Sequence analysis of two genomic clones 15.6 and 12.5 kb from the winter flounder, Pseudopleuronectes americanusWalbaum resulted in the identification of multiple clustered genes for novel
Trang 1Identification, structure and differential expression of novel
pleurocidins clustered on the genome of the winter flounder,
Susan E Douglas, Aleksander Patrzykat, Jennifer Pytyck and Jeffrey W Gallant
Institute for Marine Biosciences, Halifax, Nova Scotia, Canada
Antimicrobial peptides form one of the first lines of defense
against invading pathogens by killing the microorganisms
and/or mobilizing the host innate immune system Although
over 800 antimicrobial peptides have been isolated from
many different species, especially insects, few have been
reported from marine fish Sequence analysis of two genomic
clones (15.6 and 12.5 kb) from the winter flounder,
Pseudopleuronectes americanus(Walbaum) resulted in the
identification of multiple clustered genes for novel
pleuro-cidin-like antimicrobial peptides Four genes and three
pseudogenes (Y) are encoded in these clusters, all of which
have similar intron/exon boundaries but specify putative
antimicrobial peptides differing in sequence Pseudogenes
are easily detectable but have incorrect initiator codons
(ACG) and often contain a frameshift(s) Potential
pro-moters and binding sites for transcription factors implicated
in regulation of expression of immune-related genes have been identified in upstream regions by comparative genomics Using reverse transcription-PCR assays, we have shown for the first time that each gene is expressed in a tissue-specific and developmental stage-tissue-specific manner In addi-tion, synthetic peptides based on the sequences of both genes and pseudogenes have been produced and tested for anti-microbial activity These data can be used as a basis for prediction of antimicrobial peptide candidates for both human and nonhuman therapeutants from genomic sequences and will aid in understanding the evolution and transcriptional regulation of expression of these peptides Keywords: antimicrobial peptide; development; fish; gene expression; promoter
Antimicrobial peptides have been isolated from a wide
variety of plants, animals, fungi and bacteria, and play an
important role in defense against microbial infection Many
of these small molecules are amphiphilic a-helices
contain-ing clusters of cationic amino acid residues that are well
separated in space from hydrophobic residues These
characteristics play a role in how peptides insert into
biological membranes Although the primary mode of
action of antimicrobial peptides has been described as
destruction of membranes, they may also exert their effects
by disrupting intracellular processes In addition, some have
been reported to exert a variety of beneficial effects on host
cells such as mediating inflammation and modulating the
immune response (for a review, see [1])
Of the over 800 antimicrobial peptide sequences depos-ited in the described Antimicrobial Peptide Database (http://bbcm1.univ.trieste.it/tossi/pag1.htm), sequences have been reported from only 11 fish species Although relatively understudied, fish are proving to be a rich source
of antimicrobial peptides, possibly because of their more pronounced reliance on innate immune functions in their defense against pathogens than mammals [2,3] Natural antimicrobial peptides have been isolated from only a few teleosts and include pleurocidin from winter flounder [4,5], pardaxin from Red Sea Moses sole [6], misgurin from loach [7], HFA-1 from hagfish [8], piscidins from hybrid striped bass [9], moronecidin from hybrid striped bass [10], hepcidin from bass [11] and winter flounder and Atlantic salmon [12], chrysophsin from red sea bream [13], parasin and hipposin, cleavage products of histone 2A from catfish [14] and Atlantic halibut [15], respectively, two hydrophobic proteins of 27 kDa and 31 kDa from mucous secretions of carp [16] and a highly hydrophobic cationic peptide of undetermined sequence from trout [17] In addition, a cationic steroidal antibiotic, squalamine, has been isolated from the shark [18]
There is scant information on the structure and regulation
of expression of antimicrobial peptide genes, particularly in fish Most studies report the biochemical purification of specific peptide sequences, and in some cases the subsequent cloning and sequencing of the corresponding gene or cDNA Only in the case of the human defensins have genes for antimicrobial peptides been conclusively demonstrated
to be clustered on the genome in vertebrates [19,20], and in
Correspondence to Institute for Marine Biosciences, 1411 Oxford
Street, Halifax, Nova Scotia, Canada, B3H 3Z1.
Fax: +1 902 426 9413, Tel.: +1 902 426 4991,
E-mail: susan.douglas@nrc.ca
Abbreviations: AP-1, activator protein 1; ATF, activating transcription
factor-1; CAAT, CCAAT binding factor; C/EBP, CAAT/enhancer
binding protein; d.p.h., days posthatch; GATA, GATA motif; IFN,
interferon; IL, interleukin; NF-IL6, nuclear factor interleukin 6;
OCT1, octamer motif; Y, pseudogene; MIC, minimal inhibitory
concentration; RT, reverse transcription.
Note: Nucleotide sequence data are available in the GenBank database
under the accession numbers AY282498 and AY282499.
