Báo cáo khoa học: Interaction of selenium compounds with zinc finger proteins involved in DNA repair pdf

Originally identified as being present in different transcription factors, it is now known that zinc finger structures are among the most abundant protein motifs in the eukaryotic genome a

Interaction of selenium compounds with zinc finger proteins involved

in DNA repair

Holger Blessing1, Silke Kraus1, Philipp Heindl1, Wojciech Bal2and Andrea Hartwig1,3

1

Institute of Food Chemistry and Toxicology, University of Karlsruhe, Germany;2Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw, Poland;3Institute of Food Technology and Food Chemistry, Technical University Berlin, Germany

As an essential element, selenium is present in enzymes from

several families, including glutathione peroxidases, and is

thought to exert anticarcinogenic properties A remarkable

feature of selenium consists of its ability to oxidize thiols

under reducing conditions Thus, one mode of action

recently suggested is the oxidation of thiol groups of

metal-lothionein, thereby providing zinc for essential reactions

However, tetrahedral zinc ion complexation to four

thio-lates, similar to that found in metallothionein, is present in

one of the major classes of transcription factors and other

so-called zinc finger proteins Within this study we

investi-gated the effect of selenium compounds on the activity of the

formamidopyrimidine-DNA glycosylase (Fpg), a zinc finger

protein involved in base excision repair, and on the

DNA-binding capacity and integrity of xeroderma pigmentosum

group A protein (XPA), a zinc finger protein essential

for nucleotide excision repair The reducible selenium

compounds phenylseleninic acid, phenylselenyl chloride,

selenocystine, ebselen, and 2-nitrophenylselenocyanate caused a concentration-dependent decrease of Fpg activity, while no inhibition was detected with fully reduced selenomethionine, methylselenocysteine or some sulfur-containing analogs Furthermore, reducible selenium com-pounds interfered with XPA–DNA binding and released zinc from the zinc finger motif, XPAzf Zinc release was even evident at high glutathione/oxidised glutathine ratios pre-vailing under cellular conditions Finally, comparative studies with metallothionein and XPAzf revealed similar or even accelerated zinc release from XPAzf Altogether, the results indicate that zinc finger motifs are highly reactive towards oxidizing selenium compounds This could affect gene expression, DNA repair and, thus, genomic stability Keywords: DNA repair; glutathione; metallothionein; selenium; zinc finger proteins

As an essential element, selenium is present in enzymes

from several families, including glutathione peroxidases

and thioredoxin reductases [1] Epidemiological evidence, as

well as animal studies, point towards an inverse relationship

between selenium intake and certain types of cancer [2,3],

even though there are still some inconsistencies [4] and the

levels required are a matter of debate [5] Moreover, a

multicenter, double-blind, randomized, placebo-controlled

cancer prevention trial, originally started up to investigate

whether nutritional supplementation with selenium can

decrease the risk of skin cancer, revealed significant

reductions in lung, colorectal and prostate cancers as

secondary end-points [6] Nevertheless, a follow-up of this

study demonstrated an increased incidence of squamous cell carcinoma and of total nonmelanoma skin cancer [7] As selenocysteine is an essential constituent of glutathione peroxidases [8], selenium has been proposed to be an antioxidant, but careful consideration of its manifold chemical properties and biological activities reveals far more complex roles with respect to cancer, artherosclerosis and neurodegenerative diseases [9] From a biochemical point of view, selenium substitutes for sulfur in defined cysteines in selenoproteins It differs from sulfur by redox potentials and stabilities of oxidation states, leading to multiple catalytic potentials A remarkable feature of selenium consists of its ability to oxidize thiols under reducing conditions that are present in the cytosol [2,10,11] One mode of action recently suggested, which may be related to the protective properties of selenium, is its involvement in cellular zinc homeostasis This assumption is based on the capacity of certain selenium compounds to catalyse thiol/disulfide interchange reactions, which mobil-ize redox-inert zinc from its binding sites, and to reduce protein disulfides, thereby generating potential binding sites for zinc in proteins In this context, reducible selenium compounds have been shown to release zinc from metal-lothionein (MT) in isolated systems, which may thus be available for essential reactions [12–16] However, tetrahe-dral zinc ion complexation to four thiolates, similarly to that found in MT, is present in one of the major classes of transcription factors and other so-called zinc finger proteins

Correspondence to A Hartwig, Technical University Berlin, Institute

of Food Technology and Food Chemistry, Sekr TIB 4/3-1,

Gustav-Meyer-Allee 25, D-13355 Berlin, Germany.

Fax: +49 30 314 72823, Tel.: +49 30 314 72789,

E-mail: Andrea.Hartwig@TU-Berlin.de

Abbreviations: Fpg, formamidopyrimidine-DNA glycosylase; GSH,

reduced glutathione; GSSG, oxidized glutathione; MT,

metallo-thionein; NER, nucleotide excision repair; PAR,

4-(2-pyridylazo)-resorcinol; XPA, xeroderma pigmentosum group A protein;

XPAzf, synthetic polypeptide corresponding to the

XPA zinc finger domain.

(Received 5 February 2004, revised 6 June 2004, accepted 9 June 2004)

(Fig 1), raising the question of whether reducible selenium compounds are able to release zinc also from this group of proteins They represent a family of proteins where zinc is complexed through four invariant cysteine and/or histidine residues, forming a zinc finger domain that is mostly involved in DNA binding but also in protein–protein interactions [17] Originally identified as being present in different transcription factors, it is now known that zinc finger structures are among the most abundant protein motifs in the eukaryotic genome and have diverse functions

in many cellular processes [18]: from human genome sequencing it is estimated that
3% of the identified genes encode proteins with zinc finger domains [19] It is assumed that many of these proteins are regulated by the oxidation of zinc-binding cysteine residues, which leads to a loss of DNA binding, zinc release and/or formation of disulfide bridges [20] With respect to selenium compounds, it has recently been shown that selenite impairs the DNA-binding activity

of TFIIIH, a transcription factor with three zinc finger motifs of the Cys2His2type [21] Furthermore, nanomolar concentrations of glutathione peroxidase mimics were demonstrated to facilitate the H2O2-induced oxidation of

a Sp1 transcription factor fragment [22] While interactions

of selenium compounds with redox-regulated transcription factors have been repeatedly discussed to be involved in selenium-based chemopreventive effects [23,24], it has to be taken into account that, besides transcription factors, zinc finger structures are also present in other proteins that have essential functions in maintaining genomic stability These include factors involved in DNA damage signaling and repair, such as poly(ADP-ribose) polymerase-1, formami-dopyrimidine-DNA glycosylase (Fpg), which is involved in the repair of certain types of oxidative DNA base damage [25], and xeroderma pigmentosum group A protein (XPA), which is essential for the assembly of the DNA damage recognition/incision complex during nucleotide excision repair (NER) in mammalian cells [26]

