nghiên cứu bệnh xoăn vàng cà chua do Begomovirus gây ra tại hà nội và phụ cận doc

Tomato yellow leaf curl virus isthe most important disease in the Tomato plant in tropical and temperate zone.. Recently, based on the molecular analysis, have at least three begomovirus

I Introduction 1

1.2 Objectives and Requirements 2

1.2.1 Objectives: 2

1.2.2 Requirement: 2

II Literature review 2

2.1 Researches in the world 2

2.2 Host range 2

2.3 Symptoms 3

2.4 Cause agent 3

2.5 Vector and transmitation of Begomovirus 3

III.Material and method 4

3.1 Location and duration of the study 4

3.2 Materials 4

3.3 Methodology 5

3.3.1 Field surveying 5

3.3.2 Collecting and storing samples 5

3.4 Research method 5

3.4.1 Survey methodology in prevalence and white fly density on the field 5

3.4.2 DNA extraction 6

3.5 PCR test: 7

3.5.1 PCR testing: 7

3.5.2 Conducting PCR: 8

3.5.3 PCR product electrophoresis: 9

IV Result and discussion 10

4.1 The survey field 10

4.1.1 Describe the symptoms in the field 10

4.1.2 Survey and white fly density of disease on the field 12

4.2 PCR test results tomato samples collected in the field 15

V Conclusion and suggestion 19

5.1 Conclusion: 19 5.2 Suggestion: 19

LIST OF TABLE

Table 4.1.2.1 Tomato yellow leaf curl and white fly density development on F1 hybrid andVL2000 in fall-winter 2010 in Phu Chan-Bac Ninh……… 12Table 4.1.2.2 Tomato yellow leaf curl and white fly density development on Hong Chau andVL101 in fall-winter 2010 in Dong Anh-Ha Noi ………14Table 4.1.2.3 Tomato yellow leaf curl and white fly density development on Chanoka and C155

in spring - summer 2011 in Vo Cuong -Bac Ninh ………16Table 4.2 PCR test results tomato samples collected in the field ……….18

Faculty of Agronomy Hanoi University of Agricultural

Advance crop science program Progress reports: SUBJECT ADVANCED RESEARCH PROGRAM 2010-2011

I Introduction

Tomatoes have been attacked by many species of virus Tomato yellow leaf curl virus isthe most important disease in the Tomato plant in tropical and temperate zone

The reason of Tomato yellow leaf curl are complicated This disease is considered a

com-plex disease, meaning that a virus disease caused by many species of the genus Begomovirus,Geminiviridae cause The begomovirus with morphological dual spherical molecule (the conver-sion) and genomic DNA strands within the application, size of about 2.6 to 2.8 kb Begomovirusdoes not transport through seed but it can move around field by whitefly

( Bemisia tabaci)

There are about 40 species of Begomovirus tomato have been published around theworld On tomatoes, the same Begomovirus create typically symtoms: leaf ( figure bent spoons),margin (specially in young leaves) turn yellow, narrow leaves, stunted plant with early infectionrate very low fruits set Identity can only virus know to be based on molecular analysis

Recently, based on the molecular analysis, have at least three begomovirus species werefound to cause disease in tomato leaf curl Vietnam include Vietnam Tomato leaf curl virus(ToLCVV), Tomato yellow Vietnam leaf curl virus (TYLCVNV) and Tomato yellow leaf curlKanchanaburi (TYLCKaV) Of the three species, two species were isolated in samples of tomatoyellow leaf curl disease in the North is ToLCVV and TLCVNV

Also based on molecular analysis, Vietnam appears to be the center of diversity ofbegomovirus Despite the number of begomovirus species of plants identified in Vietnam is stillsmall, including only 19 species were isolated from many plants, including many wild species are

In 2009, Le Van Hai was isolated three begomovirus, which have not been detected inVietnam The determination of correctly species virus’s name only use when we define the order

of DNA-A The result above show that many of Begomovirus species cause disease on tomato

and other crop in Vietnam should be determined So we realized the topic: “ Investigating,study,

diogonistic Begomovirus virus on Tomato.”