(Received 5 June 2003, revised 9 July 2003, accepted 17 July 2003)
Trang 2no case has the differential expression of different members
of a vertebrate antimicrobial peptide gene family been
reported
Expression of pleurocidin peptide in skin and intestine
has been demonstrated using immunohistochemical
tech-niques [21] and we have recently localized expression of one
pleurocidin gene (WF2) to circulating eosinophilic granule
cells of winter flounder gill [22] In a previous study, we
reported the existence of multiple genes encoding
pleuro-cidin-like peptides and demonstrated generalized
pleuroci-din transcripts early in the development of winter flounder
larvae [5] However, we could not discriminate between the
different pleurocidin genes; expression of the multiple genes
encoding pleurocidins or, in fact any antimicrobial peptide
in any organism, during different stages of development and
in different tissues has never been reported In order to
investigate this and also to determine whether other
previously unreported pleurocidin genes may be present
on the winter flounder genome, we have sequenced two
genomic fragments that gave positive hybridization signals
with a pleurocidin probe Furthermore, we have used the
power of comparative genomics to identify potential
regulatory sequences that may be involved in transcriptional
control and to shed light on the role of these peptides in host
immunity
In most cases, identification of antimicrobial peptides
has involved laborious, time-consuming biochemical
puri-fication followed by antimicrobial activity assays Using a
genomics approach, we have successfully identified
addi-tional variants of this antimicrobial peptide family,
predicted their sequences and determined the activity of
synthetic peptides corresponding to these sequences against
a variety of pathogens With the wealth of genomic data
now available from a wide variety of organisms, this
genomic screening approach should be of value in future
studies aimed at uncovering multiple genes encoding
families of novel antimicrobial peptides and elucidating
their roles in vivo
Materials and methods
Fish rearing and sampling
All animal procedures were approved by the Dalhousie
University Committee for Laboratory Animals and the
National Research Council, Halifax Local Animal Care
Committee Winter flounder larvae were reared as described
[23] All fish were killed with an overdose of tricaine
methanesulfonate (MS222, 0.1 gÆL)1, Argent Chemical
Laboratories, Inc., Redmond, WA, USA) prior to sampling
Tissues were removed into RNALater (Ambion, Austin,
TX, USA) and kept at)80 C until used Samples of larvae
at different stages (hatch, 5, 9, 15, 20, 25, 30 and 36 days
posthatch; d.p.h.) and juveniles were rinsed in RNALater
(Ambion), transferred into 1.5 mL Eppendorf tubes
containing 0.5–1.25 mL RNALater, and kept at )80 C
until used
Sequencing and data analysis
A winter flounder genomic k-GEM11 library was screened
by standard procedures using a pooled radioactively labeled
probe comprised of PCR-amplified bands corresponding to pleurocidins WF1, WF2, WF3 and WF4 [5] Positively hybridizing clones were picked and replated until 100% purity was achieved and mapped using BamHI, SstI, XhoI and EcoRI Clones were completely sequenced from both strands using an ABI377 automated sequencer and the AmpliTaqFSDye Terminator Cycle Sequencing Ready Reaction kit (Perkin Elmer) Sequence data were analyzed using Sequencher (Gene Codes, Inc., Ann Arbor, MI, USA) and DNA Strider (Marck, 1992) Signal peptide cleavage sites were predicted using the SignalP Web Prediction Server (http://www.cbs.dtu.dk/services/SignalP) with the neural networks trained on sequences from eukaryotes Transcrip-tion factor binding sites were identified using WWW Signal Scan (http://bimas.dcrt.nih.gov/molbio/signal/) with the TRANSFAC [24] and TFD databases
Expression of pleurocidin genes by reverse transcription-PCR (RT-PCR)
Total RNAs were isolated from esophagus, pyloric stom-ach, cardiac stomstom-ach, pyloric caeca, liver, spleen, intestine, rectum, gill, brain, muscle and skin (20–50 mg tissue) of an adult winter flounder, and from pooled samples of 20 whole larvae (hatch and 9 d.p.h.), 10 whole larvae (15, 20, 25 30 and 36 d.p.h.) and five whole juveniles using the RNA Wiz kit (Ambion, Austin, TX, USA) according to the manu-facturer’s recommendations The isolated RNA was treated with DNA Free Kit (Ambion) as directed by the manufac-turer, except that a 1-h incubation was performed rather than the specified 30 min
First-strand cDNA was synthesized from 2 lg total RNA using the RetroScript kit (Ambion) and aliquots of the reaction products were subjected to PCR using rTaq polymerase (Amersham Biosciences) and gene-specific primers (Table 1) As Y2 and Y3 showed significant sequence degeneration (see Results), it was assumed that they are no longer functional and they were therefore not assayed The amplification conditions were: 2 min at 94C;
32 cycles of 30 s at 94C, 30 s at 52 C, 90 s at 72 C; and
2 min at 72C Amplification of b-actin mRNA was performed to confirm the steady-state level of expression of
a housekeeping gene Amplification products were resolved
on a 2% PCR Plus agarose gel (EM Sciences, Gibbstown,
NJ, USA) with a 100-bp ladder as a marker (Amersham Biosciences) Controls were performed using single primers
to eliminate single primer artifacts and without template to eliminate amplification products arising from contami-nating genomic DNA
Synthesis of peptides The sequences of selected peptides used for testing and their physical properties are provided in Table 2 All anti-microbial peptides used in this study were synthesized by N-(9-fluorenyl) methoxy carbonyl (Fmoc) chemistry at the Nucleic Acid Protein Service unit at the University of British Columbia Peptide purity was confirmed by HPLC and MSanalysis in each case Due to the high cost of peptide synthesis, only a subset of peptides was made Two peptides, WFY and WFZ, based on alternative splice products were predicted from pseudogene 1 (which
Trang 3con-tained no frameshifts) but no peptides were synthesized
based on pseudogenes 2 or 3 (which exhibited significant
sequence degeneration) WF-YT was not synthesized as it
did not exhibit the typical GEC signature upstream of the
mature peptide and the position of the carboxy-terminal
residue was ambiguous A previously synthesized peptide,
NRC-01, which differs from the predicted amino acid
sequence of WF1-like peptide by only one residue (a Glu vs
an Asp at position 7 of the mature peptide) was used to
estimate the activity of WF1-like pleurocidin
Antimicrobial assays
All strains used in this study are listed in Table 3 As
inhibition of microbial growth in humans is of interest,
nonfish bacterial strains as well as Candida albicans were
assayed and grown at 37C in Mueller-Hinton Broth
(MHB; Difco Laboratories, Detroit, MI, USA), while the
bacteria pathogenic to fish were maintained at 16C in
tryptic soy broth (Difco, 5 gÆL)1NaCl) All strains were
stored at )70 C until they were thawed for use and
subcultured daily Two field isolates of the salmonid
pathogen Aeromonas salmonicida are from the Institute
for Marine Biosciences strain collection The following
strains, P aeruginosa K799 (parent of Z61), P aeruginosa
Z61 (antibiotic supersusceptible), Salmonella typhimurium 14028s (parent of MS7953s), Salmonella typhimurium MS7953s (defensin supersusceptible), as well as Staphylo-coccus epidermidis (human clinical isolates), methicillin-resistant Staphylococcus aureus (isolated by A Chow, University of British Columbia, Canada) and C albicans were provided by R E W Hancock, University of British Columbia, Canada Antibiotic-supersusceptible strains were included with the specific intent of determining if these mutations also result in increased susceptibility to peptides, which may imply a specific mode of action
Escherichia colistrain CGSC 4908 (his-67, thyA43, pyr-37), auxotrophic forL-histidine, thymidine and uridine [25] was obtained from the E coli Genetic Stock Centre (Yale University, New Haven, CT, USA) MHB supplemented with 5 mgÆL)1thymidine, 10 mgÆL)1uridine and 20 mgÆL)1
L-histidine (Sigma Chemical Co.), was used to grow E coli CGSC 4908 unless otherwise specified
The activities of the antimicrobial peptides were deter-mined as minimal inhibitory concentrations (MICs) using the microtitre broth dilution method of Amsterdam [26], as modified by Wu and Hancock [27] Serial dilutions of the peptide were made in water in 96-well polypropylene microtiter plates (Costar, Corning Incorporated, Corning,
NY, USA) Bacteria or C albicans were grown overnight to
Table 1 Nucleotide sequences of oligonucleotides used for assay of pleurocidin-like gene expression in different tissues and at different stages of development of winter flounder.