Within the present study we investigated the effects of selenium compounds in different oxidation states, as listed in Table 1, on the activities of the DNA repair proteins Fpg and XPA, as well as on zinc release from a synthetic polypeptide, corresponding to the XPA zinc finger domain (XPAzf) Furthermore, comparative studies with MT and XPAzf were conducted to elucidate the efficiency of zinc release, and, finally, different concentrations of reduced and oxidized glutathione (GSH and GSSG, respectively) were used to investigate the effects under reducing vs oxidizing condi-tions We used methylselenocysteine and selenomethionine,

as well as selenocystine, as constituents of selenium-enriched yeast, broccoli and onion [27,28] Our study also included ebselen, phenylseleninic acid, phenylselenyl chloride and 2-nitrophenylselenocyanate – synthetic organic compounds with functional selenium groups exerting cancer-preventive activities and/or which have been shown previously to release zinc from MT [13–16] We demonstrate that the reducible selenium compounds included in this study (a) inhibit Fpg activity, (b) modulate XPA–DNA interactions, and (c) release zinc from XPAzf with equal or stronger efficiency than MT The release of zinc also occurred at high ratios of GSH/GSSG, indicating that this reaction mechanism may also be relevant for cellular conditions

Fig 1 Structures of metallothionein (MT) and XPAzf (a synthetic

polypeptide corresponding to the xeroderma pigmentosum group A

protein zinc finger domain) (A) Crystal structure of Cd 5 Zn 2 -MT-2

from rat liver, showing the N-terminal b-domain (upper part) and the

C-terminal a-domain (lower part) [56] (B) Solution structure of

XPAzf, based on the NMR structure of XPA-MBD [31,58]

Side-chains of the zinc coordinating cysteines are colored in black Both MT

and XPAzf exert tetrahedral metal ion coordination [31,57]

Coordi-nating cysteines are numbered 105, 108, 126 and 129 in XPA and 5, 7,

13, 15, 19, 21, 24, 26, 29, 33, 34, 36, 37, 41, 44, 48, 50, 57, 59 and 60 in

MT These structures are adapted from entries made to the

Brook-haven protein databank (accession code 4mt2 for MT and 1xpa for

XPA) and modified with CHIME (version 2.6 SP6).

Materials and methods

Materials

Agarose type II, dimethylsulfoxide, phenylseleninic acid,

methylselenocysteine, diamide, Ficoll 400, zinc

metallo-thionein II and BSA were from Sigma-Aldrich

(Deisenho-fen, Germany).L-cystine, phenylsulfinic acid,L-methionine,

methylene blue, xylene cyanol FF and 2-2¢-dithiodipyridine

were obtained from Fluka Chemie (Buchs, Switzerland)

Bromophenol blue sodium salt, phenylselenyl chloride,

acrylamide/bisacrylamide solution (37.5 : 1, w/w; 40%,

w/v), ammonium peroxodisulfate, as well as zinc(II)

chlor-ide, were products of Merck (Darmstadt, Germany)

Anti-digoxigenin Fab fragments and blocking reagent were

obtained from Boehringer (Mannheim, Germany), and

dithiothreitol, maleic acid, TEMED and Tween-20 were

from Serva (Heidelberg, Germany) Enhanced

chemilumi-nescence (ECL)TM detection reagents were provided by

Amersham (Bucks., UK) 4-(2-Pyridylazo)-resorcinol

monosodium salt (PAR) was from Riedel-de Haen (Seelze,

Germany) Ebselen, 2-nitrophenylselenocyanate, L

-seleno-methionine andL-selenocystine were obtained from Acros

(Geel, Belgium)

Fpg activity

Fpg was a kind gift of S Boiteux (Commissariat a

l’Energie Atomique, Fontenay aux Roses, France) The

concentration applied in the activity assay (1 lgÆmL)1) was

selected based on the results of dose–response experiments

leading to saturation in DNA damage recognition, as determined for each batch of the enzyme No nonspecific DNA cleavage was observed Fpg activity was quantified by incision of oxidatively damaged PM2 DNA, essentially as described previously [29] with some modifications Briefly, PM2 bacteriophage was amplified in Alteromonas espejiana and its circular supercoiled DNA of 10 kb was purified, yielding
90% supercoiled molecules PM2 DNA was dissolved in enzyme buffer (40 mM sodium phosphate,

100 mM NaCl, pH 7.4) and oxidatively damaged by addition of the photoreactive thiazin dye methylene blue (final concentration 10 lgÆmL)1) and irradiation with visible light (216 JÆm)2) After precipitation (at 4C for 30 min) with ethanol containing 125 mMsodium acetate, the DNA

was centrifuged for 5 min at 7000 g The supernatant was

discarded and the DNA pellet resuspended in enzyme buffer Damage induction and all subsequent steps were carried out in the dark to prevent additional DNA damage Oxidatively damaged PM2 DNA (300 ng per sample) and Fpg (1 lgÆmL)1; 30 lL per sample) were incubated for

30 min at 37C; the reaction was terminated by adding

7 lL of stop solution (0.25% bromophenol blue, 0.25% xylene cyanol, 15% Ficoll 400, w/w/w) When investigating the effects of selenium compounds, Fpg was preincubated with the respective compounds for 30 min at 37C in enzyme buffer DNA strand breaks or nicks generated by Fpg convert the supercoiled PM2 molecule into the open circular form; both forms were separated by electrophoresis

in a 1% agarose gel in buffer (89 mMTrizma-Base, 89 mM boric acid, 1 mM EDTA, pH 8.2) for 2.5 h at 90 V and stained with ethidium bromide The bands were quantified

by applying a HEROLAB gel detection system (E.A.S.Y WIN 32) For calculation of break frequencies, a Poisson distribution was assumed and a correction factor of 1.4 was applied to compensate for the relatively lower fluorescence

of the supercoiled form [30]:

