.Iss. 1): 84 - 90 HANOI UNIVERSITY OF AGRICULTURE EFFECT OF MUCUNA PRURIENS ON CATECHOLAMINE BIOSYNTHETIC ENZYME GENE EXPRESSION IN RAT BRAIN Ảnh hưởng của Mucuna pruriens đến sự biểu hiện gen tổng hợp catecholamine trên mô não chuột Nguyen Thi Hiep 1 , Truong Thi Thanh Mai 2 , Bui Thai Hang 1 , Kim Sung Jun 3 1 College of Food Industry, Da Nang City, Vietnam 2 College of Education – University of Danang, Da Nang City, Vietnam 3 College of Science, Chosun University, Gwang ju, Korea Corresponding author email: bluebio203@gmail.com Received date: 13.04.2011 Accepted date: 05.05.2011 TÓM TẮT Để xác định ảnh hưởng của Mucuna pruriens (MP) đến sự biểu hiện của một số gen tổng hợp catecholamine, nghiên cứu này xác định sự thay đổi của hàm lượng mRNA và protein của tyrosine hydroxylase (TH) và aromatic l- amino acid decarboxylase (AADC). TH là enzyme thứ nhất và AADC là enzyme thứ hai trong chu trình tổng hợp catecholamine. Hàm lượng mRNA của TH và AADC được xác định trong mô não của chuột bằng kỹ thuật RT- PCR. Hàm lượng protein được xác định bằng kỹ thuật Western blot. Chuột được nghiên cứu với liều lượng MP khác nhau (0, 100, 200, 300 và 400 mg/kg) lần lượt trong thời gian 2 giờ và 4 giờ. Kết quả chỉ ra rằng MP làm tăng cả hàm lượng mRNA và protein của TH và AADC ở liều lượng 400 mg/kg trong 2 giờ và ở liều lượng 200 mg/kg trong 4 giờ. Kết quả này cho biết, MP có ảnh hưởng tích cực đến sự biểu hiện của TH và AADC gen và mức độ ảnh hưởng đó phụ thuộc vào liều lượng cũng như thời gian sử dụng MP. Từ khóa: AADC, biểu hiện gen, catecholamines, TH. SUMMARY To determine the effect of Mucuna pruriens (MP) on the catecholamine biosynthetic enzyme encoding genes, we determined changes in mRNA and protein levels of tyrosine hydroxylase (TH) and aromatic l- amino acid decarboxylase (AADC), the first rate – limiting and the second enzyme in the catecholamine biosynthetic pathway. TH and AADC mRNA levels were examined in rat brain tissue by RT- PCR. Protein levels were determined by Western blot analysis. Rats were treated with different doses of MP (0, 100, 200, 300 and 400 mg/kg) for 2 and 4 hrs The results showed that the MP significantly increased the levels of TH and AADC mRNA and protein at a dose of 400 mg/kg for 2 hrs and at a dose of 200 mg/kg for 4hrs, respectively. These results indicated that MP has significant effects on the expression of TH and AADC genes and the level of expression depends on the treatment dose and duration of administration. Key words: AADC, catecholamines, gene expression, TH. 1. INTRODUCTION Parkinson’s disease (PD) is the most common neurodegenerative movement disorder and affects over six million people all over the world (Licker et al., 2009). This disease is a degenerative disease of the nervous system due to the progressive loss of nigrostriatal dopaminergic neurons and decrease in striatal dopamine. Dopamine is produced by dopaminergic neuronal cells and is one of three main neurotransmitters (dopamine, norepinephrine and epinephrine) called "catecholamines". Tyrosine hydroxylase (TH) is the first and rate-limiting enzyme in the biosynthesis of catecholamines, which is neurotransmitter involved in a variety of important physiological functions (Milsted et al., 2004). The regulation of TH protein level and activity represents a central means for controlling catecholamine synthesis (Kumer et al., 1996). Changes in TH expression generally reflect altered activity of dopaminergic neurons in brain. 