Gene sequence Primer Amino acid Nucleotide sequence (5¢ fi 3¢)
RTWF1/3¢ YQEGEEa CCCTCCCCCTCCTGGTA
PL2 3¢ untranslated CTGAAGGCTCCTTCAAGGCG
RTWFYT/3¢ SFDDNP a GGGTTGTCATCGAATGAG
RTWFX/3¢ DDDDSPa GGGGCTGTCATCATCATC
WFY (Y1) RTWF5.1/5¢ IVMFEP CATCGTCATGTTTGAACC
RTWF5.1/3¢ GYLNAAa GGCCGCATTGAGATAACC
WFZ (Y1) RTWF5.1/5¢ IVMFEP CATCGTCATGTTTGAACC
RTWF5.1a/3¢ PFIKPRa CCTGGGTTTAATAAATGG
ActR(WF) VLLTEAPa GGAGCCTCGGTCAGCAGGA
a Primer based on complement.
Table 2 Properties of predicted peptides To estimate the net charge K and R were assumed to have a value of + 1, H of + 1/2, D and E of )1, and C-terminal amidation was counted as an additional +1.
Label Residues Amino acid sequence M r Charge WF1-like a 24 GKGRWLERIGKAGGIIIGGALDHL- NH 2 2487 +3.5 NRC-01 b 24 GKGRWLDRIGKAGGIIIGGALDHL- NH 2 2473 +3.5
WFY (Y1) 19 FFRLLFHGVHHGGGYLNAA -NH 2 2112 +3.5 WFZ (Y1) 19 FFRLLFHGVHHVGKIKPRA -NH 2 2260 +6.5
a WF1-like contains an N-terminal insertion RRKKKGSKRKGSKGKGSK b NRC-01, which differs from WF1-like by a single Glu-Asp substitution, was tested instead of WF1-like.
Trang 4mid-logarithmic phase as described above, and diluted to
give a final inoculum size of 106c.f.u.ÆmL)1 A suspension
of bacteria or yeast was added to each well of a 96-well plate
and incubated overnight at the appropriate temperature
Inhibition was defined as growth lesser or equal to one-half
of the growth observed in control wells where no peptide
was added However, in all cases except P aeruginosa,
where growth inhibition was indeed gradual, complete
inhibition (no growth) was achieved at the lowest inhibitory
concentration Growth was assessed visually Three
repli-cates of each MIC determination were performed MHB
supplemented with 200 mM NaCl was used to test salt
resistance
Survival of bacteria and C albicans upon exposure to
selected peptides applied at their MICs and 10 times their
MICs was measured using standard methodology The test
organisms were grown in MHB and exposed to the peptides
At specified time intervals, equal aliquots were removed from the cultures, plated on MHB plates, and the resulting colonies were counted Percentage survival was plotted against time on a logarithmic scale Two replicates of each experiment were performed
Results Genomic structure Four lambda clones giving positive hybridization signals with the pleurocidin probe were isolated from the winter flounder genomic library Two clones differing markedly
in restriction endonuclease cleavage pattern were selected for sequencing Complete sequencing of these two clones (k1.1 and k5.1) revealed inserts of 15.6 and 12.5 Kb, respectively k1.1 contained three genes encoding pleuro-cidin-like antimicrobial peptides (referred to as WFYT, WFX and WF1-like) and one pseudogene (Y3) k5.1 contained one gene encoding pleurocidin (WF2) and two pseudogenes (Y1 and Y2) Sequence analysis demonstra-ted that all pleurocidin genes contained four exons and three introns Interestingly, the pseudogenes all had a similar genomic structure but were missing ATG start codons and correct splicing sites, or contained frameshifts (asterisks, Fig 1) Intron and exon sizes varied quite markedly (Table 4) Pronounced degeneration of the sequences upstream of the pseudogenes made it impossible
to predict the locations of the first introns and exons of Y1, Y2 and Y3
An alignment of the peptides predicted from the pleurocidin genes and pseudogenes is shown in Fig 1 All
of the genes, and even most of the pseudogenes, encode highly conserved signal sequences and anionic propieces The exception isY2, which encodes a very long carboxy-terminal extension The mature peptides, predicted by SignalP to start after the motif GEC, GES or GEG and
to terminate at the glycine adjacent to the acidic propiece (by comparison with the published amino acid sequence of pleurocidin [4]), are somewhat variable in sequence, net positive charge and length (Table 2)
Computer searches for promoters revealed common promoter motifs with very high scores (0.98–1.00) in the upstream regions of all four genes (Fig 2A) However, only aberrant motifs with much lower scores (0.88–0.93) could be detected in the upstream regions of the pseudogenes All of the high-scoring promoters exhibited significant sequence identity with one another (Fig 2B) but no similarity to the motifs upstream of pseudogenes
Table 3 Strains used to test antimicrobial activity of pleurocidins and
the corresponding MICs.