N¼ ln½ð1:4  IÞ=ð1:4  I þ IIÞ

where N¼ the number of strand breaks per molecule of PM2, I¼ the percentage of supercoiled PM2 DNA, and

II¼ the percentage of open circular PM2 DNA The overall number of strand breaks per 10 000 bp represents the sum of single-strand breaks and incisions generated by the repair enzyme

DNA-binding activity of XPA Purified recombinant mouse XPA protein was kindly provided by A Eker (University of Rotterdam, Rotterdam, the Netherlands) The DNA-binding activity was deter-mined by gel mobility shift experiments using a digoxygenin end-labeled synthetic double-strand oligonucleotide (70 bp; MWG Biotech, Ebersberg, Germany) of the following 5¢ fi 3¢ sequence: 5¢-ATATGTGCACATGGCGCACGT ATGTATCTATAGTCTGCCATCACGCCAGTCAAT CGCTGTGGTATATGCA-3¢ XPA (500 ng) was pre-treated with selenium compounds for 30 min at 37C in the gel shift buffer (final concentration 25 mM Hepes-KOH, 10% glycerol, 30 mM KCl, 4 mM MgCl2, 1 mM EDTA, 45 lgÆmL)1BSA, 15 lM dithiothreitol, pH 8.3) previously purged with argon Afterwards, 240 fmol of the irradiated (18 kJÆm)2UVC; 254 nm germicidal lamp,

Table 1 Structures and oxidation states of selenium compounds used in

the present study.

VL-6C; Bioblock Scientific, Illkirch, France)

digoxigenin-labeled oligonucleotide were added and incubated for

30 min at room temperature in the dark The binding

mixture was loaded onto a 5% polyacrylamide gel

[acrylamide/bisacrylamide (37.5 : 1.0, w/w), 50 mMTris/

HCl, 50 mM boric acid, 1 mM EDTA, pH 8.0] and

electrophoresis was conducted for 75 min Southern

blotting was carried out in a semidry electroblotting

apparatus using a positively charged nylon membrane

(Hybond-N+Amersham, Braunschweig, Germany),

fol-lowed by fixation at 90C for 1.5 h Digoxigenin-labelled

oligonucleotide was detected by chemiluminescence with

an anti-digoxigenin immunoglobulin conjugated to

horseradish peroxidase, using the ECLTM detection

system (Amersham, UK)

Zinc release from XPAzf and MT

The XPAzf peptide with the sequence: Ac-DYVICEE

CGKEFMDSYLMNHFDLPTCDNCRDADDKHK-am

(purity > 95%) was custom synthesized by Schafer-N

(Copenhagen, Denmark) The identity and purity of the

peptide was confirmed by HPLC and ESI-MS, as described

previously [31] Reconstitution of the zinc finger structure

was performed by the addition of equimolar amounts of

zinc, which resulted in correct folding, as demonstrated by

CD spectra and fluorescence spectroscopy [31]

Unbound zinc and salts were removed from MT by

ultrafiltration and MT was further characterized by

quan-tification of the thiol groups with 2-2¢-dithiodipyridine

[32,33], yielding 19.2 thiol groups per molecule Protein

concentrations were determined spectrophotometrically by

using the extinction coefficients published previously [34]

Determination of the metal content of MT by complete zinc

release after oxidation with 10 mM H2O2 and ICP-MS

revealed 6.4 zinc atoms per molecule of MT and negligible

amounts of cadmium and copper

Zinc release from XPAzf and MT was measured

spectro-photometrically by quantifying the formation of complexes

between two molecules of the chelating dye PAR and zinc(II)

[35,36] XPAzf (20 lM) or MT (5 lM) were incubated with

the respective selenium compounds for 30 min at 37C in

20 mM Hepes-NaOH buffer (pH 7.4), previously purged

with argon Following the addition of 100 lM PAR, the

absorption was measured immediately at 492 nm As

positive controls, XPAzf or MT were exposed to 10 mM

H2O2for 30 min at 37C to fully oxidize the thiol groups in

the respective molecule Zinc release occurring under these

conditions was maximal and considered to be 100%

Results

Effect of selenium and corresponding sulfur compounds

on Fpg activity

First, the effect of selenium compounds on the activity of

the isolated Fpg was investigated Fpg recognizes and

removes 7,8-dihydro-8-oxoguanine (8-oxoguanine), the

imidazol ring opened purines

2,6-diamino-4-hydroxy-5-formamidopyrimidine (Fapy-Gua),

4,6-diamino-5-form-amidopyrimidine (Fapy-Ade) and, to a smaller extent,

7,8-dihydro-8-oxoadenine (8-oxoadenine), as well as

apuri-nic/apyrimidinic sites, and converts them into DNA single-strand breaks by its associated DNA endonuclease activity [37, 38] We applied supercoiled isolated PM2 DNA, which had been oxidatively damaged with methylene blue and visible light, a treatment shown to generate predominantly 8-oxoguanine and small amounts of Fapy-Gua [38, 39]; if Fpg is active, then oxidatively damaged supercoiled PM2 molecules are converted into the open circular form None

of the selenium compounds induced DNA strand breaks by themselves (data not shown); however, Fpg activity was inhibited to differing extents, depending on the selenium compound (Fig 2) While fully reduced selenomethionine and methylselenocysteine did not affect enzyme activity at concentrations up to 1 mM(data not shown), phenylselenyl chloride, selenocystine, phenylseleninic acid, 2-nitrophenyl-selenocyanate and ebselen reduced the Fpg activity in a dose-dependent manner, yielding complete inhibition The strongest inhibition was observed when using ebselen; the enzyme was almost completely inactivated at 100 nM selenium compound To determine whether these inhibi-tions were mediated by selenium, comparative studies were conducted with some sulfur analogues As shown in Fig 3, neither cystine nor phenylsulfinic acid affected Fpg activity

at strongly inhibitory concentrations of the respective selenium compounds Furthermore, no inhibition was observed with up to 1 mMmethionine

Effect of selenium compounds on XPA-DNA binding Next, the effects of different selenium compounds on the activity of the XPA protein were investigated XPA binds specifically to damaged DNA, including lesions induced by UVC and benzo[a]pyrene [40–42]; in the present study we analyzed its ability to bind to a UVC-damaged oligonucle-otide by gel mobility shift assay One representative outcome of the experiments is shown in Fig 4, derived after a 30 min preincubation of XPA with selenocystine In the absence of XPA, selenocystine did not affect the migration of free oligonucleotide (data not shown) In the absence of selenocystine, a shift in UVC-irradiated free