1.2 Objectives and Requirements

- Diagnostic tomato disease due to Begomovirus

II Literature review

2.1 Researches in the world.

There are many diseases in tomato, according to statistics of CABI, 2005, currently; thereare 499 kinds of harmful pests on tomato, which has 49 species of virus Although diseasescaused by a virus only take a small fraction of all pathogen on tomato, but massive damage to thetomato-growing region in the world Therefore, damage of tomato virus disease have been manyscientists around the world are interested now, research on biology, ecology and transmissionmethods to provide best effective preventive measures

2.2 Host range

Host range of Begomovirus is abundent, includes crops and weeds In whichBegomovirus TYLCV have broad host range over 63 different species According to Zakay(1991) indicate that tomatoes (L.esculentum) are the main host of virus Besides these types oftomatoes as L.chinense, L.hirsutum, L.peruvianum, L.pimpinellifolium are carried symptoma

by vius TYLCV An additional some plant are the host range of virus: Eustoma grandifloum,Petunia, Phaseolus Vulgans, tobacco (Nicotinana tabacum), jimson weed (stramonium Datuna )

2.3 Symptoms

Symptoms of Yellow leaf curl appear within 2-4 weeks After the diseases and the fulldevelopment of symptoms within 2 months Symptoms may vary according to environmentalconditions and physiological conditions of plants at the time of infection Symptoms as early as

in the curved bottom and sides The latter are not shaped, yellow cramped from the top of theleaf to the veins of the leaf, leaf turn to spoon shape, young leaf turn yellow, brittle, stems can betwisted, stunted, grow much small branch Infected trees are not flowering

is the basic strands as single strand, DNA B strand includes two genes

2.5 Vector and transmitation of Begomovirus

Bemisia tabaci (Homoptera: Aleyrodidae), commonly called tobacco, cotton, or

sweetpotato whitefly, is a cosmopolitan pest of eastern origins, likely from Pakistan or India It isvery polyphage, infecting more that 600 plant species and it is very damaging outdoors,particularly in sunny and hot conditions Its development rate mainly depends on temperature,humidity, and plant host quality The average life cycle length ranges from 17 to 27 days, andcan be completed in 12-14 days or 43-49 days in hot or cold conditions, respectively Its range ofdevelopmental temperatures is very wide, being most favourable between 16 and 24°C

Temperatures below 9°C and above 40°C are lethal to the insect The optimum RH for insectdevelopment is between 30-60% Oviposition can be impaired by rain, extreme temperatures,

and low humidity Like most whiteflies, Bemisia tabaci is arrhenotokous Females can regulate

the sex of their progeny by selective eggs fertilization Fertilized females lay diploid and haploideggs, up to 300 per female The former give rise to females and the latter to males Theunfertilized females only lay haploid eggs The proportion of males to females is usually 1:1, butcan vary with the season and environmental conditions The progeny sex ratio is also affected by

insect age Young females lay more female-producing eggs than older females The insectacquires the virus while feeding on the plant, reaching the phloem cells with its stylet The viruspasses through specific cells within the gut wall into the body cavity to enter the haemocoel,where it accumulates before passing out of the insect during feeding via the salivary glands Thisvirus circulation inside the insect accounts for the latent transmission period that ends once thevirus reaches the salivary glands and the insect becomes viruliferous

III.Material and method

3.1 Location and duration of the study

- Areas surrounding Ha Noi

- The laboratory of The Research Center for Tropical Plant Pathology, Hanoi University ofAgriculture

- Reagents and buffers/solutions

Buffer for DNA extraction

 CTAB + β ME

 NaOH 0.5M

3.3 Methodology

3.3.1 Field surveying

All the plants that have symptoms such as yellowing, curling was counted on field Therate of pathology causes on plants is determined by the infected plants over the total plants onfield