MIC in lgÆmL)1
NRC-01 WF2 WFX
WFY (Y1)
WFZ (Y1) Aeromonas salmonicida
A449 field isolate 64 2 >64 >64 >64
97–4 field isolate 64 2 >64 >64 32
Salmonella typhimurium
MS7953s supersusceptible 16 2 >64 64 16
14028s parent of
MS7953s
>64 16 >64 >64 >64 Pseudomonas aeruginosa
K799 parent of Z61 >64 8 >64 >64 32
Z61 supersusceptible 32 4 >64 64 8
Escherichia coli
CGSC4908 triple
auxotroph
32 2 >64 64 32 UB1005 parent of DC2 32 4 >64 >64 32
DC2 outer membrane
mutant
32 2 >64 >64 32 Staphylococcus epidermidis
Clinical isolate >64 8 >64 >64 32
Staphylococcus aureus
Methicillin resistant
clinical isolate
>64 8 >64 >64 64 Candida albicans
Clinical isolate 64 8 >64 >64 >64
Fig 1 Predicted amino acid sequences of peptide precursors encoded by pleurocidin genes and pseudogenes Single letter amino acid code is used and deletions are indicated by dashes (–) Insertions in WF1-like and Y2 peptides relative to the other peptides are indicated by arrows Positions of frameshifts in the Mature peptide region of Y2 and Y3 are indicated by asterisks (*).
Trang 5Apart from a 5-nucleotide deletion that was present in
the promoters from WF1 and WFX relative to WF2
and WFYT, the sequences differed at only five locations
and four of these were in a stretch of eight positions
at the 5¢ end Classical TATA and CAAT boxes could
be found in the upstream regions of all four genes but, of the pseudogenes, only Y3 had a TATA box
No CAAT boxes could be detected in any of the pseudogenes
Stage-specific gene expression of pleurocidin genes The results of RT-PCR expression assays of each pleuro-cidin gene during development are shown in Fig 3 Expression of WF1-like pleurocidin could not be detected
at any stage of development Expression of WFX was just discernable at 20 d.p.h whereas expression of WFYT and WF2 was readily detectable in premetamorphic larvae and juveniles
Tissue-specific gene expression of pleurocidin genes The results of RT-PCR expression assays of each pleuro-cidin gene in different tissues of adult fish are shown in Fig 4 Expression of WFX appears to be confined to the
Table 4 Sizes (in bp) of introns (I) and exons (E) of pleurocidin genes
and pseudogenes (Y) encoded on k1.1 and k5.1 clones ND, Not
deter-mined.
Name E1 I1 E2 I2 E3 I3 E4
WF1-like 25 120 155 539 31 95 112
WFX 25 119 101 453 19 97 85
WFYT 25 115 101 386 19 97 88
WF2 25 101 101 523 31 109 76
WFY (Y1) ND ND 101 2120 19 113 76
WFZ (Y1) ND ND 101 544 41 1656 87
Y2 ND ND 93 368 8 108 160
Y3 ND ND 102 524 30 97 67
Fig 2 Locations of transcription factor binding sites of pleurocidin genes and pseudogenes (A) and an alignment of predicted promoters (B) (A) Promoters are indicated by solid boxes with the corresponding score above The first two exons (hatched boxes) and the first intron (stippled box) of each gene are shown Asterisks above and below the lines represent GAAA motifs on the coding and noncoding strands, respectively AP-1, activator protein 1; ATF, activating transcription factor-1; CAAT, CCAAT binding factor; GATA, GATA motif; a-IFN, a-interferon; NF-IL6, nuclear factor-interleukin 6; OCT1, octamer motif (B) Upper case letters indicate nucleotides present in the pleurocidin transcripts and lower case letters indicate nucleotides present in the 5¢ nontranscribed portions of the genes The predicted promoter is underlined.
Trang 6skin whereas that of the other three genes is more
widespread, particularly in the gill, skin and gut tissues In
addition, WFYT transcripts were detected in spleen and
WF2 transcripts were found in liver
Pseudogene expression
No expression could be detected fromY1 either at different stages of development (Fig 3) or in different tissues (Fig 4),
Fig 3 RT-PCR of expression of pleurocidin genes and pseudogenes throughout larval development Larvae at 0, 5, 9, 15, 20, 25, 30 and 36 d.p.h and juveniles (J) were analyzed Controls using single primers (5¢, 3¢) and no template (NT) are also shown Exons and introns are represented as in Fig 2A No reading frames could be identified in regions represented by solid lines Portions of the clones flanking the pleurocidin gene clusters are not represented Markers (M) are a 100-bp ladder (100–400 bp shown).
Fig 4 RT-PCR assays of expression of pleurocidin genes and pseudogenes in different tissues Esophagus (E), pyloric stomach (PS), cardiac stomach (CS), pyloric caeca (PC), liver (L), spleen (Sp), intestine (I), rectum (R), gill (G), brain (B), muscle (Mu) and skin (Sk) were analysed Markers (M) and representations of genes and pseudogenes are the same as in Fig 3.
