Báo cáo Y học: A nonphosphorylated 14-3-3 binding motif on exoenzyme S that is functional in vivo pot

In this study we have identified the amino acid residues on ExoS, which are responsible for its specific interaction with 14-3-3.. Moreover, in vivo an ExoS protein lacking the 14-3-3 bind

A nonphosphorylated 14-3-3 binding motif on exoenzyme S

that is functional in vivo

Maria L Henriksson1,2, Matthew S Francis2, Alex Peden4, Margareta Aili2, Kristina Stefansson1,

Ruth Palmer3, Alastair Aitken4and Bengt Hallberg1

1

Department of Medical Biosciences/Pathology, Umea˚ University, Sweden;2Department of Molecular Biology, Umea˚ University, Sweden;3Umea˚ Center for Molecular Pathogenesis, Umea˚ University, Sweden;4Membrane Biology Group, Division of Biomedical and Clinical Laboratory Sciences, University of Edinburgh, Scotland

14-3-3 proteins play an important role in a multitude of

signalling pathways The interactions between 14-3-3 and

other signalling proteins, such as Raf and KSR (kinase

suppressor of Ras), occur in a phospho-specific manner

Recently, a phosphorylation-independent interaction has

been reported to occur between 14-3-3 and several proteins,

for example 5-phosphatase, p75NTR-associated cell death

executor (NADE) and the bacterial toxin Exoenzyme S

(ExoS), an ADP-ribosyltransferase from Pseudomonas

aeruginosa In this study we have identified the amino acid

residues on ExoS, which are responsible for its specific

interaction with 14-3-3 Furthermore, we show that a

peptide derived from ExoS, containing the 14-3-3 interaction

site, effectively competes out the interaction between ExoS and 14-3-3 In addition, competition with this peptide blocks ExoS modification of Ras in our Ras modification assay We show that the ExoS protein interacts with all isoforms of the 14-3-3 family tested Moreover, in vivo an ExoS protein lacking the 14-3-3 binding site has a reduced capacity

to ADP ribosylate cytoplasmic proteins, e.g Ras, and shows

a reduced capacity to change the morphology of infected cells

Keywords: ADP-ribosylation; coenzyme binding site; cyto-toxicity; NAD-dependent; peptide inhibitor

Members of the 14-3-3 family function as adaptor or

scaffold proteins and appear to interconnect different

proteins involved in signal transduction, cell cycle regulation

and apoptosis (reviewed in [1–3]) Studies in other model

systems have also shown that 14-3-3 proteins are essential

for Drosophila melanogaster and yeast cell proliferation and

survival [4–7] 14-3-3 proteins have been shown to interact

with phosphoserine-containing peptides, within a defined

consensus-binding motif Some well-described 14-3-3

bind-ing partners include the protein kinases Raf-1 [8], kinase

suppressor of Ras-1 [9], Ask1 [10], mitogen-activated

protein kinase/extracellular signal-regulated kinase kinase

[11], Bcr [12] and protein kinase C [13] In addition, 14-3-3

proteins also interact in a phospho-specific manner with the

pro-apoptotic protein Bad [14] and the transcription factor

Forkhead [15]

Analysis of the crystal structural of 14-3-3 proteins has

revealed that all isoforms of 14-3-3 exist as a dimer, which is

made up of a conserved concave surface, a so-called

amphipathic groove, and a more variable outer surface in

each monomer [16–19] It has been verified by both

mutational analysis and crystal studies that the basic cluster

in the amphipathic groove is involved in mediating the interaction of 14-3-3 with the phosphorylated residues in its interaction partners [20,21]

In addition to the defined interaction of 14-3-3 proteins with phosphoserine-containing motifs [22], there are also several reports showing an interaction between 14-3-3 and nonphosphorylated substrates [23–32] It is presumed that there are structural similarities between the phosphorylated and nonphosphorylated 14-3-3 ligands The best studied nonphosphorylated ligand for 14-3-3 is R18, an artificial peptide isolated from a phage display library as a 14-3-3 binding sequence, which assumes an extended conformation

in the amphipathic groove in a manner similar to that observed for the phosphorylated peptides and interacts with 14-3-3 with high affinity [33]

14-3-3 has also been shown to interact with Exoenzyme S (ExoS) in an unphosphorylated manner and recently we have shown that 14-3-3 interacts with the C-terminal region

of ExoS [27–29] ExoS is a bi-functional toxin, encoded by the pathogen Pseudomonas aeruginosa ExoS contains a C-terminal ADP-ribosyltransferase activity, which blocks receptor-stimulated Ras activation through a modification

of Ras in vivo [34–36] It has also been reported to contain

an N-terminal Rho GTPase-activating protein (GAP) activity in vitro [37] and in vivo [34]

Since the interaction between ExoS and 14-3-3 has been suggested to be important for the ADP-ribosylation activity

of ExoS, and more intriguingly appears to be independent

of serine-phosphorylation, we wanted to define the amino acid sequence required for the ExoS interaction with 14-3-3 and its resultant activity both in vitro and in vivo We have approached these questions by using deletion and substitu-tion analysis of ExoS both in vitro and in vivo Various

Correspondence to B Hallberg, Department of Medical Biosciences/

Pathology, Umea˚ University, S-901 87 Umea˚, Sweden.

Fax: +46 90 77 14 20, Tel.: +46 90 785 25 23,

E-mail: Bengt.Hallberg@medbio.umu.se

Abbreviations: ExoS, Exoenzyme S; NADE, p75NTR-Associated

cell Death Executor; GAP, GTPase-activating protein;

HRP, horseradish peroxidase.

(Received 22 March 2002, revised 16 August 2002,

accepted 20 August 2002)

mutant ExoS proteins were tested for their capacity to

interact with 14-3-3 and subsequently for their

ADP-ribosylation potential using Ras as a substrate both in vitro

and in vivo

Here we identify the binding site on ExoS for 14-3-3

interaction and show that it harbours a short amino acid

sequence (DALDL) with similarities to the peptide sequence

(WLDL) of R18 In addition, we also show that a peptide

containing the interaction determinant of ExoS acts as an

efficient competitor for both 14-3-3 : ExoS binding and the

resulting activation of 14-3-3-dependent ExoS

ADP-ribosy-lation activity We show that the ExoS proteins interact with

all isoforms of the 14-3-3 family Finally, we show that the

DALDL sequence is necessary for the ADP-ribosylation

activity and the cytotoxic action of ExoS in vivo

M A T E R I A L A N D M E T H O D S

Cell cultures, cell lysis

HeLa cells were grown in RPMI 1640 supplemented with

10% (v/v) fetal bovine serum and 100 UÆmL)1penicillin

Following bacterial infection (80 min) cells were washed in

ice-cold NaCl/Piand lysed on ice in lysis buffer [1% (v/v)