Fig 2 Effects of phenylselenyl chloride, phenylseleninic acid, 2-nitrophenylselenocyanate, selenocystine and ebselen on the activity of formamidopyrimidine-DNA glycosylase (Fpg) on methylene blue-damaged PM2 DNA The protein was incubated with the respective selenium compound for 30 min at 37 C, at the concentrations indi-cated The mean values of at least four determinations + SD are shown.

oligonucleotide (lane 1, band 1) mobility was observed, thus

demonstrating specific binding of XPA (lane 2, band 2)

With increasing concentrations of selenocystine (lanes

3–10), the intensity of band 2 decreased Nevertheless,

instead of free oligonucleotide, which would be expected in

the event of diminished XPA–DNA binding, a new band of

even slower migration appeared (band 3), indicative of high

molecular mass DNA–protein complexes Similarly,

com-plete inhibition of oligonucleotide migration was seen with

25 lMphenylseleninic acid or 75 lMphenylselenyl chloride,

as well as with the thiol-oxidizing compound, diamide (data

not shown), indicating that thiol oxidation, and probably

disulfide formation, may account for this effect In contrast,

oligonucleotide–XPA binding was not affected at up to

1 mMconcentrations of fully reduced methylselenocysteine

and selenomethionine (data not shown)

Zinc release from XPAzf by selenium compounds

To investigate the interactions with the zinc finger structure

more directly, a peptide consisting of 37 amino acids

(XPAzf) was applied as a model, representing the amino

acid sequence and structure of the zinc finger domain of

human XPA [31] Zinc release was followed

spectrophoto-metrically by formation of the zinc–PAR complex, as described in the Materials and methods As a positive control, the Zn(II)-complexed peptide (20 lM) was treated with 10 mMhydrogen peroxide, leading to a saturation of zinc release caused by fully oxidized thiolates In negative controls (bidistilled water in the absence of selenium) no considerable zinc release was observed (data not shown) Concerning the selenium compounds,
50% zinc release (equivalent to 10 lM Zn2+) was observed with 3 lM 2-nitrophenylselenocyanate, 6 lMselenocystine, 12 lM phe-nylseleninic acid, 16 lM ebselen or 21 lM phenylselenyl chloride In contrast, methylselenocysteine and seleno-methionine, when used at concentrations up to 1000 lM, were unable to release zinc (Fig 5)

To compare zinc release by selenium compounds with zinc release by the cellular oxidant GSSG, and to investigate the potential physiological relevance of zinc release by selenium compounds, experiments were per-formed by applying 3 mM GSSG, 1 mM GSH or 10 lM phenylseleninic acid, as well as different GSH/GSSG ratios As expected, only marginal zinc release was observed in the presence of 1 mM GSH In contrast,

3 mM GSSG induced
22% zinc release, while 10 lM phenylseleninic acid (in the absence of GSH and GSSG) resulted in
40% zinc release (data not shown), indica-ting that reducible selenium is a stronger oxidant than GSSG At GSH/GSSG concentration ratios of 1 : 1 to

3 : 1, which is observed in the endoplasmic reticulum [43], zinc release mediated by phenylseleninic acid was accel-erated, from 40% in the absence of GSH/GSSG to 50%

or 70%, respectively At high GSH/GSSG ratios between

40 and 100 prevailing in the overall cell, zinc release was still evident, although to a smaller extent (Fig 6) Comparative studies on zinc release from MT and XPAzf

As stated in the Introduction, previous studies by Maret and co-workers have demonstrated zinc release from MT, induced by reducible selenium compounds, as a potential indication for the involvement of selenium in zinc homeo-stasis [12–16] Thus, in the present study, comparative experiments were conducted to elucidate whether, in the presence of selenium compounds, zinc is released more, equal to or less efficiently from XPAzf than MT As shown

in Fig 7, all reducible selenium compounds mediated zinc

Fig 4 Effect of selenocystine on the DNA-binding activity of xeroderma pigmentosum group A protein (XPA) to a UVC-irradiated oligonucleotide XPA was incubated with selenocystine for 30 min at 37 C and its binding activity was analysed by gel mobility shift assay, as described in the Materials and methods One representative experiment is shown.

Fig 3 Effects of selenomethionine, selenocystine and phenylseleninic

acid and the sulfur analogous methionine, cystine and phenylsulfinic acid

on formamidopyrimidine-DNA glycosylase (Fpg) activity Fpg was

incubated with the respective compound for 30 min at 37 C, at the

concentrations indicated The mean values of at least four

determi-nations + SD are shown.

release also from MT, while fully reduced selenomethionine

and methylselenocysteine were inactive, as seen previously

with XPAzf As MT contains 20 zinc-binding cysteines as

compared to four cysteines in XPAzf, for better

compar-ison, zinc release was plotted against the ratio of selenium

compound/cysteine In the case of selenocystine and

2-nitrophenylselenocyanate, zinc was released with an even

higher efficiency from XPAzf than from MT (Fig 8); with

respect to ebselen, phenylseleninic acid and phenylselenyl

chloride, zinc release occurred at similar concentrations from both molecules (Fig 9)

Discussion

The cancer-preventive activities of selenium compounds have long been discussed, such as the effects of different dietary levels as a result of geographical variation, the potential benefits of dietary supplements, and the clinical applications as chemopreventive agents [2–4,6,9] Further-more, selenium deficiency has been linked to increased viral pathogenicity in humans (Keshan disease) and in animal experiments [44] One obvious function of selenium relates

to its role as an antioxidant as a constituent part of glutathione peroxidases in the detoxification of peroxides, which leads to a reduction in the level of reactive oxygen species in cells and tissues In addition, in recent years,

Fig 5 Release of zinc from XPAzf by phenylselenyl chloride,

phenyl-seleninic acid, 2-nitrophenylselenocyanate, selenocystine, ebselen,

sele-nomethionine and methylselenocysteine The XPAzf peptide was

incubated with the respective selenium compound for 30 min at 37 C.

Zinc release was measured spectrophotometrically after the addition of

100 l M 4-(2-pyridylazo)-resorcinol (PAR) The mean values of at least

six determinations + SD are shown.