Trang 7consistent with the lack of a strong promoter motif, TATA
or CAAT boxes (Fig 2A) Primers based on alternatively
spliced transcripts that would give rise to either WFY or
WFZ peptides (Table 1), were both negative for expression
Although expression ofY2 and Y3 was not tested, it is
assumed that their aberrant genomic structure and lack of
promoters would preclude transcription
Antimicrobial activity of synthetic peptides
Minimal inhibitiory concentrations of the five tested
pep-tides against a range of bacteria and C albicans are shown
in Table 3 While WFX and WFY pleurocidins appeared to
be inactive in our hands, NRC-01 (similar to WF1-like) and
WFZ pleurocidins possessed moderate antimicrobial
acti-vity WF2, an amidated version of the original pleurocidin,
showed activity similar to that described in previous studies
[4] All peptides with detectable activity against P
aerugi-nosaZ61 (NRC-01, WF2, WFY and WFZ) retained that
activity in the presence of 200 mM NaCl (Table 5) The
ability of NRC-01 pleurocidin to kill A salmonicida A449,
Salmonella typhimurium MS7953s and C albicans at its
MIC and 10 times MIC is shown in Fig 5 NRC-01
pleurocidin added at 10 times MIC showed strong
bacte-ricidal and modest fungicidal activity against the pathogens
tested NRC-01 pleurocidin added at its MIC was less active
although it still showed bactericidal activity against
Salmonella typhimuriumand A salmonicida
Discussion
Antimicrobial peptides such as cecropins [28], apidaecins
[29], dermaseptins [30] and defensins [31] are known to be
encoded by multigene families Southern blot analysis of
apidaecin [29] and more recently, pleurocidin [5] and
hepcidin [12], indicate that antimicrobial peptide genes
may exist in clusters on the genome However, with the
exception of human defensins [32], definitive proof of a
clustered gene arrangement has never been demonstrated
In fact, genomic sequencing of the defensin cluster has
recently been used to uncover additional previously
unknown members of this antimicrobial peptide family [19]
Our data definitively demonstrate that pleurocidin genes
occur at at least two distinct loci on the winter flounder
genome Furthermore, we predict that there must be at least
one other locus encoding the previously described WF1,
WF1a, WF3 and WF4 pleurocidins [5] These may be
located on the other two lambda clones we isolated that had
slightly different restriction patterns from the two that were
sequenced
Given the high degree of sequence conservation among the pleurocidin genes and their flanking regions (Figs 1 and 2), it is possible that recombination between these conserved modules has allowed the generation of variants with diverse sequences, and presumably antimicrobial properties Some of these changes may be very subtle or even vary between winter flounder from different loca-tions; the WF2 pleurocidin we describe differs from the gene sequence determined by Cole et al [21] at seven
Table 5 Minimum inhibitory concentrations of peptides active against
P aeruginosa Z61 in the presence or absence of 200 m M NaCl.
MIC in lgÆmL)1against P aeruginosa Z61
No salt 200 m M NaCl
Fig 5 Ability of NRC-01 to kill A salmonicida (A), Salmonella typhimurium (B) and C albicans (C) Peptide was added at its MIC (h),
10 times MIC (n) and a no-peptide control was included in each group (r).
Trang 8positions in the upstream region and four positions in the
first intron, including a large deletion of 17 nucleotides
This amount of sequence divergence between different
individuals of the same species indicates that the
pleuro-cidin genes, like defensin genes, are evolving very rapidly
In addition, the identification of pseudogenes with a
relatively low amount of degeneration indicates a fairly
recent evolutionary event; the sequences were highly
similar to those found in active genes and easily
detect-able The ability to generate multiple genes encoding
diverse antimicrobial peptides may be one way that fish
are able to capitalize on this component of innate
immunity, both in killing microbes and in modulating
host immunity
Three pseudogenes were present in the cluster containing
the four functional pleurocidin genes In mammalian
genomes, pseudogenes are nearly as abundant as genes
[33], possibly as a result of the genomic processes involved in
generating multigene families, such as those concerned with
immunity The general assumption that pseudogenes
rep-resent dysfunctional relics has recently been contradicted by
the discovery of a pseudogene that regulates expression of
the functional gene from which it arose via an
RNA-mediated mechanism [34] It will be of interest to probe
whether a similar process may be involved in the regulation
of expression of pleurocidin (and possibly other
antimicro-bial peptide) genes
Little is known about the promoter or regulatory
sequences involved in pleurocidin gene expression In a
recent study comparing human and mouse genomes, it was
apparent that conserved noncoding genomic sequence (5¢
upstream and intron sequence) is often enriched in signals
involved in transcriptional regulation compared to coding
sequence [35] Furthermore, co-occurring pairs of
transcrip-tion factors could be identified using this approach By using
a similar comparative genomics approach, we have been
able to identify putative biologically active regulatory
elements upstream of pleurocidin genes and within the first
intron, including one with a high prediction score for a
eukaryotic promoter, and also to predict which
transcrip-tion factors are likely to interact
Transcription factors usually work in complexes to
regulate transcription [36] and their binding sites are often
clustered into modular units known as cis-regulatory
modules Recent analysis of clusters of transcription factor
binding sites in the Drosophila genome indicated that
multiple transcription factors are required to modulate
eukaryotic gene expression [37] While the consensus
sequences of some transcription factor binding sites are
known, their short length and low sequence complexity
often results in a high number of false positives in computer
searches due to random occurrences
Binding sites for various transcription factors known to
be involved in host defense [activator protein 1 (AP-1),
a-interferon (a-IFN), nuclear factor interleukin 6 (NF-IL6),
octamer motif (OCT1)] as well as GAAA motifs (commonly
found upstream of interferon-induced genes) were identified
in the upstream regions of both genes and pseudogenes or
within the first intron Those present in functional genes
conformed better to the consensus sequences than those
upstream of pseudogenes, as the latter appear to have
undergone substantial sequence drift As seen from Fig 2A,
many of these consensus binding sites are at similar positions
GAAA motifs were abundant upstream of genes (6–10 motifs) but rare upstream of pseudogenes (1–4 motifs) Binding sites for activator protein-1 (AP-1), a family of transcription factors consisting of homodimers and hetero-dimers of Jun, Fos or activating transcription factor 1 (ATF) were also located upstream of three of the four pleurocidin genes (for review of AP-1 function and regula-tion see [38]) Cis-regulatory elements containing AP-1 sites are regulated by multiple sets of bZIP transcription factor dimers with different binding and transactivation properties [39] ATF motifs were found upstream of only one gene (WF2) but in the identical position upstream of all three pseudogenes AP-1 factors are involved in cell differenti-ation and survival and are also produced after viral transformation of cells The presence of GAAA and AP-1 motifs indicates that pleurocidins may be induced by viral infection and play a role in clearing these pathogens although at this time we do not have antiviral activity data
to support this hypothesis