84 Effect of Mucuna pruriens on catecholamine biosynthetic enzyme gene expression in rat brain The aromatic l- amino acid decarboxylase (AADC) is the second enzyme in the catecholamine biosynthesis. AADC is a non-specific enzyme mainly implicated in the synthesis of dopamine and serotonin through the decarboxylation of a substrates (L-DOPA), 5-hydroxytryptophan in neuronal and non-neuronal cells (Yuichi Okazaki and Yoshikazu Shizuri, 2001). Unlike other enzymes which are involved in catecholamine biosynthetic pathway, AADC is still generally considered not to be limiting in regulating of catecholamine biosynthesis. Nevertheless, some recent studies concerning the regulation of AADC in vivo and in vitro through phosphorylation indicate that this enzyme may play the role in regulation of catecholamine biosynthesis (Waymire and Haycock, 2002). The immobilization stress stimulation induced also increases in TH and AADC activity (Kubovcakova et al., 2004; Micutkova et al., 2003). Seeds of Mucuna pruriens (MP) have been described as an useful therapeutic agent in various diseases of the human nervous and reproductive system including PD in the ancient Indian medical system (Manyam et al., 2004). MP contains L-dopa (5%), 5-indole compounds (tryptamine and 5- hydroxytriptamine), and four tetrahy- droisoquinolines alkaloidals (Eustace et al, 2006; Misra and Wagner, 2004). In addition, MP consists of co-enzyme Q-10 and nicotinamide adenine dinucleotide (NADH), which have neuroprotective activities (Manyam et al., 2004). Although many researches have focused on the therapeutic effects of natural plant extracts, however, until now, there are few researches on genetic analysis of catecholamine biosynthetic enzyme genes induced by MP. Therefore, in this study, we analyzed the effects of MP on the gene expression of TH and AADC, the first rate – limiting and the second enzyme in the catecholamine biosynthetic pathway, 2. MATERIALS AND METHODS 2.1. MP sample preparation The fresh seeds of MP (from Gwang-ju city, South of Korea) were collected by removing peel and then ground to a paste by grinder. This powder was kept in deep freezer -70 0 C and freezing-dry. A total of 100g of the dry powder was completely dissolved in 100ml of saline before use. 2.2. Animal experiments Male Sprague-Dawlay rats, 6 ~ 8 weeks of age and weights from 250~300g were used in all experiments. Animals were housed four per cage and under controlled environmental conditions (12 hrs light / dark cycle and room temperature 25 ± 2 o C. Food and water were supplied all the time. Rats were treated by MP powder dissolved in saline with dose of 100, 200, 300 and 400 mg/kg each for 2 and 4 hrs (each group = 5 rats). The control groups received the same volume of saline instead of MP. 2.3. Total RNA isolation and relative quantification of mRNA levels by Reverse transcriptase polymerase chain reaction (RT – PCR) Total RNA was isolated from frozen brain tissues by using the Trizol TM reagent (Invitrogen Co. USA). Reverse transcription was performed from 4 μg of total RNA samples using oligo (dT) primer and Moloney murine leukemia virus ribonuclease (M-MLV) (BioNEER co. Korea) according to the manufacturer’s instructions. Quality of cDNA was verified by PCR amplification of β-actin. The cDNA was stored at - 20 o C for further using. The determining of catecholamine synthesizing enzymes, TH, AADC as well as housekeeper β-actin gene expression was carried out by RT-PCR. Specific primers, annealing temperatures, number of cycles and size of each fragment for