Triton X-100, 100 mM NaCl, 50 mM Tris/HCl pH 7.5,

1 mM EDTA supplemented with protease inhibitors

(10 lgÆmL)1aprotinin, pepstatin and leupeptin)] Lysates

were subsequently cleared by centrifugation at 14 000 r.p.m

for 10 min at 4C Lysates were precleared with purified

glutathione S-transferase (GST) Lysates were incubated

with GST-fusion proteins for 1 h prior to the addition of

Glutathione Sepharose (Amersham Pharmacia Biotech) for

30 min After three washes in lysis buffer, samples were

boiled in SDS/PAGE sample buffer

Western analysis, peptide and antibodies

Anti-14-3-3b was from Santa Cruz; monoclonal Ras

(R02120) was from Transduction Laboratories;

anti-phos-pho-Erk, phospho-Akt, pan-Erk were from Cell Signaling

Technology; epidermal growth factor (EGF) was from UBI

Immunoblotting was performed according to the

manufac-turer’s instructions using secondary antibodies conjugated

to horseradish peroxidase (HRP) sheep anti-mouse or

rabbit antibodies (Pierce and ECL Plus, Amersham

Phar-macia Biotech) A synthetic peptide, purified by

reverse-phase HPLC and characterized by MS, corresponding to

the putative 14-3-3 binding domain of ExoS (QSGHSQG

LLDALDLASKP), was purchased from Agrisera AB

(Sweden)

Plasmids

pGEX-ExoS(SD), was derived from wild-type ExoS

(pTS103) [38] as follows Primers were designed to introduce

flanking 5¢-ClaI site (shown in italic type), 5¢-CAGGTCCG

GAATCGATGTCAGCGG-3¢, at position 1101, 3¢-NdeI/

NotI restriction sites (shown in italic type) 5¢-CCCCTCGT

CTCACCGGTATACCGCCGGCGCGAG-3¢, at position

1251, 5¢-NotI/NheI ( 5¢–GCTCGCGGCCGCAGCTAGCA

AACCGGAACGTTCAGG-3¢), at position 1277, and

3¢-EcoRI (5¢-TACGACGAATTCGGCCAGATCAAG

GC-3¢), at position 1359 over the area to be substituted

PCR from wild-type ExoS was carried out using these primers PCR products were subsequently inserted into a pGEX-2TK-ExoS(88–453) opened with ClaI–EcoRI to produce pGEX-ExoS(SD) pGEX-ExoS(SD) is mutated

at amino acid positions 419–423 from SQGLL to MAAAA and deleted from amino acid 424 to 428 The substitution mutants, 2TK-ExoS(S1), pGEX-2TK-ExoS(S2) and pGEX-2TK-ExoS(S3), were then con-structed by digesting pGEX-2TK-ExoS(SD) with NdeI/ NheI and insertion of oligomers corresponding to the appropriate amino acid substitutions, as outlined in Fig 1B All constructs were sequenced using the DYEnamic.ET terminal cycle sequencing kit (Amersham-Pharmacia) pGEX-2TK-ExoS(88–453), pGEX-2TK-ExoS(400–453), pGEX-2TK-ExoS(366–453), pGEX-2T-14-3-3-zeta and pRSET-Ha-Ras were expressed as described previously [29,39,40]

Competition analysis 14-3-3 (250 nM) was preincubated for 30 min at 37C with increasing amounts of peptide, and then transferred into a mixture containing (in a final volume of 20 lL): 0.2M sodium acetate, pH 6.0 and 500 nMGST–ExoS (366–453) After 1 h at 37C the reaction was put on ice and 5 lL Glutathione Sepharose beads were added and tumbled for

1 h at 4C Complexes were washed three times with 1 mL

20 mMHepes, 120 mMNaCl, 10% glycerol, 0.5% NP-40,

2 mMEDTA pH 8.0 and then subjected to SDS/PAGE and immunoblotting

Immunoblotting analysis of the 14-3-3 isoforms pulled down by GST–ExoS mutants

HeLa cell lysate (2.4 mg) was incubated with GST-fusion protein (10 lg) for 1 h prior to the addition of Glutathione Sepharose for 30 min After three washes in lysis buffer, samples were boiled in SDS/PAGE sample buffer Protein samples were loaded onto a single wide lane of an SDS/ polyacrylamide gel After electrophoresis the separated proteins were transferred onto nitrocellulose membranes at

200 mA constant current for 1 h The membranes were then blocked for 1 h in 5% skimmed milk in TBS-Tween (20 mM Tris/HCl pH 7.5, 137 mMNaCl, 0.1% Tween) Longitudi-nal strips of the membrane were exposed to a range of

14-3-3 isoform-specific antisera (diluted in 5% skimmed milk in TBS-Tween, see Table 1) using a BiometraTM slot blot apparatus [41] After washing the slots separately with TBS-Tween, the nitrocellulose filters were probed with HRP-conjugated goat anti-(rabbit Ig) (Bio-Rad) diluted 1 : 2000 and developed by enhanced chemiluminescence

Construction of arabinose inducible ExoS derivatives and infection of cells

To ensure protein stability of ExoS derivatives, mutant alleles were coexpressed with orf1, encoding the cognate nonsecreted chaperone of ExoS [38,42] In all cases, DNA was amplified by PCR using conditions described previously [43] pMF366 was constructed from amplified DNA from pTS103 [38] harbouring wild-type orf1, which was cloned into the NcoI/XhoI (shown in italic type) sites of pBAD/ Myc-His under the control of an arabinose inducible

promoter using the orf1 specific primers porf1a (forward):

5¢-GCCGCCTCCATGGACTCGGAACACGCC-3¢ and

porf1b (reverse): 5¢-TCGCCCGACTCGAGTCAGCGTA

GCTCTTC-3¢ Wild-type exoS sequence was cloned into

the XhoI/KpnI (shown in italic type) sites of pMF366 to

generate the plasmid pMF384, using DNA amplified from

pTS103 with the exoS specific primer pair pexoSa (forward): 5¢-CGGAGAAACTCGAGGAGAAGGCAACCATC-3¢, pexoSb (reverse): 5¢-GTCTTTCTGGTACCACCGGTCA GGCCAGA-3¢ pMF419 and pMF420 were obtained by replacing the C-terminal ClaI/KpnI fragment from pMF384 with DNA amplified and restriction enzyme cut with ClaI/ KpnI from pGEX-2TK-ExoS(SD) and pGEX-2TK-ExoS (S3), respectively, using the exoS specific primers, pexoSseq3 (position 973–991; forward): 5¢-AAGTGATGGCGCTTG GTCT-3¢ and pexoSd (reverse): 5¢-ATGCATGGTACCTC AGGCCAGATCAAGGCCGCG-3¢ All constructs were confirmed by sequence analysis Stable induction of protein expression in strains grown in the presence of 0.02%L(+) arabinose was confirmed by Western analysis as described previously [44], using polyclonal rabbit anti-ExoS [38] Bacterial infection of cells was performed in the presence of 0.1%L(+)arabinose as described previously [45]