GATA motifs (WGATAR), which together with nuclear factor (NF)-jB motifs are necessary for tissue-specific expression of immunity genes in larval fat body (the insect equivalent of the liver) and hemocytes of Drosophila [40] and in erythroid-specific gene expression in mammals [41], were found within and/or upstream of WF2 and WFYT They may be responsible for the transcripts in liver (WF2) and spleen (WFYT) The more widespread pleurocidin expression in gill, skin and gut tissues is not surprising, given their proximity to the external environment (gill and skin) or bacteria in the gut (intestine, pyloric caecae, stomach and rectum) Specific cDNAs for WF1a, WF2 and WF3 have been cloned and sequenced from intestine [5] and immuno-gold electron microscopy revealed WF2-like pleurocidin transcripts in mucus-producing cells of skin and goblet cells
of small intestine in winter flounder [21] In addition, Paneth cells within the human intestine have been shown to express human defensin-5 [42] It is possible that pleurocidin transcripts also originate from immune cells circulating through these tissues In support of this, we have recently localized WF2 pleurocidin (both transcripts and peptide) to circulating eosinophilic granule cells in the gill of winter flounder [22] Human neutrophils contain defensins [31] and bovine neutrophils have been shown to store the anti-microbial peptide bactenecin in granules [43] In situ hybridi-zation experiments designed to elucidate which cell types are responsible for production of the various pleurocidins are underway in our lab
A cluster of NF-IL6 and/or a-IFN transcription factor binding sites within 150 nucleotides of the promoter co-occur in three out of the four pleurocidin genes (WFX, WF2 and WFYT) NF-IL6 is a member of the CCAAT/ Enhancer Binding Protein (C/EBP) class of leucine-zipper transcription factors that binds to an IL-1-responsive element in the IL-6 gene It is induced by IL-1, IL-6, and lipopolysaccharide during the acute phase response; it has been termed the master regulator of the immune response [44] and is involved in activating transcription of the inflammatory cytokines IL-6 and IL-8 [45] As antimicrobial peptides can be induced in response to infection [46], the detection of NF-IL6 sites is not surprising One of the AP-1
Trang 9sites was also found clustered with an NF-IL6 site upstream
of WF2 Similar association of these two sites has been
reported in the enhancer region of one of the winter
flounder antifreeze protein genes, where a sequence element
containing an AP-1 site binds two transcription factors, one
of which is a C/EBP family member, C/EBPa [47] Both
transcription factors are proposed to interact to direct
liver-specific gene expression in winter flounder Possibly the
expression of WF2 in the liver is regulated in a similar
manner
NFjB-like motifs have been found upstream of
antimi-crobial peptide genes in mammals, amphibia and Drosophila
[48], often adjacent to binding sites for NF-IL6 with which it
interacts to effect transcription of immune-relevant genes
[49] The lack of NF-jB motifs upstream of the pleurocidin
genes described in this study may mean that inducible
expression of pleurocidin occurs via some other
transcrip-tional pathway involving NF-IL6 either alone or with
another unidentified factor, or that additional pleurocidin
genes possessing NFjB binding sites in their upstream
sequences may exist elsewhere in the genome
Octamer motifs (ATGCAAAT) are present in the
noncoding sequences of all of the pleurocidins These motifs
are often found in enhancers, where they promote
tran-scription of immune-relevant genes In fish, such sequences
have been found in the salmon transferrin promoter [50],
trout MX genes [51] and catfish [52] The catfish IgH
enhancer contains 11 octamer motifs, of which nine are
functional [53] OCT1 sites have been detected in the human
IL-2 promoter [54] The occurrence of between one and four
OCT1 sites in pleurocidin genes indicates that they may be
involved in promoting transcription of antimicrobial
pep-tide genes as well as other immune-relevant genes in fish
Expression of WFX, WFYT and WF2 was detectable in
premetamorphic larvae and juveniles, but no expression of
WF1-like pleurocidin or any of the pseudogenes could be
detected at any stage of development Interestingly, the
cluster of NF-IL6 and a-IFN transcription factor binding
sites found upstream of WFX, WF2 and WFYT are absent
from WF1-like pleurocidin and the pseudogenes, indicating
that these motifs may be necessary for expression in the
larval stages Both WFYT and WF2 genes contain GATA
motifs, which have been shown to be essential for larval
expression of insect genes including those for two
anti-microbial peptides, cecropin and drosocin [40] Our earlier
studies showed the expression of pleurocidin at 5 d.p.h [5],
but the primers used could not discriminate between the
different variants described here It is likely that another, as
yet undescribed member of the pleurocidin gene family, is
expressed earlier in development
Although the focus of our study was not to identify
peptides with highly active antimicrobial properties, but
rather to demonstrate the power of genomics in identifying
novel peptide-encoding sequences, the modest activities we
detected against the microbes in our panel are encouraging
The peptides may be active against other species of bacteria
more commonly encountered in fish In addition, as many
antimicrobial peptides are known to synergize with each
other and with other components of the innate immune
system such as lysozyme [55], the in vivo effects may be more
powerful than shown in the in vitro assays performed in our
study The ability of antimicrobial peptides to exert positive
modulatory effects on the innate immune system [56] may result in further beneficial effects to the host The peptides are both inhibitory and cidal, although both activities vary from pathogen to pathogen, with C albicans counts being reduced only by one log order, even at 10 times the MIC Also, the peptides are able to exert their effects in the presence of 200 mMNaCl, a characteristic that is promising for application to cystic fibrosis treatment These results encourage us to scout the genome of winter flounder for more peptides with unique characteristics that could be of value in combating bacterial infections
Interestingly, the WFZ peptide exhibited some activity even though the gene is no longer functional There is no detectable promoter, few transcriptional control sequences,
no initiator methionine, and frameshift mutations are present Nonetheless, the predicted peptide encoded by this pseudogene is highly positively charged (Table 2) This underscores the advantage of scanning genomic informa-tion for possible antimicrobial peptide sequences: even if the genes are no longer functional, the peptides they once encoded may be of interest
In conclusion, we have identified two clusters containing several pleurocidin-like antimicrobial peptide genes and pseudogenes and determined the antimicrobial activities of synthetic peptides predicted from these sequences We have performed a comprehensive survey of the differential expression of these genes and pseudogenes and shown for the first time that the different antimicrobial peptide genes are expressed in different tissues and at different times during development Using comparative genomics, we have been able to identify sequence motifs that potentially bind transcription factors involved in the regulation of expression
of immunity-related genes This has provided us with a window into the complex regulatory processes that appear
to govern the transcription of different members of this multigene family Future studies aimed at dissecting the promoter and critical cis-regulatory sequences will further enhance our understanding of the regulation of this important component of innate immunity
Acknowledgements
We thank Dr Vanya Ewart for critically reviewing this manuscript prior
to submission This is NRCC publication 42402.