TH, AADC and β-actin mRNA are shown in table 1. PCR products were analyzed on 1.2% agarose gel in 0.5 X TBE (Tris-Boric acid- EDTA) buffers containing EtBr. Intensity of individual bands was evaluated by Gel Quant software (DNR Bio-Imaging Systems Ltd.). Table 1. Oligonucleotide sequence of primers used in PCR for amplification Genes Sequences of primers Temp.of annealing No. of cycles Size of fragment Gene Reference TH 5’ GCTGTCACGTCCCCAAGGTT 3’ 3’ TCAGACACCCGACGCACAGA 5’ 64 0 C/45’’ 35 380bp M10244 AADC 5’ CTTCAGATGGCAACTACTCC 3’ 3’ CTTCGGTTAGGTCAGTTCTC 5’ 60 0 C/45’’ 35 345 bp U31884 β-actin 5’ CCTCTATGCCAACACAGT 3’ 3’ AGCCACCAATCCACACAG 5’ 56 0 C/45’’ 30 155 bp BC063166 85 Nguyen Thi Hiep, Truong Thi Thanh Mai, Bui Thai Hang, Kim Sung Jun Table 2. Antibodies used for western blot assay Antibodies Species Dilution Source Primary antibodies Anti-TH (0MA-04051) Anti-AADC (ab3905) Actin Mouse (monoclonal IgG1) Rabbit polyclonal Mouse (monoclonal IgG1) 1:2000 1:1000 1:2000 Affinity Bio Reagents Abcam plc Biomeda crop. Secondary antibodies HRP conjugated(Sc-2054) HRP conjugated(Sc-2055) Goat-anti-mouse IgG1 Goat-anti-rabbit IgG1 1:1000 1:1000 Santa Cruz Biotechnology Santa Cruz Biotechnology 2.4. Total protein isolation and western blot analysis Total protein was separated in the organic phase during the preparation of total RNA and subsequently precipitated with isopropanol, and then it was washed three times with 0.3 M guanidine hydrochloride. After washing with 70% ethanol, protein was dried and dissolved in 1% SDS. Protein concentration was determined by using a Bicinchoninic acid (BCA) protein assay kit (Cabres Co. USA). Bovine serum albumin (BSA) (Sigma-Aldrich Co. USA) was used as the standard. Total 10 μg of protein isolated from brain tissue was separated by sodium dodecyl sulphate- polyarylamide gel (SDS-PAGE; 5% stacking gel and 10.5% separating gel) and then transfered to a polyvinylidene fluoride (PVDF) membrane. Non- specific binding sites were blocked by immersing the membranes in 3% BSA in Tris- buffered saline Tween (TBST) for overnight at 4 o C on a shaker. Levels of the TH and AADC immunoreactive protein were determined using TH and AADC primary antibody (Table 2). After membranes washed several times with washing buffer TBS-T, the membranes were incubated with primary anti- TH and AADC antibody for 2hrs at 4 o C, followed by incubation with secondary antibodies (Table 2) for 2hrs at room temperature. The same amount of protein was loaded and reacted with anti-mouse actin antibody (Table 2) which was used for normalization of protein loading. All primary antibodies and secondary antibodies were diluted in TBS-T solution. To reveal the reaction bands, the membrane was reacted with WEST-ZOL (plus) Western blot detection system (Intron Biotechnology, Inc.) and exposed to X-ray film (BioMax MS-1, Eastman Kodak). A digital image system was used to determine the density of the bands (Gel Quant, DNR Bio-Imaging Systems Ltd.). 2.5. Statistical analysis Data were presented as mean ± S.E.M. Results were evaluated by Student’s test and by one- way analysis of variance (ANOVA). A value of P ≤ 0.05 was considered statistically significant. 