R E S U L T S

Amino acids 420–429 of ExoS are important for interaction with 14-3-3

Numerous observations have revealed that 14-3-3 binds phosphorylated ligands [3] The binding of 14-3-3 proteins

to nonphosphorylated partners is, however, far less defined

As the interaction between ExoS and 14-3-3 has been suggested to be important for the ADP-ribosylation activity

of ExoS, and more intriguingly appears to be independent

of serine phosphorylation, we decided to define the amino acid sequence required for the ExoS interaction with 14-3-3

To date, the best-studied example of a nonphosphorylated interaction with 14-3-3 is with an artificial peptide, named R18, which was isolated from a phage display library as having high affinity for 14-3-3 proteins A motif in R18

10WLDLE14, was found in a similar position as the phosphorylated residues in the 14-3-3 binding phosphopep-tides, with negatively charged Asp12 and Glu14 making contacts similar to those of phosphoserine [3] The hydro-phobic residues in the R18 peptide make contact with the hydrophobic side of the amphipathic groove of 14-3-3, implying that the R18 peptide interacts with 14-3-3 in a manner very similar to phosphorylated ligands [33,46] In an earlier study we have shown that a C-terminal deletion in which the extreme 26 amino acids of ExoS were removed was unable to bind 14-3-3 (Fig 1A, lane 4, and see [29]) On further inspection we noted that ExoS contains a DALDL sequence, at amino acid position 424–428, which is similar

to the WLDLE of R18 (Table 2)

To address the question of whether the DALDL sequence is a determinant of the 14-3-3 : ExoS interaction,

Fig 1 GST–ExoS mutant analysis of interaction with endogenous

14-3-3 proteins HeLa cells were harvested, and lysates were subjected

to pull-down analysis with 5 lg of various GST-fusion proteins.

Samples were separated by SDS/PAGE on a 12.5% gel (A) Upper

panel: HeLa cell lysates were subjected to affinity precipitation with a

series of GST–ExoS mutants Lanes correspond to schematic

repre-sentations of the constructs illustrated in (B) Lower panel: Commassie

blue stained SDS/PAGE, shows purified GST-fusion proteins purified

from Escherichia coli used in this study Lanes correspond to schematic

representations of the constructs illustrated in (B) Lane 1 represents

2 lg of whole HeLa cell lysate 14-3-3 proteins were detected by

immunoblotting with anti-14-3-3 antibodies (B) Schematic diagram

detailing the various GST-fusion protein constructs of ExoS used in

the present study Important amino acids for 14-3-3 interactions of

ExoS are indicated between amino acids 418 and 429 The region of

interest in ExoS and the limited similarity towards other

nonphos-phorylated 14-3-3 partners is shown in Table 2.

Table 1 Summary of isoform specific 14-3-3 antibodies used Isoform Antibody Epitope Position Dilution

f f1002 Ac-MDKNELVQKAC 1–10 1 : 3000

s s197 Ac-MEKTELIQKAC 1–10 1 : 3000

r r789 Ac-MERASLIQKAC 1–10 1 : 3000

e e2025 Ac-MDDREDLVYQAKC 1–12 1 : 3000

g g2043 Ac-GDREQLLQRARC 2–12 1 : 3000

c c1006 Ac-VDREQLVQKAC 2–11 1 : 6000

a set of deletion and substitution variants of ExoS were

generated for use in protein pull-down experiments (see

Fig 1B) We constructed an ExoS deletion protein depicted

in Fig 1B, named GST–ExoS(SD), as well as three

over-lapping substitution mutants between amino acids 419–429

[named GST–ExoS (S1 to S3)] (see Fig 1B)

HeLa cell lysates were precleared with GST–agarose

beads prior to incubation with the various GST–ExoS

fusion proteins, as indicated Samples were subsequently

washed and separated by SDS/PAGE, followed by

immu-noblotting with anti-14-3-3 Igs As we have previously

shown, GST–ExoS(88–453) clearly interacts with 14-3-3,

whereas GST–ExoS(88–426) does not (Fig 1A, compare

lanes 3 and 4) Precipitation of 14-3-3 proteins could also be

seen with GST–ExoS(S1) and (S2), although less 14-3-3

proteins were precipitated when compared with GST–

ExoS(88–453) (Fig 1, compare lanes 6 and 7 with lane 3)

However, fusion proteins GST–ExoS(SD) and GST–

ExoS(S3) failed to interact with and precipitate 14-3-3

proteins (Fig 1A, lane 5 and 8)

The E-son peptide blocks the ExoS : 14-3–3 interaction

We thus reasoned that 14-3-3 proteins may interact with

ExoS through residues within this region However, the

possibility exists that mutation or deletion of ExoS may

cause conformational changes elsewhere in ExoS which are

responsible for the observed loss of ExoS : 14-3-3 binding

activity To exclude this possibility and to investigate further

the interaction between 14-3-3 and ExoS we decided to

perform a peptide competition analysis From our analysis

of the binding of 14-3-3 proteins to the ExoS deletion and

substitution mutants we synthesized a 18-mer peptide

spanning the area of interest from amino acid 415–432 of

ExoS (QSGHSQGLLDALDLASKP), which we have

denoted E-son As controls in our experiments we used

the previously published peptide; R18 in our analysis (for

details see Table 2 and [47]) In in vitro assays we observed

that the E-son peptide was able to competitively block the

ExoS : 14-3-3 interaction in a dose-dependent manner

(Fig 2B) In fact, a 10-fold excess of the E-son peptide

was sufficient to compete out 90% of the interaction

between 14-3-3 and ExoS (Fig 2B) We also noted that the

phage display peptide R18 was able to disrupt the

interac-tion between 14-3-3 and ExoS within a similar

concentra-tion range (Fig 2A) These results therefore provide strong

evidence that 14-3-3 proteins do indeed interact with ExoS

through amino acid residues 415–432, containing the

DALDL sequence

E-son blocks modification of Ras by ExoS Having defined the sequences in ExoS required for ExoS : 14-3-3 binding, we next wished to address the question of whether these residues are of importance for ExoS activity This question can be approached by using an

in vitroRas modification assay, where ADP-ribosylation of Ras by ExoS is reflected by a gel mobility shift of Ras on SDS/PAGE [35] Incubation of Ha-Ras, 14-3-3, NAD and GST alone does not alter the mobility of Ras proteins (Fig 3, lane 1) However, when ExoS is also included Ras modification is readily observed by a change in mobility on SDS/PAGE (Fig 3, lane 2) When either the E-son or the R18 peptide were preincubated with 14-3-3 prior to addition

of Ras, NAD and ExoS, no change in Ras shift due to ADP-ribosylation of Ras by ExoS was observed (Fig 3, lanes 3 and 4 compared with lane 2) Thus, we are able to show that both E-son and R18 are capable of inhibiting ExoS activity efficiently, resulting in an observed inhibition

of the modification of Ras in vitro

ExoS interacts with all isoforms of the 14-3-3 family ExoS interacts with 14-3-3 proteins in the C-terminal part and this interaction is necessary for the ADP ribosylation