Fig 6 Release of zinc from XPAzf by various ratios of reduced

gluta-thione (GSH)/oxidized glutagluta-thione (GSSG), in the presence (s) or

absence (h) of 10lM phenylseleninic acid GSSG was applied from

10 l M to 3 m M , while GSH was maintained at 1 m M The peptide was

incubated with the respective compounds for 30 min at 37 C Zinc

release was measured spectrophotometrically by the addition of

100 l M 4-(2-pyridylazo)-resorcinol (PAR) About 40% zinc release

was observed with 10 l M phenylseleninic acid in the absence of GSH

and GSSG (data not shown) The mean values of at least nine

deter-minations + SD are shown.

Fig 7 Release of zinc from metallothionein (MT) by phenylselenyl chloride, phenylseleninic acid, 2-nitrophenylselenocyanate, selenocystine, ebselen, selenomethionine and methylselenocysteine MT was incubated with the respective selenium compound for 30 min at 37 C Zinc release was measured spectrophotometrically by the addition of

100 l M 4-(2-pyridylazo)-resorcinol (PAR) The mean values of at least six determinations + SD are shown.

Fig 8 Release of zinc from metallothionein (MT) or XPAzf by 2-nitrophenylselenocyanate and selenocystine The data are derived from the experiments shown in Figs 5 and 7, but plotted against the number of cysteines present in XPAzf and MT The mean values of at least six determinations + SD are shown.

greater emphasis has been given to specific cellular

reac-tions, based on selenium catalysis This concerns reversible

cysteine/disulfide transformations in redox-regulated

pro-teins, such as transcription factors [24], and MT, as a zinc

storage protein [11,14] Nevertheless, there is increasing

evidence that zinc finger structures are among the most

common protein motifs, present not just in transcription

factors, but in basically all families of proteins involved in

maintaining genomic stability, including DNA repair

pro-teins and cell cycle control propro-teins [18] This prompted us

to investigate the effect of selenium compounds in different

oxidation states on the integrity and function of two zinc

finger proteins (Fpg and XPA) with tetrahedral zinc ion

complexation to four cysteines involved in DNA repair,

as compared to zinc release from MT Our experiments

demonstrate, for the first time, that reducible selenium

compounds (i.e with an oxidation state of –I or higher)

including selenocystine, phenylselenyl chloride, ebselen,

2-nitrophenylselenocyanate and phenylseleninic acid, are

able to react with the thiolates of these zinc finger

DNA-repair proteins, resulting in enzyme inactivation and

release of zinc

The bacterial Fpg was used as the first model Fpg is a

glycosylase that initiates base excision repair in

Escheri-chia coli, which recognizes and removes several oxidative

DNA base modifications Fpg has the highest affinity for

8-oxoguanine, which, owing to its mutagenic potential, is

believed to be the biologically most relevant substrate

[37,38] DNA binding of Fpg is mediated by a single zinc

finger domain in the C-terminal region of the enzyme, where

zinc is complexed tetrahedrally by four cysteines (Cys244,

Cys247, Cys264 and Cys267) [45,46] Within the present

study we demonstrated that all reducible selenium

com-pounds inhibited Fpg activity completely, albeit at different

concentrations As fully reduced methylselenocysteine and

selenomethionine were not inhibitory, the observed enzyme

inactivation is probably caused by the oxidation of

zinc-complexing thiol groups in the enzyme and a simultaneous reduction of the selenium compound This interpretation is

in agreement with the mutational analysis of Fpg, which revealed that substitution of any of the cysteines in the zinc finger destroys DNA-binding capacity and enzyme func-tion, while substitution of the other two cysteines outside the zinc finger has little effect [25] The participation of selenium

is further demonstrated by the lack of inhibition by the sulfur-containing analogues cystine and phenylsulfinic acid Similarly, selenocystamine reacted with the zinc/sulfur clusters of MT at much lower concentrations than cysta-mine [12,47] Although sulfur shares similar chemical properties with selenium [48], one difference is the redox chemistry, which allows selenium to act at much lower physiological concentrations than sulfur

The effects of different selenium compounds on the mammalian XPA protein were investigated in the second model In vivo, XPA is absolutely required for incision during NER by co-ordinating the binding of ERCC1– XPF and presumably activating XPG [49] In vitro, it binds specifically to bulky DNA lesions, such as (6–4)-photoproducts induced by UVC [40] Even though its zinc finger motif is not directly involved in DNA binding,

it is required for the correct folding of the minimal DNA-binding domain [50]; substitution of any of its zinc-complexing cysteines (Cys105, Cys108, Cys126 and Cys129) leads to diminished DNA binding and a severe reduction in NER activity [26] In the present study, all reducible selenium compounds investigated in this set of experiments (selenocystine, phenylselenyl chloride, phenyl-seleninic acid) led to profound changes in the gel mobility shift experiments performed to investigate XPA–DNA interactions If DNA–protein interactions would have been disturbed, one would expect the appearance of free oligonucleotide with increasing concentrations of redu-cible selenium compounds Surprisingly, this was not the case; however, a third band appeared with almost no migration in the gel, indicative of high molecular mass DNA–protein complexes As selenium compounds exert higher reactivity towards free cysteines as compared to zinc-bound thiolates [16], intermolecular disulfide bridges may be formed between two or more XPA molecules which still retain their DNA-binding activity It cannot be excluded that selenium compounds also react with the zinc finger thiol groups, but, owing to the completely retarded migration of the complexes, this cannot be discriminated by gel mobility shift analysis

To elucidate interactions with the zinc finger domain of XPA more directly, the effects of selenium compounds on a synthetic 37 amino acid peptide, representing the zinc finger domain of the human XPA protein (XPAzf), were inves-tigated by determining zinc release Similarly to the results obtained with Fpg, all reducible selenium compounds caused zinc release in a concentration-dependent manner, starting at the low micromolar range, while fully reduced selenomethionine and methylselenocysteine were inactive For comparison, a 10 mM H2O2 solution was required to mediate complete zinc release

The experiments demonstrate that in principle any reducible selenium compound should be able to release zinc from zinc finger structures Nevertheless, there were clear differences with respect to the reactivities of different

Fig 9 Release of zinc from metallothionein (MT) or XPAzf (a synthetic

polypeptide corresponding to the xeroderma pigmentosum group A

protein zinc finger domain) by various concentrations of phenylselenyl

chloride, phenylseleninic acid and ebselen The data are derived from the

experiments shown in Figs 5 and 7, but plotted against the number of

cysteines present in XPAzf and MT The mean values of at least six

determinations + SD are shown.