3. RESULTS 3.1. Effects of MP on TH and AADC mRNA levels expression in rat brain tissue To determine the effects of MP on the catecholamine biosynthetic enzyme genes, we determined changes in mRNA level of TH and AADC, the first rate-limiting and the second enzyme in this pathway. TH and AADC mRNA levels were examined by RT-PCR. Rats were treated with different doses of MP (0, 100, 200, 300, and 400 mg/kg) each for 2 and 4 hrs. As shown in Fig.1 and Fig. 2, TH and AADC mRNA levels increased in dose-dependent manner. However, the AADC mRNA level was less than TH mRNA level. In particular, at 2 hrs TH mRNA increased by 2.2 ± 3 folds (P<0.001), while AADC mRNA level rose to 1.86 and 2 folds with doses 300 mg/kg, 400 mg/kg, respectively. At 4hrs, TH mRNA level increased sharply and was higher than AADC mRNA level, the highest expression (TH mRNA 7.4 times (P<0.0001) and AADC mRNA 1.3 times (P<0.05)) was observed with dose 200 mg/kg. The expression of TH and AADC mRNA levels depend on MP doses and duration of administration. 86 Effect of Mucuna pruriens on catecholamine biosynthetic enzyme gene expression in rat brain Con 100 200 300 400 (mg/kg) TH AADC β-actin 380 pb 345 pb 150 pb (㎎/㎏) Con 100 200 300 400 Relative gene expression 0.0 0.5 1.0 1.5 2.0 2.5 TH AADC ** ** ** ** Con 100 200 300 400 (mg/kg) TH AADC β-actin 380 pb 345 pb 150 pb Con 100 200 300 400 (mg/kg) TH AADC β-actin 380 pb 345 pb 150 pb Con 100 200 300 400 (mg/kg) TH AADC β-actin 380 pb 345 pb 150 pb (㎎/㎏) Con 100 200 300 400 Relative gene expression 0.0 0.5 1.0 1.5 2.0 2.5 TH AADC ** ** ** ** (㎎/㎏) Con 100 200 300 400 Relative gene expression 0.0 0.5 1.0 1.5 2.0 2.5 TH AADC (㎎/㎏) Con 100 200 300 400 Relative gene expression 0.0 0.5 1.0 1.5 2.0 2.5 TH AADC ** ** ** ** Relative gene expression Figure. 1. The effects of MP on the TH and AADC mRNA levels in rat brain tissue at after 2hrs treatment. Values (n=5/group) are presented as mean ± S.E and compared by one-way ANOVA and Tukey’s test: *P<0.05 and ** P< 0.001 versus control Con 100 200 300 400 (mg/kg) TH AADC β-actin 380 pb 345 pb 150 pb * (㎎/㎏) Con 100 200 300 400 Relative gene expression 0 2 4 6 8 TH AADC ** ** * Con 100 200 300 400 (mg/kg) TH AADC β-actin 380 pb 345 pb 150 pb Con 100 200 300 400 (mg/kg) TH AADC β-actin 380 pb 345 pb 150 pb Con 100 200 300 400 (mg/kg) TH AADC β-actin 380 pb 345 pb 150 pb * ) (㎎/㎏ Con 100 200 300 400 Relative gene expression 0 2 4 6 8 TH AADC ** ** * * ) (㎎/㎏ Con 100 200 300 400 Relative gene expression 0 2 4 6 8 TH AADC (㎎/㎏) TH AADC ** ** * 0 2 4 6 8 Relative gene expression Relative gene expression Con 100 200 300 400 Figure. 2. The effects of MP on the TH and AADC mRNA levels in rat brain tissue at after 4hrs treatment. Values (n=5/group) are presented as mean ± S.E and compared by one- way ANOVA and Tukey’s test: *P<0.05 and ** P< 0.001 versus control Con (mg/kg) 87 Nguyen Thi Hiep, Truong Thi Thanh Mai, Bui Thai Hang, Kim Sung Jun 3.2. Effect of MP on TH and AADC protein level expression in rat brain tissue The protein levels of TH and AADC were determined by western blot analysis at 2 and 4 hrs after treatment. All different doses of MP induced TH and AADC protein levels at 2hrs. TH protein levels increased significantly at 1.34, 5.62, 6.92 and 9.74 folds with the doses of 100, 200, 300, 400 mg/kg, respectively (Fig. 3), AADC protein levels increased highly significantly at a dose of 100 mg/kg by 2.53 times. But only doses of 200 mg/kg and 300 mg/kg have significantly upregulated the TH protein for 4hrs, while doses of 100 mg/kg and 400 mg/kg showed the down regulation (Fig. 4). AADC protein levels did not change at different doses of MP in the 4hrs treatment. The above results indicate that TH and AADC protein levels were significantly up regulated with the treatment of MP. (㎎/㎏) Con 100 200 300 400 Relative protein levels 0 2 4 6 8 10 TH AADC * ** ** ** (㎎/㎏) Con 100 200 300 400 Relative protein levels 0 2 4 6 8 10 TH AADC * ** ** ** (㎎/㎏) Con 100 200 300 400 Relative protein levels 0 2 4 6 8 10 TH AADC (㎎/㎏) TH AADC * ** ** ** 0 2 4 6 8 10 Relative protein levels Relative protein levels Con 100 200 300 400 Figure. 