Table 2 Protein interacting with 14-3-3 in a nonphosphorylated

man-ner A literature search for nonphosphorylated 14-3-3 interacting

partners reveals five binding partners References are indicated in

brackets after each interacting protein name and putative interaction

amino acid residues are marked in bold.

E-son (315–432) (this study) QSGHSQGLLDALDLASKP

GPIb-a (593–610) [30] QDLLSTVSIRYSGHSL

IP5-Pase(359–371) [24] ELVLRSESEEKVV

NADE (81–100) [23] EEMREIRRKLRELQLRNCLR

CLIC4 (145–161) [50] LKTLQKLDEYLNSPLPG

Fig 2 E-son disrupts the binding between ExoS and 14-3-3 Recom-binant 14-3-3 (250 n M ) was mixed with the indicated amount of pep-tide for 30 min at 37 C, prior to incubation for 1 h with 500 n M

purified GST–ExoS(366–453), followed by GST-bead precipitation, washing and separation by SDS/PAGE and immunoblotting with anti-14-3-3 antibodies The R18 peptide (A) and E-son peptide (B) were used as competitor peptides.

activity of ExoS (see above and [29]) However we have no

indication as to whether ExoS interacts with all, or a subset

of the 14-3-3 family members (Table 1) To explore this

further we used pull-down assays using different GST–ExoS

deletion proteins In our assay we used the following ExoS

constructs: ExoS(88–453) (see above), which harbours the

ability to bind 14-3-3 and to ADP-ribosylate endogenous

cellular targets both in vivo and in vitro [29]; GST–

ExoS(400–453), a construct that we have shown to bind

to 14-3-3 proteins but lacks both the GAP and the

ADP-ribosylation domains of ExoS [29] In addition, we have also

made use of ExoS(88–426), which lacks the ability to

interact with 14-3-3 and shows a dramatically reduced

ADP-ribosylation activity both in vivo or in vitro (see above

and [29]) All 14-3-3 isoforms appear to be expressed in

HeLa cells, although 14-3-3 r and s are not as pronounced

as the other isoforms (Fig 4A) The ExoS(88–453) protein

is able to affinity precipitate all 14-3-3 isoforms from HeLa

lysates (Fig 4B), as is the ExoS(400–453) protein, although

ExoS(400–453) appears to have a reduced ability to interact

with 14-3-3 r (Fig 4C) and ExoS(88–453) appears to have

a reduced ability to interact with 14-3-3 s (Fig 4B) As

expected, GST–ExoS(88–426) does not affinity precipitate

14-3-3 proteins from HeLa whole cell lysates (Fig 4D)

From this analysis we conclude that the full-length ExoS

protein does indeed have the capacity to interact with all

members of the 14-3-3 family

ExoS mutants lacking the 14-3-3 binding site do not

modify Rasin vivo

Most importantly we wished to test the significance of the

in vitrodetermined amino acid sequence for the interaction

between ExoS and 14-3-3 in a biological system in vivo We

approached this question through the utilization of two

different assays Firstly, we exploited the ADP-ribosylation

activity of ExoS towards an important endogenous target –

namely the small G-protein Ras – as a readout [35]

Secondly, we employed a cytotoxicity assay, since the

ADP-ribosylation activity of ExoS mediates a marked change in

cell morphology and has a lethal activity upon translocation

into the host cell in vivo [38,48,49]

In our earlier studies we have shown that Ras is modified

by ExoS expressed and delivered into the eukaryotic cells by

a genetically defined Yersinia pseudotuberculosis strain,

devoid of endogenous toxins, and also by several different

clinically relevant parental P aeruginosa strains ([35] and data not shown) Y pseudotuberculosis strain, YPIII/ pIB251, can express and deliver heterogenous ExoS protein (YPIII/pTS103) with high efficiency, at levels substantially greater than parental P aeruginosa 388 and PAK (MLH and BH, unpublished results) To reduce the expression and translocation of ExoS from the bacteria to the cell we constructed a Y pseudotuberculosis strain which expresses and translocates ExoS and various ExoS mutants under the control of an arabinose inducible promoter located on pBAD/Myc-His [44] Thus, by growing the bacteria in the presence of 0.1% arabinose in the culture media we could induce a reduced expression and translocation of ExoS into eukaryotic cells compared to YPIII/pTS103, to increase the sensitivity of our assay In this study we measured the

Fig 3 E-son blocks the modification of Ras by ExoS in vitro.

Recombinant Ha-Ras (10 l M ) was incubated with 500 n M GST (lane

1), 500 n M GST–ExoS(88–453) fusion proteins (lanes 2–4) together

with recombinant 14-3-3 (250 n M ) and 1.25 m M NAD+for 10 min at

37 C Samples were separated by SDS/PAGE, followed by

immuno-blotting with anti-Ras monoclonal antibody E-son (100 l M ; lane 3) or

R18 (100 l M ; lane 4) was preincubated with recombinant 14-3-3 for

30 min at 37 C prior to addition of NAD +

, Ha-Ras and GST-fusion protein.