References
1 Hancock, R.E & Lehrer, R (1998) Cationic peptides: a new source of antibiotics Trends Biotechnol 16, 82–88.
2 Tatner, M.F & Horne, M.T (1983) Susceptibility and immunity
to Vibrio anguillarum in post-hatching rainbow trout fry, Salmo gairdneri Richardson 1836 Dev Comp Immunol 7, 465–472.
3 Bly, J.E & Clem, L.W (1991) Temperature-mediated processes in teleost immunity: in vitro immunosuppression induced by in vivo low temperature in channel catfish Vet Immunol Immunopathol.
28, 365–377.
4 Cole, A.M., Weis, P & Diamond, G (1997) Isolation and char-acterization of pleurocidin, an antimicrobial peptide in the skin secretions of winter flounder J Biol Chem 272, 12008–12013.
5 Douglas, S.E., Gallant, J.W., Gong, Z & Hew, C (2001) Cloning and developmental expression of a family of pleurocidin-like antimicrobial peptides from winter flounder, Pleuronectes amer-icanus (Walbaum) Dev Comp Immunol 25, 137–147.
Trang 106 Oren, Z & Shai, Y (1996) A class of highly potent antibacterial
peptides derived from pardaxin, a pore-forming peptide isolated
from Moses sole fish Pardachirus marmoratus Eur J Biochem.
237, 303–310.
7 Park, C.B., Lee, J.H., Park, I.Y., Kim, M.S & Kim, S C (1997) A
novel antimicrobial peptide from the loach, Misgurnus
anguilli-candatus FEBS Lett 411, 173–178.
8 Hwang, E.-Y., Seo, J.-K., Kim, C.-H., Go, H.-J., Kim, E.-J.,
Chung, J.-K., Ryu, H.-S & Park, N.-G (1999) Purification and
characterization of a novel antimicrobial peptide from the skin of
the hagfish, Eptatretus burgeri J Food Sci Nutr 4, 28–32.
9 Silphaduang, U & Noga, E.J (2001) Peptide antibiotics in mast
cells of fish Nature 414, 268–269.
10 Lauth, X., Shike, H., Burns, J.C., Westerman, M.E., Ostland,
V.E., Carlberg, J.M., Van Olst, J.C., Nizet, V., Taylor, S.W.,
Shimizu, C & Bulet, P (2002) Discovery and characterization of
two isoforms of moronecidin, a novel antimicrobial peptide from
hybrid striped bass J Biol Chem 277, 5030–5039.
11 Shike, H., Lauth, X., Westerman, M.E., Ostland, V.E., Carlberg,
J.M., Van Olst, J.C., S himizu, C & Burns, J.C (2002) Bass
hep-cidin is a novel antimicrobial peptide induced by bacterial
chal-lenge Eur J Biochem 269, 2232–2237.
12 Douglas, S.E., Gallant, J.W., Liebscher, R.S., Dacanay, A &
Tsoi, S.C.M (2003) Identification and expression analysis of
hepcidin–like antimicrobial peptides in bony fish Dev Comp.
Immunol 27, 589–601.
13 Iijima, N., Tanimoto, N., Emoto, Y., Morita, Y., Uematsu, K.,
Murakami, T & Nakai, T (2003) Purification and
characteriza-tion of three isoforms of chrysophsin, a novel antimicrobial
pep-tide in the gills of the red sea bream, Chrysophrys major Eur J.
Biochem 270, 675–686.
14 Park, I.Y., Park, C.B., Kim, M.S & Kim, S.C (1998) Parasin I, an
antimicrobial peptide derived from histone H2A in the catfish,
Parasilurus asotus FEBS Lett 437, 258–262.
15 Birkemo, A.G., Luders, T., Andersen, O., Nes, I.F &
Nissen-Meyer, J (2003) Hipposin, a histone-derived antimicrobial peptide
in Atlantic halibut (Hippoglossus hippoglossus L.) Biochim
Bio-phys Acta 1646, 207–215.
16 LeMaitre, C., Orange, N., Saglioi, P., Saint, N., Gagnon, J &
Molle, G (1996) Characterization and ion channel activities of
novel antibacterial proteins from the skin mucosa of carp
(Cyprinus carpio) E ur J Biochem 240, 143–149.
17 Smith, V.J., Fernandes, J.M.O., Jones, S.J., Kemp, G.D &
Tatner, M.F (2000) Antibacterial proteins in rainbow trout,
Oncorhynchus mykiss Fish Shellfish Immunol 10, 243–260.