The criteria for surveying: Disease prevalence (the percentage of diseased plants pertotal surveyed plants)

3.3.2 Collecting and storing samples

- Collecting samples: all the leaves that have typical symptom of begomovirus infection werecollected into bag with full information below:

+ Name of sample

+ Location, time

+ The characteristics of disease

- Storing samples: there are two methods for storage samples after being taken from field

+ Dry storage: samples are dried in plastic bags containing self-indicating silica gel andstored in same way

+ Fresh storage: samples are stored at -200C

3.4 Research method

3.4.1 Survey methodology in prevalence and white fly density on the field

- Investigating disease rotation: base on TC10CN-224-85 Plant Protection Department

- 7 days / recurring, 5 points angled for each breeding, 50 individual of tomato / point in largefield and all of plant in small one

- Prevalence of white fly density: 5 points angled for each breeding, random 20 leaves / point

Ratio of disease

Number of disease Prevalence (%) = —————————— x 100

Total plant investigated

White fly density:

Total white fly investigatedWhite flies desity (individual / leaf ) = ———————————

Total of leaves investigated

3.4.2 DNA extraction

There are two methods for DNA extraction from leaf tissue:

(i) using CTAB

Step1:

- Adding 0.1 g fresh tissue or 0.02 g dry tissue in tube 1.5ml

- Adding 0.5 ml CTAB buffer + βME which keep at 60oC in 10 minute and melting

- Keep at 60oC in 10 minute and put in room temperature

Step 2:

- Adding 0.5 ml mixed (Chloroform : isoamyl alcohol 24:1) shaking

- Centrifugal 12.000/ minute in 10 minute, sucking the solution above of precipitateand put it into new tube (0.35ml)

Step 7: DNA residue dried in the air at least 30 minute.

Step 8: Dissolve DNA residues in 0.1 ml pure water 2 times and kept at -20oC

(ii) Using NaOH 0.5M for fast DNA extraction

- 50 mg leaf tissue of soybean into tube 1.5 ml

- 0.5 ml NaOH 0.5M into tube

- Dilute 50-100 times by Tris 0.1M, pH = 8

3.5 PCR test:

3.5.1 PCR testing:

* The primers used in PCR

- General primers for Begomovirus DNA-A is BegoAReV1 & BegoAFor1 (Ha et al, 2006)BegoAReV1: 5’- ATHCCMDCHATCKTBCTiTGCAATCC*-3’

BegoAFor1: 5’- TGYGARGGiCCiTGYAARGTYCARTC* -3’

* Y (C / T), R (G / A), H (A / C / T), M (A / C), B (C / G / T), D (A / G / T), K (G / T) and

i = inosine

- Specific primers ToLCVV (product = 454 bp)

+ Downstream primer is ToLCVV (product = 454bp)

(Location 1254) 5’ GACCAGTCTGAAGGTGTGAGTTC 3’ (Location 1276)

+ Up stream primer is ToLCVV –R2-sp-species :

(Location 1683) 5’ACTCAAGCTATAAAGAATACCTAGAC 3’ (Location 1708)

- Specific primer TYLCVNV (product = 1386 bp):

+ Dowstream primer is TYLCVNV-F1-sp- sequence :

(Location 1094) 5’ TGTGTTACATATTCTGTGTTTTCC 3’ (Location 1117)

+ Upstream primer is TYLCVNV- R1 - sp- sequence:

(Location 2456) 5’ AAATACATCAAAATCTGCAGAGAGC 3’ (Location 2480)

- Specific primers DNA-β of begomovirus BetaFor2 & BetaRev2

primer R : 0,3µlDream Tag : 0,2 µl

Total volume : 25µ

+ Processing PCR

* PCR products were electrophoresis on 1% agarose gel prepared with TAE buffer and

containing 0.5 mg / ml ethidium bromide

* Gels were run on mobile devices is the Mini - Sub Cell (Biorad) with TAE buffer at