Fig 4 Pull down of 14-3-3 isoforms with GST–ExoS mutants HeLa cells were harvested, and lysates were subjected to pull-down analysis with various GST-fusion proteins as indicated Cell lysates and the eluates from the GST–ExoS pull downs were analysed for the presence

of 14-3-3 isoforms by immunoblotting Eluted protein was subjected to 12% (w/v) SDS/PAGE The separated proteins were then transferred onto nitrocellulose and immunoblotted with 14-3-3 antisera specific for the seven isoforms (b, f, s, r, e, g and c) using a Biometra TM slot blot apparatus A summary of these antisera is shown in Table 1 and [41] (A) Whole HeLa cell lysate HeLa cell lysates were subjected to affinity precipitation with (B) GST–ExoS(88–453) (C) GST–ExoS(400–453) (D) GST–ExoS(88–426) and (E) GST-fusion protein The position of the 30 kDa marker proteins is indicated.

modification of Ras in vivo as a reflection of ExoS

ADP-ribosyltransferase activity HeLa cells were infected for

80 min with Y pseudotuberculosis, which had been induced

to express and translocate ExoS, ExoS(SD) and ExoS(S3)

After stimulation with EGF for 2 min, cells were harvested

and the resultant lysate was separated on SDS/PAGE

followed by immunoblotting with anti-Ras,

antiphospho-Akt and antiphospho-Erk Igs (Fig 5A) Stimulation of the

uninfected cells with EGF caused the phosphorylation of

both Erk and PKB/Akt (Fig 5A, compare lanes 1 and 2)

The expected modification of Ras and its subsequent

inability to signal downstream to Erk and Akt was observed

in cells infected with bacteria expressing wild-type ExoS but

not in stimulated uninfected cells or in mock infected cells

(Fig 5A, compare lane 4 with that of lanes 2 and 3)

However, this inhibition of the activation of Ras, Erk and

Akt was abrogated when the cells were infected with bacteria producing ExoS mutants unable to interact with 14-3-3, e.g ExoS(SD) and ExoS(S3) (Fig 5A, lanes 5 and 6), thus indicating that mutation of the 14-3-3 binding motif

in ExoS results in an inactive ExoS molecule in vivo

Cell morphology is not affected by an ExoS mutant lacking the 14-3-3 binding site

It has previously been demonstrated that delivery of ExoS into HeLa cells results in a change in cell morphology, concommitent with a disruption of actin microfilaments, which is followed by cell death, the latter also being correlated to the ADP-ribosylation activity of ExoS [35,38,49] Here we wished to address whether infection of HeLa cells with Y pseudotuberculosis strain, YPIII/pIB251, pregrown in 0.1% arabinose to induce expression of ExoS mutants lacking the 14-3-3 binding site, could induce a morphological change of HeLa cells To achieve this we infected cells with bacteria, which translocated either the wild-type ExoS, ExoS(SD), or ExoS(S3)

The extent of cytotoxicity as visualized by a distinct change in cell morphology in vivo was examined in HeLa cells taken at 80 min postinfection As control, the trans-location efficiencies of ExoS, ExoS(SD) and ExoS(S3) proteins were compared by immunoblot analysis to ensure that the effects observed were not caused by decreased translocation of protein (Fig 5C)

As expected, intracellular wild-type ExoS induced a rapid cytotoxic response toward infected HeLa cells, consistent

Fig 5 Morphological and protein effects of ExoS infection on cells

in vivo and on EGF receptor signalling components downstream of Ras (A) Upper panel: phosphorylation of PKB/Akt and Erk was examined

in nonstimulated (–) (lane 1) and EGF stimulated (+) (lanes 2–6) cells Cells were infected for 80 min as follows: uninfected (lanes 1 and 2), infected with Y pseudotuberculosis, YPIII(pIB251) alone (mock infected, lane 3), or YPIII(pMF384), expressing ExoS wild-type (lane 4), YPIII(pMF419), expressing ExoS(SD) (lane 5) or YPIII(pMF420), expressing ExoS(S3) (lane 6) Whole cell lysates were subjected to SDS/ PAGE followed by immunoblotting with anti-phosphospecific Erk (a-P-Erk) and PKB/Akt (a-P-PKB/Akt) Igs, as indicated Middle panel: the membrane was stripped and reprobed with anti-pan Erk antibodies, as indicated Lower panel: the same membrane was im-munoblotted with anti-Ras antibodies (B) Morphological changes caused by different variants of ExoS preinduced in 0.1% arabinose HeLa cells, also in the presence of 0.1% arabinose, were infected with YPIII(pMF384), expressing wild-type ExoS (3), YPIII(pMF419), expressing ExoS(SD) (4), or YPIII(pMF420), expressing ExoS(S3) (5).

As controls we used uninfected HeLa cells (1) or HeLa cells infected with YPIII(pIB251) (2) for mock infection (C) Translocation of ExoS variants by Y pseudotuberculosis into HeLa cells Bacteria were pre-induced with 0.1% arabinose, allowed to infect HeLa cells for 80 min prior to cold washing of the cells and harvest ExoS was immuno-precipitated from cell lysates with Sepharose G-coupled ExoS anti-bodies, and analysed by immunoblotting using ExoS antibodies YPIII(pMF384), expressing ExoS (lane 4), YPIII(pMF419), expres-sing ExoS(SD) (lane 5), or YPIII(pMF420), expresexpres-sing ExoS(S3) (lane 6) Twenty lg whole cell lysate from ExoS(SD) infected cells (lane 1), uninfected HeLa cells (lane 2) or HeLa cells infected with YPIII(pIB251) (lane 3) for mock infection were used as controls.

with published reports (Fig 5B(3) and [38,48]) However,

HeLa cells infected with the bacteria expressing the ExoS

mutants: ExoS(SD), ExoS(S3), or mock infected, were

essentially indistinguishable, indicating no evidence of a

cytotoxic response (Fig 5B, compare 3 with 1, 2, 4 and 5)

Using our new arabinose inducible strains, which

translo-cate a more physiological level of ExoS, we observe no GAP

domain induced cytotoxicity, however, a cytotoxic effect

can be seen when the ADP-ribosylation domain is complete

We have also observed that there is no decrease or increase

in the Rho GAP activity between wild-type and SD of ExoS

constructs in vitro (M Aili and B Hallberg, data not shown)