3. The effects of MP on the TH and AADC protein levels in rat brain tissue at after 2hrs treatment. Values (n=5/group) are presented as mean ± S.E and compared by one- way ANOVA and Tukey’s test: *P<0.05 and ** P< 0.001 versus control (㎎/㎏) Con 100 200 300 400 Relative protein levels 0 1 2 3 TH AADC * ** ** (㎎/㎏) Con 100 200 300 400 Relative protein levels 0 1 2 3 TH AADC * ** ** (㎎/㎏) Con 100 200 300 400 Relative protein levels 0 1 2 3 TH AADC (㎎/㎏) * ** ** TH AADC Con 100 200 300 400 Relative protein levels 0 1 2 3 Relative protein levels Figure. 4. The effects of MP on the TH and AADC protein levels in rat brain tissue at after 4hrs treatment. Values (n=5/group) are presented as mean ± S.E and compared by one- way ANOVA and Tukey’s test: *P<0.05 and ** P< 0.001 versus control 88 Effect of Mucuna pruriens on catecholamine biosynthetic enzyme gene expression in rat brain 4. DISCUSSION The seed powder of MP has been used in traditional Ayurvedic India medicine for disease therapy including PD. All compounds of MP seed have been identified by several studies (Eustace et al., 2006; Misra 2004). These researches showed that MP has high contents of crude protein, amino acids, total phenols, tannins and, especially, L- dopa. In additional, MP contains co-enzyme Q-10 and nicotinamide adenine dinucleotide (NADH), which have neuroprotective activities (Manyam et al., 2004). MP treatment is known to increase the dopamine content in the rat brain and MP exhibited twice the antiparkinsonian activity compared with synthetic levodopa (Manyam et al., 2004). Furthermore, synthetic levodopa causes drug – induced dyskinesias in majority of patients with PD. MP, however, is reputed to provide anti- parkinsonian benefits without inducing dyskinesias (Christopher et al., 2010). The regulation of TH and AADC expression has attracted much attention in the field of neurology. Indeed, the biological function of TH and AADC is very important for the dopamine biosynthesis as well as for brain function under physiological and pathological conditions. The study of Duan et al., (2005) found that the expression of TH and AADC genes could fulfill the function of dopamine synthesis. The present study was carried out to evaluate the effects of MP on the catecholamine biosynthetic enzyme genes, particularly TH and AADC. The results showed that the levels of TH mRNA and protein increased significantly at different doses of MP at both 2hrs and 4hrs treatment. Similarly, the AADC mRNA and protein levels rose slightly at different doses of MP at 2hrs treatment. In contrast, the level of AADC protein did not change at different doses of MP at 4hrs after treatment. The levels of TH mRNA and protein are always higher than those of AADC at different doses of MP during the treatment period. These results indicate that MP has a complex and different effect on TH and AADC gene expression in the rat brain tissue. 