100 V voltage for 30 - 40 minutes

* Gel examined under ultraviolet light and photographed using a dedicated camera ordigital camera

IV Result and discussion 4.1 The survey field

4.1.1 Describe the symptoms in the field

In Vietnam, tomato yellow leaf curl disease is considered to be the cause of serious damage ontomatoes in all cases during the year: spring-summer, early winter, main winter season, spring-winter, summer- autumn, especially spring-summer and early winter tend to more severedamage, a higher prevalence

Diagnosis and detection of symptoms as a skeleton in research as well as in plantprotection Diagnostic of plant diseases in general and tomato yellow leaf curl (TYLCV) inparticular has many different methods, including simple methods can be carried out on the field

is the observed symptoms disease

Tomato was being attacked with several species of insects and diseases in the field.Symptoms caused by insects such as chew, bite of wound, leaf, stem often easy to spot Thesymptoms caused by the disease particularly difficult to identify compared with the pathogensout of typical symptoms, easily confused with abiotic diseases (diseases caused by unfavorableenvironmental causes) Tomato disease with typical symptoms: curly top of the plant, causingcurled leaves, stunted plant, flowers grow less, vulnerable to loss Infected at a young stage, itwill be curly faster; plant can not grow fast, no flower to wither

Based on the typical symptoms of the leaf culf disease are described in the virusliterature, we conducted observations, diagnosis and collected some samples in Hanoi and someother provinces (Thanh Hoa, Phu Tho,Nam Dinh) Samples obtained by shooting up leaves inplastic bags, sealed bags and tie off Sample is dried immediately by Silicagel, secret preserved,away from moisture to keep the concentration of virus in the sample

TH1 TH4

TH2 TH3

4.1.2 Survey and white fly density of disease on the field

VL2000 in fall-winter 2010 in Phu Chan-Bac Ninh

Table 4.1.2.1 Tomato yellow leaf curl and white fly density developmenmt on F1 hybrid and

VL2000 in fall-winter 2010 in Phu Chan-Bac Ninh

development

Prevalence (%)

Whitefly density (individual/leaf)

Prevalence (%)

White fly density (individual/leaf)

The results in table 4.1.2.1 showed that both hybrid toamato F1 and breeds VL2000 were

infected by tomato yellow leaf culf Tomato VL2000 has a higher prevalance than F1 hybrid

At green fruit stage prevalence was highest in two varieties: F1 was 10.20 % andVL2000 was 11.6% VL2000 infected earlier thanh F1 hybrid.

It appeared in branching stage in F1 with prevalence was about 0.40% and the samedisease appear early from seeding stage to the prevalence was 0.40% in VL2000 When tomatowas coming to green fruit stage prevalence of disease increase fastly F1 was from 8.00 % to 9.30 % ( up1.3%), VL2000 was from 9.2 % to 10.00% ( up 0.8%)

Whitefly density development was not good White Fly density was higher in VL2000than F1 hybrid White fly density increased from branching stage and highest in the greeningfruit stage It was small rain in 15th and 16 th October, white fly density has reduced on the nextday of survey (0.46 individual/ leaf) 31/10/2010 density of White fly 0.78 individual/leaf in F1and 0.80 like VL2000 Thank to reduced of temperature density of white fly on the two varietieswere dropped

Two varieties of tomato had low prevalence of yellow leaf culf if we have well take carelinked to IPM method That mean we have high revenue

4.1.2.2 Tomato yellow leaf curl and white fly density developmenmt on Hong Chau and VL101 in fall-winter 2010 in Dong Anh – Ha Noi

Table 4.1.2.2 Tomato yellow leaf curl and white fly density developmenmt on Hong Chau and VL101 in fall-winter 2010 in Dong Anh – Ha Noi