In summary, the lack of Ras modification and inhibition

together with the loss of cytotoxic effect in ExoS mutant for

the 14-3-3 binding motif clearly points to an important

function for the 14-3-3:ExoS interaction in vivo

D I S C U S S I O N

In this study we have focused our attention on defining the

amino acids on ExoS important for its interaction with

14-3-3 both in vitro and in vivo This is an important

consideration since the interactions between 14-3-3 and

many cellular proteins have been described to occur in a

phospho-specific manner [21,25] However, the interaction

between 14-3-3 and ExoS has been reported to occur in a

phosphorylation-independent manner We have shown that

the ExoS sequence between amino acid 424 and 428

(DALDL) is critical for the interaction between 14-3-3 and

ExoS Furthermore, sequences flanking this DALDL

sequence also contribute to binding of 14-3-3 proteins

Further evidence for a specific phosphorylation–independent

interaction between 14-3-3 and ExoS is provided by

competi-tion experiments utilizing the E-son peptide, corresponding

to the amino acids 415–432 of ExoS Firstly, E-son efficiently

inhibits the formation of the 14-3-3:ExoS complex, with

similar kinetics as seen earlier with the R18 peptide [20] It

seems that the interaction between 14-3-3 and ExoS is of a

specific and tight-binding nature Secondly, and more

importantly, E-son is an efficient competitor for the 14-3-3

dependent ExoS ADP-ribosylation activity, as measured by

modification of the small GTPase protein Ras in vitro

Considering the large number of 14-3-3 isoforms together

with the large number of putative target proteins for 14-3-3

within the cell, we asked which of the 14-3-3 isoforms were

able to interact with ExoS It has been suggested that homo-/

hetero-dimer combinations of 14-3-3 may confer specificity,

which would mean that there are differences in specificity

towards the 14-3-3 partners [39] It is also possible that

specific interactions occur as a result of particular subcellular

localizations or transcriptional regulation of isoforms rather

than of differences in their ability to bind to a specific target

From our analysis we have strong evidence that full-length

ExoS(88–453) has the ability interact with all members of

the 14-3-3 family, although there may be a reduction in

the affinity of ExoS for 14-3-3 s (Fig 4) Interesting, the

ExoS(400–453) construct, which lacks a GAP domain, did

not appear to interact with 14–3-3 r, in contrast with

ExoS(88–453) This discrepancy may be worthy of future

investigation but has not been approached here

Comparisons of amino acid sequences in the published

nonphosphorylated interaction partners for 14-3-3 are

shown in Table 2 The identified 14-3-3 binding sequence

in ExoS, DALDL, shows similarities to the artificial unphosphorylated peptide (R18) isolated from a phage display library, which contains the sequence WLDLE (10– 14), and has been suggested to bind to the conserved amphipathic groove of 14-3-3 [33] It has been proposed that negatively charged amino acids, such as glutamic and aspartic acid residues are able to mimic a phosphorylated serine motif of Raf-1, which would perhaps explain the binding of 14-3-3 proteins to these motifs [33] Furthermore,

it has been proposed that the motif RSESEE of the 43 kDa inositol polyphosphate 5-phosphatase binds 14-3-3 proteins due to the appearance of multiple negatively charged amino acids (Table 2 and [24]) Another 14-3-3 binding protein is GPIb-a, which contains a reported interaction domain [30] This domain harbours the motif, QDLLSTVS, which shows

a weak resemblance to ExoS and R18 A motif that weakly resembles this (ELQLRN) can be found at residues 90–112

of the p75NTR-associated cell death executor (NADE), within the domain, which has recently been reported to interact with 14-3-3 [23] CLIC4, an ion channel protein, also binds 14-3-3 proteins and harbours a sequence which resembles a negatively charged motif, DEYLN, at residues 152–156 [50]

From this comparison of 14-3-3 nonphosphorylated motif sequences it is not clear which amino acids within the motif are important for the interaction between 14-3-3 and its nonphosphorylated ligand However, it is clear that a more thorough dissection is needed for the hypothesis that negatively charged amino acids can substitute phosphoryl-ated serine/threonine residues Numerous reports have clarified the importance of 14-3-3 proteins as a factor that activates ExoS [27–29,35] It has been proposed that the dimeric structure of the 14-3-3 proteins allows it to bind two ligands simultaneously, as the ligand-binding grooves run in opposite directions in each monomer of the molecule [3,21,51] It is possible that the interaction between 14-3-3 and ExoS creates a conformational change in the structure

of ExoS, thereby changing ExoS from nonactive protein to

an active protein with ADP-ribosylation activity Thus 14-3-3 proteins may have two functions, firstly as an activator of ExoS and secondly to localize ExoS to a specific domain within the cell

Most importantly in this study we wished to test the significance of the in vitro determined amino acid sequence for the interaction between ExoS and 14-3-3 in vivo We have shown earlier that Ras (and its deactivation of downstream targets such as Erk and PKB/Akt), and many other small GTPases are modified by ExoS, expressed and translocated into the eukaryotic cells by a genetically defined Y pseudotuberculosis strain and also by several different Pseudomonas aeruginosa strains [34,35] The Yer-sinia strain expresses and translocates ExoS protein with high efficiency, at levels greater than that observed in strains such as P aeruginosa 388 and PAK For this reason we have engineered a Yersinia strain to express wild-type ExoS and two different mutants of ExoS under the control of an arabinose-inducible promoter so that considerably lower levels of ExoS proteins were translocated into infected cells

We observed the expected phosphorylation of both PKB/ Akt and of Erk 1/2 after stimulation by EGF in HeLa cells

As reported previously, infection of HeLa cells for 80 min with bacteria expressing the wild-type ExoS caused the ADP-ribosylation of Ras and inhibited the EGF mediated

phosphorylation of both Erk and PKB/Akt This effect was

not seen upon infection with bacteria expressing the ExoS

S3 constructs where the DALDL sequence has been

mutated or with the substitution/deletion ExoS(SD) These

results suggest that an ExoS construct lacking the DALDL

sequence, which we suggest to be the binding motif in ExoS

for 14-3-3, does not abrogate the activation of Ras, Erk or

PKB/Akt upon stimulation with EGF and thus is

nonfunc-tional in vivo In addition, no modification of endogenous

Ras can be observed if 14-3-3 has lost its ability to interact

with ExoS, as is the case with ExoS(SD)

ExoS is known to cause infected cells to round up and

detach from the underlying surface, which correlates with

disruption of the actin microfilament structure within the

cell [38,48] We observed that an ExoS protein lacking the

residues important for 14-3-3 binding motif is unable to

elicit the changes in cell morphology routinely observed

with wild-type ExoS Thus, the 14-3-3 binding motif of

ExoS) DALDL ) appears to be necessary for both the

ADP-ribosylation activity and the cytotoxic action of ExoS

in vivo

In this report we have firstly identified the residues on

ExoS responsible for its specific interaction with 14-3-3,

both in vitro and in vivo Secondly, we have shown that an

amino acid peptide derived from ExoS, containing the

important 14-3-3 interaction site, effectively competes out

the interaction between ExoS and 14-3-3 Thirdly,

compe-tition with this peptide blocks ExoS modification of Ras in

our in vitro Ras modification assay Fourthly, we show that

the full-length ExoS proteins interact with all isoforms of the

14-3-3 family Finally, in vivo an ExoS protein lacking the

14-3-3 binding site is unable to ADP ribosylate

cytoplas-matic proteins, e.g Ras, and is impaired in its capacity to

change the morphology of infected cells

A C K N O W L E D G E M E N T S

Financial support for this work was from the MRC, UK (A A), the

Wellcome trust (A A), Swedish Cancer Society, Riksfo¨rbundet Cystisk

Fibros Forskningsfond, Sven Jerring foundation, Kungliga

Vetenskap-sakademin, Elsa and Folke Sahlbergs minnesfond, and the Swedish

Natural Science Council.