5. CONCLUSIONS The present study shows that both catecholamine biosynthetic enzymes encoding genes TH and AADC were up – regulated by the treatment of MP. The expression of TH and AADC genes depends on MP doses and duration of administration. Thus, MP may provide a platform for future drug discoveries and novel therapy strategies for PD. Acknowledgements This work was support by a reseach grant provied by Chosun University, 2007. REFERENCES Christopher A. Lieu, R. Kunselman Allen, V.Manyam Bala, Venkiteswaran Kala, and Subramanian Thyagarajan. (2010). A water extract of Mucuna pruriens provides long – term amelioration of parkinsonism with reduced risk for dyskinesias. Parkinsonism and related disorders. 16: 458 – 465. Duan Chun- Li, Yue Su, Chun –Li Zhao, Qun – Yuan Xu and Hui Yang.(2005). The assays of activities and function of TH, AADC and GCH1 and their potential use in ex vivo gene therapy of PD. Brain Research Protocols. 16: 37 – 43. Eustace A lyayi, Holger Kluth and Markus Rodehutscord.(2006). Chemical composition, antinutritional constituents, precaecal crude protein and amino acid digestibility in three unconventional tropical legumes in broilers. J Sci Food Agric. 86: 2166 – 2171. Katzenschlarger R, Evans A, Manson A, P N Patsalos, N Ratnaraj, H Watt, L Timmermann, R Van der Geissen, A J Lees.(2004). Mucuna pruriens in Parkinson’s disease: a double blind chinical and pharmacological study. J Neuol Neurosurg Psychiatry.75: 1672 -1677. Kumer S.E. and K. E. Vrana (1996). Intricate regulation of tyrosine hydroxylase activity and gene expression. Jounal of neurochemistry. 67: 443-462. Kubovcakova L., O. Krizanova and R. Kvetnansky (2004). Identification of the aromatic L-amino acid decarboxylase gene expression in various mice tissued and its modulation by immobilization stress in stellate ganglia. Jounal of neuroscience.126: 375-380. Licker V, E Kovari, D. F. Hochstrasser, P. R. Burkhard (2009). Proteomics in human Parkinson’s disease research. J Proteomics 73: 10-29. Manyam B.V., M. Dhanasekaran., and T.A. Hare (2004). Neuroprotective effects of the 89 Nguyen Thi Hiep, Truong Thi Thanh Mai, Bui Thai Hang, Kim Sung Jun Antiparkinson drug Mucuna Pruriens. Jounal of Phytotherapy Research. 18: 706-172. Manyam B.V., M. Dhanasekaran, and T. Hare (2004). Effect of antiparkison drug HP-200 (Mucuna pruriens) on the central monoaminergic neurotransmitters. Phytother Res. 18: 97-101. Milsted A., L. Serova, E.L. Sabban, and G. Dunphy (2004). Regualtion of tyrosine hydroxylase gene transcription by Sry. Neuroscience Letters. 369: 203-207. Misra L. and H. Wagner (2004). Alkaloidal constituents of Mucuna pruriens seeds. Phytochemistr. 65: 2565 - 2567. Yuichi Okazaki and Yoshikazu Shizuri. (2001) Identification of the aromatic l- amino acid decarboxylase (AADC) gene and its expression in the attachment and metamorphosis of the barnacle, Balanus amphitrite. J develop Growth Differ. 43: 33 – 41. Waymire J.C., and J.W. Haycock (2002). Lack of regulation of aromatic L-amino acid decarboxylase in intact bovine chromaffin cells. Jounal of Neurochemistry. 81:589-593. 90 . EFFECT OF MUCUNA PRURIENS ON CATECHOLAMINE BIOSYNTHETIC ENZYME GENE EXPRESSION IN RAT BRAIN Ảnh hưởng của Mucuna pruriens đến sự biểu hiện gen tổng hợp catecholamine trên mô não chuột Nguyen. TẮT Để xác định ảnh hưởng của Mucuna pruriens (MP) đến sự biểu hiện của một số gen tổng hợp catecholamine, nghiên cứu này xác định sự thay đổi của hàm lượng mRNA và protein của tyrosine hydroxylase. protein của TH và AADC ở liều lượng 400 mg/kg trong 2 giờ và ở liều lượng 200 mg/kg trong 4 giờ. Kết quả này cho biết, MP có ảnh hưởng tích cực đến sự biểu hiện của TH và AADC gen và mức độ ảnh hưởng

Ngày đăng: 07/08/2014, 02:21

TỪ KHÓA LIÊN QUAN

TÀI LIỆU CÙNG NGƯỜI DÙNG

TÀI LIỆU LIÊN QUAN

🧩 Sản phẩm bạn có thể quan tâm