selenium compounds In the experiments with Fpg,

inhi-bitory concentrations were not related to the respective

oxidation state Thus, for selenium compounds of the

oxidation state 0, the strongest inhibition was observed with

ebselen, where full inhibition was evident at 100 nM, while

2-nitrophenylselenocyanate and phenylselenyl chloride

exer-ted similar inhibition at 2.5 and 10 lM, respectively Full

inhibition was obtained with 100 lMselenocystine

(oxida-tion state –I) or 100 lMphenylseleninic acid (oxidation state

+II) In experiments with XPAzf, the strongest effect was

observed with 2-nitrophenylselenocyanate, while

compar-able reactivities were found for the other selenium

com-pounds in different oxidation states As the results were

somehow more uniform in the isolated zinc finger peptide,

XPAzf, one reason for the differences observed with Fpg

may be the higher order protein structures and differences in

accessibility in the intact protein, one major determinant for

the sensitivity of zinc finger thiolates towards oxidation [20]

Nevertheless, zinc release is not merely a stoichiometric

process, but also exerts a catalytic component owing to the

oxidation of selenolates, for example by trace amounts of

oxygen This catalytic component has been shown to occur

in 2-nitrophenylselenocyanate with respect to zinc release

from MT [14] and may differ depending on the actual

selenium compound

In cells there is an excess of free SH groups,

predomin-antly provided by GSH, raising the question of whether

under conditions of high concentrations of GSH and/or

GSSG, the cysteines in zinc finger structures remain as

targets for oxidation by selenium compounds As shown in

the present study, zinc release is even accelerated in the

presence of GSSG and at GSH/GSSG ratios between 0.3

and 3, and is only partly prevented even at a 100-fold excess

of GSH over both phenylseleninic acid and GSSG This

indicates that reducible selenium compounds are able to

attack zinc-sulfur bonds also under cellular conditions,

where GSH/GSSG ratios between 1 and 3 for the

endoplasmatic reticulum and between 40 and 100 for the

overall cell have been reported [43] Similarly, Maret and

co-workers observed zinc release from zinc-sulfur clusters in

MT, catalyzed by reducible selenium compounds, at a high

excess of GSH over MT [13] One possible explanation

relates to the formation of mixed selenodisulfides between

selenium compounds and GSH, which are still sufficiently

reactive towards zinc finger thiols Furthermore, in the

presence of GSSG, redox cycling could take place by

oxidation of reduced selenium species, which would explain

the enhanced zinc release in the presence of GSSG observed

in our experiments In this context, reducible selenium

coumpounds have been shown to efficiently couple the

GSH/GSSG redox pair with the MT/thionein system [15]

and a similar mechanism would be plausible in the case of

zinc finger proteins Under cellular conditions, redox

changes of selenium are part of the essential reactions, for

example within the catalytic cycle of glutathione peroxidases

[51,52] In an isolated test system, recent investigations

demonstrated that glutathione peroxidase mimics in the

presence of hydrogen peroxide are able to oxidize the zinc

finger peptide fragment of transcription factor, SP1 [22]

With respect to oxidized selenium species, Youn et al

reported a concentration-dependent decreased binding of

zinc finger transcription factors Sp1 and Sp3 to their

consensus recognition sequence when cells were treated with either 1,4-phenylenebis(methylene)selenocyanate (p-XSC)

or selenite, even though the authors did not investigate whether the zinc finger was affected directly [23]

As stated in the Introduction, one mechanism suggested

to contribute to the cancer-preventive properties of selenium compounds is the involvement in cellular zinc homeostasis

by mediating zinc release from MT, thus providing it for essential reactions However, significant protection would require preferential reaction with MT, compared with zinc finger proteins, to minimize toxic reactions Our experiments confirm zinc release by reducible selenium compounds described previously by Maret and co-workers [12–15], but revealed additionally that the zinc finger domain of XPA is

at least as susceptible towards thiol oxidation by reducible selenium compounds as MT During incubation with selenocystine and 2-nitrophenylselenocyanate, zinc was released at even lower concentrations from XPAzf compared with MT The reason for this is unclear at the moment; potential contributing factors are better assessibility of the peptide vs MT combined with more pronounced catalytic reaction components, as discussed above Whether or not zinc finger DNA repair proteins are affected under cellular conditions has yet to be elucidated In the cytosol of cells,

MT is present in excess over DNA repair proteins; however, owing to the coupling of zinc-binding structures (either in

MT or in zinc finger proteins) by selenium compounds with the cellular redox system GSH/GSSG, reducible selenium may be regenerated within catalytic cycles and thus is not necessarily inactivated by an excess of MT

Taken together, the results presented in this study demonstrate that low concentrations of selenium com-pounds in reducible oxidation states may inactivate DNA repair processes by the oxidation of zinc finger structures in DNA repair proteins As these observations are derived from subcellular systems, experiments on interactions with DNA repair systems in intact cells are urgently needed The hypothesis on DNA repair inhibition seems to contradict observations published recently, where selenomethionine even stimulated DNA repair after UV irradiation of human fibroblasts [53] Nevertheless, selenomethionine is fully reduced (oxidation state –II) and was found not to interfere with zinc finger proteins in the present study In principle, our results are in agreement with the growing experimental evidence that the role of selenium compounds in biological systems is not merely antioxidative (by detoxification of reactive oxygen species as part of glutathione peroxidases), but rather complex, owing to multiple interactions with cellular thiol groups Importantly, it was shown that not only free SH groups are targets of reducible selenium compounds, but also zinc-complexed thiol groups, which are commonly thought to be more resistant towards redox reactions [54, 55] While interactions with isolated DNA repair proteins are demonstrated for the first time, recent studies by other groups also showed inhibition of transcrip-tion factor–DNA binding by reducible selenium com-pounds [21, 23] In fact, these interactions with either transcription factors or MT have repeatedly been discussed

to contribute to the protective properties of selenium compounds with respect to tumor prevention or tumor therapy However, as shown in the present study, these reactions may also have detrimental consequences: because

zinc finger proteins are involved in basically all cellular

reactions required to maintain genomic stability, their

inactivation may lead to increased genetic instability Thus,

functioning DNA repair processes are urgently required to

protect the genome not only from DNA damage induced by

environmental agents such as UV radiation, food mutagens

and polycyclic aromatic hydrocarbons, but also from

endogenous DNA damage generated continuously, for

example by reactive oxygen species arising in the course of

oxygen consumption As redox reactions are important for

the regulation of zinc finger proteins and thus the cellular

pathways that are dependent on these proteins, an

imbal-ance in selenium compounds as powerful mediators of

cellular redox reactions, provoked by either selenium

deficiency or oversupply, may considerably decrease

genomic stability

Acknowledgements

The Fpg protein was a kind gift of Dr Serge Boiteux, Commisariat

Energie Atomique, Fontanay aux Roses, France and XPA was kindly

provided by Dr Andre´ Eker, Erasmus University of Rotterdam, the

Netherlands This work was supported by grants Ha 2372/1-3 and Ha

2372/3-2 from the Deutsche Forschungsgemeinschaft, and by a grant

from the Alexander von Humboldt Foundation (a maintenance grant

to W.B.).