18 Moore, K.S., Wehrli, S., Roder, H., Rogers, M., Forrest, J.N.J.,
McCrimmon, D & Zasloff, M (1993) Squalamine: an
amino-sterol antibiotic from the shark Proc Natl Acad Sci USA 90,
1354–1358.
19 Jia, H.P.C.S.B., Schudy, A., Linzmeier, R., Guthmiller, J.M.,
Johnson, G.K., Tack, B.F., Mitros, J.P., Rosenthal, A., Ganz, T.
& McCray, P.B (2001) Discovery of human b-defensins using a
genomics-based approach Gene 263, 211–218.
20 Schutte, B.C., Mitros, J.P., Bartlett, J.A., Walters, J.D., Jia, H.P.,
Welsh, M.J., Casavant, T.L & McCray, P.B Jr (2002)
Discovery of five conserved beta -defensin gene clusters using a
computational search strategy Proc Natl Acad Sci USA 99,
2129–2133.
21 Cole, A.M., Darouiche, R.O., Legarda, D., Connell, N &
Diamond, G (2000) Characterization of a fish antimicrobial
peptide: gene expression, subcellular localization, and spectrum of
activity Antimicrob Agents Chemother 44, 2039–2045.
22 Murray, H.M., Gallant, J.W & Douglas, S.E (2003) Cellular
localization of pleurocidin expression in winter flounder gill using
immunohistochemistry and in situ hybridization Cell Tiss Res.
312, 197–202.
23 Douglas, S.E., Gawlicka, A., Mandla, S & Gallant, J.W (1999) Ontogeny of the stomach in winter flounder: characterisation and expression of the pepsinogen and proton pump genes and determination of pepsin activity J Fish Biol 55, 897–915.
24 Wingender, E., Chen, X., Fricke, E., Geffers, R., Hehl, R., Liebich, I., Krull, M., Matys, V., Michael, H., Ohnhauser, R., Pruss, M., Schacherer, F., Thiele, S & Urbach, S (2001) The TRANSFAC system on gene expression regulation Nucleic Acids Res 29, 281–283.
25 Cohen, S., Sekiguchi, M., Stern, J & Barner, H (1963) The synthesis of messenger RNA without protein synthesis in normal and phage-infected thymineless strains of Escherichia coli Proc Natl Acad Sci USA 49, 699–703.
26 Amsterdam, D (1996) Susceptibility Testing of Antimicrobials in Liquid Media In Antibiotics in Laboratory Medicine EI (Lorian, V., ed.), pp 52–111 Williams & Wilkins, Baltimore.
27 Wu, M & Hancock, R.E (1999) Improved derivatives of bacte-necin, a cyclic dodecameric antimicrobial cationic peptide Anti-microb Agents Chemother 43, 1274–1276.
28 Gudmundsson, G.H., Lidholm, D.A., Asling, B., Gan, R & Boman, H.G (1991) The cecropin locus Cloning and expression
of a gene cluster encoding three antibacterial peptides in Hyalo-phora cecropia J Biol Chem 166, 11510–11517.
29 Casteels-Jossen, K., Capaci, T., Casteels, P & Tempst, P (1993) Apidaecin multipeptide precursor structure: a putative mechanism for amplification of the insect antibacterial response EMBO J 12, 1569–1578.
30 Amiche, M., Seon, A.A., Pierre, T.N & Nicolas, P (1999) The dermaseptin precursors: a protein family with a common pre-proregion and a variable C-terminal antimicrobial domain FEBS Lett 456, 352–356.
31 Ganz, T., Selsted, M.E., Szklarek, D., Harwig, S.S., Daher, K., Bainton, D.F & Lehrer, R.I (1985) Defensins Natural peptide antibiotics of human neutrophils J Clin Invest 76, 1427–1435.
32 Harder, J., Siebert, R., Zhang, Y., Matthiesen, P., Christophers, E., Schlegelberger, B & Schroder, J.M (1997) Mapping of the gene encoding human beta-defensin-2 (DEFB2) to chromosome region 8p22-p23.1 Genomics 46, 472–475.
33 Harrison, P.M., Hegyi, H., Balasubramanian, S., Luscombe, N.M., Bertone, P., Echols, N., Johnson, T & Gerstein, M (2002) Molecular fossils in the human genome: identification and analysis
of the pseudogenes in chromosomes 21 and 22 Genome Res 12, 272–280.
34 Hirotsune, S., Yoshida, N., Chen, A., Garrett, L., Sugiyama, F., Takahashi, S., Yagami, K., Wynshaw-Boris, A & Yoshiki, A (2003) An expressed pseudogene regulates the messenger-RNA stability of its homologous coding gene Nature 423, 91–96.
35 Levy, S., Hannenhalli, S & Workman, C (2001) Enrichment of regulatory signals in conserved non-coding genomic sequence Bioinformatics 17, 871–877.
36 Wagner, A (1999) Genes regulated cooperatively by one or more transcription factors and their identification in whole eukaryotic genomes Bioinformatics 10, 776–784.
37 Berman, B.P., Nibu, Y., Pfeiffer, B.D., Tomancak, P., Celniker, S.E., Levine, M., Rubin, G.M & Eisen, M.B (2002) Exploiting transcription factor binding site clustering to identify cis-reg-ulatory modules involved in pattern formation in the Drosophila genome Proc Natl Acad Sci USA 99, 757–762.
38 Karin, M., Liu, Z & Zandi, E (1997) AP-1 function and reg-ulation Curr Opin Cell Biol 9, 240–246.
39 Kataoka, K., Noda, M & Nishizawa, M (1996) Transactivation activity of Maf nuclear oncoprotein is modulated by Jun, Fos and small Maf proteins Oncogene 12, 53–62.
40 Petersen, U.M., Kadalayil, L., Rehorn, K.P., Hoshizaki, D.K., Reuter, R & Engstrom, Y (1999) S erpent regulates Drosophila