R E F E R E N C E S

1 Aitken, A (1995) 14-3-3 proteins on the MAP Trends Biochem.

Sci 20, 95–97.

2 Aitken, A., Jones, D., Soneji, Y & Howell, S (1995) 14-3-3

pro-teins: biological function and domain structure, Biochem Soc.

Trans 23, 605–611.

3 Fu, H., Subramanian, R.R & Masters, S.C (2000) 14-3-3

pro-teins: structure, function, and regulation Annu Rev Pharmacol

Toxicol 40, 617–647.

4 Su, T.T., Parry, D.H., Donahoe, B., Chien, C.T., O’Farrell, P.H.

& Purdy, A (2001) Cell cycle roles for two 14-3-3 proteins during

Drosophila development J Cell Sci 114, 3445–3454.

5 Broadie, K., Rushton, E., Skoulakis, E.M & Davis, R.L (1997)

Leonardo, a Drosophila 14-3-3 protein involved in learning,

regu-lates presynaptic function Neuron 19, 391–402.

6 Ford, J.C., al-Khodairy, F., Fotou, E., Sheldrick, K.S., Griffiths,

D.J & Carr, A.M (1994) 14-3-3 protein homologs required for the

DNA damage checkpoint in fission yeast Science 265, 533–535.

7 van Heusden, G.P., Griffiths, D.J., Ford, J.C., Chin, A.W.T.F.,

Schrader, P.A., Carr, A.M & Steensma, H.Y (1995) The 14-3-3

proteins encoded by the BMH1 and BMH2 genes are essential in the yeast Saccharomyces cerevisiae and can be replaced by a plant homologue Eur J Biochem 229, 45–53.

8 Fantl, W.J., Muslin, A.J., Kikuchi, A., Martin, J.A., MacNicol, A.M., Gross, R.W & Williams, L.T (1994) Activation of Raf-1

by 14-3-3 proteins Nature 371, 612–614.

9 Xing, H., Kornfeld, K & Muslin, A.J (1997) The protein kinase KSR interacts with 14-3-3 protein and Raf Curr Biol 7, 294–300.

10 Zhang, L., Chen, J & Fu, H (1999) Suppression of apoptosis signal-regulating kinase 1-induced cell death by 14-3-3 proteins Proc Natl Acad Sci USA 96, 8511–8515.

11 Fanger, G.R., Widmann, C., Porter, A.C., Sather, S., Johnson, G.L & Vaillancourt, R.R (1998) 14-3-3 proteins interact with specific MEK kinases J Biol Chem 273, 3476–3483.

12 Reuther, G.W., Fu, H., Cripe, L.D., Collier, R.J & Pendergast, A.M (1994) Association of the protein kinases c-Bcr and Bcr-Abl with proteins of the 14-3-3 family Science 266, 129–133.

13 Hausser, A., Storz, P., Link, G., Stoll, H., Liu, Y.C., Altman, A., Pfizenmaier, K & Johannes, F.J (1999) Protein kinase C mu is negatively regulated by 14-3-3 signal transduction proteins J Biol Chem 274, 9258–9264.

14 Zha, J., Harada, H., Yang, E., Jockel, J & Korsmeyer, S.J (1996) Serine phosphorylation of death agonist BAD in response to survival factor results in binding to 14-3-3 not BCL-X (L) Cell

87, 619–628.

15 Brunet, A., Bonni, A., Zigmond, M.J., Lin, M.Z., Juo, P., Hu, L.S., Anderson, M.J., Arden, K.C., Blenis, J & Greenberg, M.E (1999) Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor Cell 96, 857–868.

16 Liu, D., Bienkowska, J., Petosa, C., Collier, R.J., Fu, H & Liddington, R (1995) Crystal structure of the zeta isoform of the 14-3-3 protein Nature 376, 191–194.

17 Xiao, B., Smerdon, S.J., Jones, D.H., Dodson, G.G., Soneji, Y., Aitken, A & Gamblin, S.J (1995) Structure of a 14-3-3 protein and implications for coordination of multiple signalling pathways Nature 376, 188–191.

18 Wu, K., Lu, G., Sehnke, P & Ferl, R.J ( 1997) The heterologous interactions among plant 14-3-3 proteins and identification of regions that are important for dimerization Arch Biochem Bio-phys 339, 2–8.

19 Jones, D.H., Martin, H., Madrazo, J., Robinson, K.A., Nielsen, P., Roseboom, P.H., Patel, Y., Howell, S.A & Aitken, A ( 1995) Expression and structural analysis of 14-3-3 proteins J Mol Biol.

245, 375–384.

20 Wang, H., Zhang, L., Liddington, R & Fu, H (1998) Mutations

in the hydrophobic surface of an amphipathic groove of 14-3-3zeta disrupt its interaction with Raf-1 kinase J Biol Chem 273, 16297–16304.

21 Yaffe, M.B., Rittinger, K., Volinia, S., Caron, P.R., Aitken, A., Leffers, H., Gamblin, S.J., Smerdon, S.J & Cantley, L.C (1997) The structural basis for 14-3-3: phosphopeptide binding specifi-city Cell 91, 961–971.

22 Tzivion, G & Avruch, J (2002) 14-3-3 proteins: active cofactors in cellular regulation by serine/threonine phosphorylation J Biol Chem 277, 3061–3064.

23 Kimura, M.T., Irie, S., Shoji-Hoshino, S., Mukai, J., Nadano, D., Oshimura, M & Sato, T.A (2001) 14-3-3 is involved in p75 neurotrophin receptor-mediated signal transduction J Biol Chem 276, 17291–17300.

24 Campbell, J.K., Gurung, R., Romero, S., Speed, C.J., Andrews, R.K., Berndt, M.C & Mitchell, C.A (1997) Activation of the 43 kDa inositol polyphosphate 5-phosphatase by 14-3-3zeta Bio-chemistry 36, 15363–15370.

25 Muslin, A.J & Xing, H (2000) 14-3-3 proteins: regulation of subcellular localization by molecular interference Cell Signal 12, 703–709.

26 Seimiya, H., Sawada, H., Muramatsu, Y., Shimizu, M., Ohko, K.,

Yamane, K & Tsuruo, T (2000) Involvement of 14-3-3 proteins in

nuclear localization of telomerase EMBO J 19, 2652–2661.

27 Masters, S.C., Pederson, K.J., Zhang, L., Barbieri, J.T & Fu, H.

(1999) Interaction of 14-3-3 with a nonphosphorylated protein

ligand, exoenzyme S of Pseudomonas aeruginosa Biochemistry 38,

5216–5221.