References

1 Ko¨hrle, J., Brigelius-Flohe´, R., Bock, A., Gartner, R., Meyer, O.

& Flohe´, L (2000) Selenium in biology: facts and medical

per-spectives Biol Chem 381, 849–864.

2 Ganther, H.E (1999) Selenium metabolism, selenoproteins and

mechanisms of cancer prevention: complexities with thioredoxin

reductase Carcinogenesis 20, 1657–1666.

3 El-Bayoumy, K (2001) The protective role of selenium on genetic

damage and on cancer Mutat Res 475, 123–139.

4 Vinceti, M., Rovesti, S., Bergomi, M & Vivoli, G (2000) The

epidemiology of selenium and human cancer Tumori 86, 105–118.

5 Thomson, C.D (2004) Assessment of requirements for selenium

and adequacy of selenium status: a review Eur J Clin Nutr 58,

391–402.

6 Clark, L.C., Combs, G.F Jr, Turnbull, B.W., Slate, E.H.,

Chal-ker, D.K., Chow, J., Davis, L.S., Glover, R.A., Graham, G.F.,

Gross, E.G., Krongrad, A., Lesher, J.L Jr, Park, H.K., Sanders,

B.B Jr, Smith, C.L & Taylor, J.R (1996) Effects of selenium

supplementation for cancer prevention in patients with carcinoma

of the skin A randomized controlled trial Nutritional Prevention

of Cancer Study Group JAMA 276, 1957–1963.

7 Duffield-Lillico, A.J., Slate, E.H., Reid, M.E., Turnbull, B.W.,

Wilkins, P.A., Combs, G.F Jr, Park, H.K., Gross, E.G., Graham,

G.F., Stratton, M.S., Marshall, J.R & Clark, L.C (2003)

Sele-nium supplementation and secondary prevention of

non-melanoma skin cancer in a randomized trial J Natl Cancer Inst.

95, 1477–1481.

8 Flohe´, L., Gunzler, W.A & Schock, H.H (1973) Glutathione

peroxidase: a selenoenzyme FEBS Lett 32, 132–134.

9 Brigelius-Flohe´, R., Maiorino, M., Ursini, F & Flohe, L (2001)

Selenium: An antioxidant? In Handbook of Antioxidants, 2nd edn.

(Cadenas, E & Packer, L., eds), pp 633–664 Marcel Dekker, Inc.,

New York, Basel.

10 Turan, B., Fliss, H & Desilets, M (1997) Oxidants increase the

intracellular free Zn 2+ concentration in rabbit ventricular

myo-cytes Am J Physiol 272, 2095–2106.

11 Jacob, C., Giles, G.I., Giles, N.M & Sies, H (2003) Sulfur and selenium: the role of oxidation state in protein structure and function Angew Chem Int Ed Engl 42, 4742–4758.

12 Jacob, C., Maret, W & Vallee, B.L (1998) Control of zinc transfer between thionein, metallothionein, and zinc proteins Proc Natl Acad Sci USA 95, 3489–3494.

13 Jacob, C., Maret, W & Vallee, B.L (1999) Selenium redox bio-chemistry of zinc-sulfur coordination sites in proteins and enzymes Proc Natl Acad Sci USA 96, 1910–1914.

14 Chen, Y & Maret, W (2001) Catalytic oxidation of zinc/sulfur coordination sites in proteins by selenium compounds Antioxid Redox Signal 3, 651–656.

15 Chen, Y & Maret, W (2001) Catalytic selenols couple the redox cycles of metallothionein and glutathione Eur J Biochem 268, 3346–3353.

16 Jacob, C., Maret, W & Vallee, B.L (1998) Ebselen, a selenium-containing redox drug, releases zinc from metallothionein Bio-chem Biophys Res Commun 248, 569–573.

17 Mackay, J.P & Crossley, M (1998) Zinc fingers are sticking together Trends Biochem Sci 23, 1–4.

18 Laity, J.H., Lee, B.M & Wright, P.E (2001) Zinc finger proteins: new insights into structural and functional diversity Curr Opin Struct Biol 11, 39–46.

19 Maret, W (2003) Cellular zinc and redox states converge in the metallothionein/thionein pair J Nutr 133, 1460S–1462S.

20 Wilcox, D.E., Schenk, A.D., Feldman, B.M & Xu, Y (2001) Oxidation of zinc-binding cysteine residues in transcription factor proteins Antioxid Redox Signal 3, 549–564.

21 Larabee, J.L., Hocker, J.R., Hanas, R.J., Kahn, F.M & Hanas, J.S (2002) Inhibition of zinc finger protein–DNA interactions by sodium selenite Biochem Pharmacol 64, 1757–1765.

22 Giles, N.M., Gutowski, N.J., Giles, G.I & Jacob, C (2003) Redox catalysts as sensitisers towards oxidative stress FEBS Lett 535, 179–182.

23 Youn, B.W., Fiala, E.S & Sohn, O.S (2001) Mechanisms of organoselenium compounds in chemoprevention: effects on tran-scription factor-DNA binding Nutr Cancer 40, 28–33.

24 Kim, Y.S & Milner, J (2001) Molecular targets for selenium in cancer prevention Nutr Cancer 40, 50–54.

25 O’Connor, T.R., Graves, R.J., de Murcia, G., Castaing, B & Laval, J (1993) Fpg protein of Escherichia coli is a zinc finger protein whose cysteine residues have a structural and/or functional role J Biol Chem 268, 9063–9070.

26 Miyamoto, I., Miura, N., Niwa, H., Miyazaki, J & Tanaka, K (1992) Mutational analysis of the structure and function of the xeroderma pigmentosum group A complementing protein Iden-tification of essential domains for nuclear localization and DNA excision repair J Biol Chem 267, 12182–12187.