28 Fu, H., Coburn, J & Collier, R.J (1993) The eukaryotic host

factor that activates exoenzyme S of Pseudomonas aeruginosa is a

member of the 14-3-3 protein family Proc Natl Acad Sci USA

90, 2320–2324.

29 Henriksson, M.L., Troller, U & Hallberg, B (2000) 14-3-3

pro-teins are required for the inhibition of Ras by exoenzyme S

Bio-chem J 349, 697–701.

30 Gu, M.&., X (1998) A novel ligand-binding site in the zeta-form

14-3-3 protein recognizing the platelet glycoprotein Ibalpha and

distinct from the c-Raf-binding site J Biol Chem 273, 33465–

33471.

31 Calverley, D.C., Kavanagh, T.J & Roth, G.J (1998) Human

signaling protein 14-3-3zeta interacts with platelet glycoprotein Ib

subunits Ibalpha and Ibbeta Blood 91, 1295–1303.

32 Andrews, R.K., Harris, S.J., McNally, T & Berndt, M.C (1998)

Binding of purified 14-3-3 zeta signaling protein to discrete amino

acid sequences within the cytoplasmic domain of the platelet

membrane glycoprotein Ib-IX-V complex Biochemistry 37, 638–

647.

33 Petosa, C., Masters, S.C., Bankston, L.A., Pohl, J., Wang, B.,

Fu, H & Liddington, R.C (1998) 14-3-3zeta binds a

phos-phorylated Raf peptide and an unphosphos-phorylated peptide via

its conserved amphipathic groove J Biol Chem 273, 16305–

16310.

34 Henriksson, M.L., Sundin, C., Jansson, A.L., Forsberg, A.,

Palmer, R.H & Hallberg, B (2002) Exosenzyme S show selective

ADP-ribosylation and GAP activities towards small GTPases

in vivo Biochem J., in press.

35 Henriksson, M.L., Rosqvist, R., Telepnev, M., Wolf-Watz, H &

Hallberg, B (2000) Ras effector pathway activation by epidermal

growth factor is inhibited in vivo by exoenzyme S

ADP-ribosy-lation of Ras Biochem J 347, 217–222.

36 McGuffie, E.M., Frank, D.W., Vincent, T.S & Olson, J.C (1998)

Modification of Ras in eukaryotic cells by Pseudomonas

aerugi-nosa exoenzyme S Infect Immun 66, 2607–2613.

37 Goehring, U.M., Schmidt, G., Pederson, K.J., Aktories, K &

Barbieri, J.T (1999) The N-terminal domain of Pseudomonas

aeruginosa exoenzyme S is a GTPase- activating protein for Rho

GTPases J Biol Chem 274, 36369–36372.

38 Frithz-Lindsten, E.Y., Rosqvist, R & Forsberg, A (1997)

Intra-cellular targeting of exoenzyme S of Pseudomonas aeruginosa via

type III-dependent translocation induces phagocytosis resistance,

cytotoxicity and disruption of actin microfilaments Mol

Micro-biol 25, 1125–1139.

39 Dubois, T., Rommel, C., Howell, S., Steinhussen, U., Soneji, Y., Morrice, N., Moelling, K & Aitken, A (1997) 14-3-3 is phos-phorylated by casein kinase I on residue 233 Phosphorylation at this site in vivo regulates Raf/14-3-3 interaction J Biol Chem 272, 28882–28888.

40 Rodriguez-Viciana, P., Warne, P.H., Khwaja, A., Marte, B.M., Pappin, D., Das, P., Waterfield, M.D., Ridley, A & Downward, J (1997) Role of phosphoinositide 3-OH kinase in cell transforma-tion and control of the actin cytoskeleton by Ras Cell 89, 457– 467.

41 Wiltfang, J., Otto, M., Baxter, H.C., Bodemer, M., Steinacker, P., Bahn, E., Zerr, I., Kornhuber, J., Kretzschmar, H.A., Poser, S., Ruther, E & Aitken, A (1999) Isoform pattern of 14-3-3 proteins

in the cerebrospinal fluid of patients with Creutzfeldt-Jakob dis-ease J Neurochem 73, 2485–2490.

42 Yahr, T.L., Goranson, J & Frank, D.W (1996) Exoenzyme S of Pseudomonas aeruginosa is secreted by a type III pathway Mol Microbiol 22, 991–1003.

43 Francis, M.S & Wolf-Watz, H (1998) YopD of Yersinia pseudo-tuberculosis is translocated into the cytosol of HeLa epithelial cells: evidence of a structural domain necessary for translocation Mol Microbiol 29, 799–813.

44 Francis, M.S., Aili, M., Wiklund, M.L & Wolf-Watz, H (2000) A study of the YopD–lcrH interaction from Yersinia pseudotuber-culosis reveals a role for hydrophobic residues within the amphi-pathic domain of YopD Mol Microbiol 38, 85–102.

45 Francis, M.S., Lloyd, S.A & Wolf-Watz, H (2001) The type III secretion chaperone LcrH co-operates with YopD to establish a negative, regulatory loop for control of Yop synthesis in Yersinia pseudotuberculosis Mol Microbiol 42, 1075–1093.

46 Masters, S.C & Fu, H (2001) 14-3-3 proteins mediate an essential anti-apoptotic signal J Biol Chem 276, 45193–45200.

47 Muslin, A.J., Tanner, J.W., Allen, P.M & Shaw, A.S (1996) Interaction of 14-3-3 with signaling proteins is mediated by the recognition of phosphoserine Cell 84, 889–897.

48 Sundin, C., Henriksson, M.L., Hallberg, B., Forsberg, A & Frithz-Lindsten, E (2001) Exoenzyme T of Pseudomonas aerugi-nosa elicits cytotoxicity without interfering with Ras signal trans-duction Cell Microbiol 3, 237–246.

49 Kaufman, M.R., Jia, J., Zeng, L., Ha, U., Chow, M & Jin, S (2000) Pseudomonas aeruginosa mediated apoptosis requires the ADP-ribosylating activity of exoS Microbiology 146, 2531–2541.

50 Suginta, W., Karoulias, N., Aitken, A & Ashley, R.H (2001) Chloride intracellular channel protein CLIC4 (p64H1) binds directly to brain dynamin I in a complex containing actin, tubulin and 14-3-3 isoforms Biochem J 359, 55–64.

51 Rittinger, K., Budman, J., Xu, J., Volinia, S., Cantley, L.C., Smerdon, S.J., Gamblin, S.J & Yaffe, M.B (1999) Structural analysis of 14-3-3 phosphopeptide complexes identifies a dual role for the nuclear export signal of 14-3-3 in ligand binding Mol Cell

4, 153–166.