27 Cai, X.-J., Block, E., Uden, P.C., Zhang, X., Quimby, B.D & Sullivan, J.J (1995) Allium chemistry: identification of seleno-amino acids in ordinary and selenium-enriched garlic, onion, and broccoli using gas chromatography with atomic emission detec-tion J Agric Food Chem 43, 1754–1757.

28 Bird, S., Uden, P.C., Tyson, J.F., Block, E & Denoyer, E (1997) Speciation of selenoamino acids and organoselenium compounds

in selenium-enriched yeast using high-performance liquid chro-matography-inductively coupled plasma mass spectrometry.

J Anal Atomic Spectrom 12, 785–788.

29 Asmuss, M., Mullenders, L.H., Eker, A & Hartwig, A (2000) Differential effects of toxic metal compounds on the activities of Fpg and XPA, two zinc finger proteins involved in DNA repair Carcinogenesis 21, 2097–2104.

30 Mu¨ller, E., Boiteux, S., Cunningham, R.P & Epe, B (1990) Enzymatic recognition of DNA modifications induced by singlet oxygen and photosensitizers Nucleic Acids Res 18, 5969–5973.

31 Bal, W., Schwerdtle, T & Hartwig, A (2003) Mechanism of nickel

assault on the zinc finger of DNA repair protein XPA Chem Res.

Toxicol 16, 242–248.

32 Grassetti, D.R & Murray, J.F Jr (1967) Determination of

sulf-hydryl groups with 2,2¢- or 4,4¢-dithiodipyridine Arch Biochem.

Biophys 119, 41–49.

33 Vasak, M (1991) Criteria of purity for metallothioneins Methods

Enzymol 205, 44–47.

34 Schaeffer, A (1991) Absorption, circular dichroism, and magnetic

circular dichroism spectroscopy of metallothionein Methods

Enzymol 205, 529–540.

35 Hunt, J.B., Neece, S.H., Schachman, H.K & Ginsburg, A (1984)

Mercurial-promoted Zn2+release from Escherichia coli aspartate

transcarbamoylase J Biol Chem 259, 14793–14803.

36 McCall, K.A & Fierke, C.A (2000) Colorimetric and fluorimetric

assays to quantitate micromolar concentrations of transition

metals Anal Biochem 284, 307–315.

37 Tchou, J., Kasai, H., Shibutani, S., Chung, M.H., Laval, J.,

Grollman, A.P & Nishimura, S (1991) 8-oxoguanine

(8-hydro-xyguanine) DNA glycosylase and its substrate specificity Proc.

Natl Acad Sci USA 88, 4690–4694.

38 Boiteux, S., Gajewski, E., Laval, J & Dizdaroglu, M (1992)

Substrate specificity of the Escherichia coli Fpg protein

(for-mamidopyrimidine-DNA glycosylase): excision of purine lesions

in DNA produced by ionizing radiation or photosensitization.

Biochemistry 31, 106–110.

39 Floyd, R.A., West, M.S., Eneff, K.L & Schneider, J.E (1990)

Mediation of 8-hydroxy-guanine formation in DNA by thiazin

dyes plus light Free Radic Biol Med 8, 327–330.

40 Robins, P., Jones, C.J., Biggerstaff, M., Lindahl, T & Wood, R.D.

(1991) Complementation of DNA repair in xeroderma

pigmen-tosum group A cell extracts by a protein with affinity for damaged

DNA EMBO J 10, 3913–3921.

41 Jones, C.J & Wood, R.D (1993) Preferential binding of the

xeroderma pigmentosum group A complementing protein to

damaged DNA Biochemistry 32, 12096–12104.

42 Asahina, H., Kuraoka, I., Shirakawa, M., Morita, E.H., Miura, N.,

Miyamoto, I., Ohtsuka, E., Okada, Y & Tanaka, K (1994) The

XPA protein is a zinc metalloprotein with an ability to recognize

various kinds of DNA damage Mutat Res 315, 229–237.

43 Hwang, C., Sinskey, A.J & Lodish, H.F (1992) Oxidized redox

state of glutathione in the endoplasmic reticulum Science 257,

1496–1502.

44 Beck, M.A (2001) Antioxidants and viral infections: host immune

response and viral pathogenicity J Am Coll Nutr 20, 384S–

388S.

45 Buchko, G.W., Hess, N.J., Bandaru, V., Wallace, S.S & Kennedy,

M.A (2000) Spectroscopic studies of zinc (II)- and cobalt

(II)-associated Escherichia coli formamidopyrimidine-DNA gly-cosylase: extended X-ray absorption fine structure evidence for a metal-binding domain Biochemistry 39, 12441–12449.

46 Zharkov, D.O., Shoham, G & Grollman, A.P (2003) Structural characterization of the Fpg family of DNA glycosylases DNA Repair (Amst) 2, 839–862.

47 Maret, W (1995) Metallothionein/disulfide interactions, oxidative stress, and the mobilization of cellular zinc Neurochem Int 27, 111–117.

48 Barceloux, D.G (1999) Selenium J Toxicol Clin Toxicol 37, 145–172.

49 Volker, M., Mone, M.J., Karmakar, P., van Hoffen, A., Schul, W., Vermeulen, W., Hoeijmakers, J.H., van Driel, R., van Zeeland, A.A & Mullenders, L.H (2001) Sequential assembly

of the nucleotide excision repair factors in vivo Mol Cell 8, 213– 224.

50 Buchko, G.W., Ni, S., Thrall, B.D & Kennedy, M.A (1998) Structural features of the minimal DNA binding domain (M98– F219) of human nucleotide excision repair protein XPA Nucleic Acids Res 26, 2779–2788.

51 Wendel, A., Pilz, W., Ladenstein, R., Sawatzki, G & Weser, U (1975) Substrate-induced redox change of selenium in glutathione peroxidase studied by x-ray photoelectron spectroscopy Biochim Biophys Acta 377, 211–215.

52 Aumann, K.D., Bedorf, N., Brigelius-Flohe´, R., Schomburg, D & Flohe´, L (1997) Glutathione peroxidase revisited – simulation of the catalytic cycle by computer-assisted molecular modelling Biomed Environ Sci 10, 136–155.

53 Seo, Y.R., Kelley, M.R & Smith, M.L (2002) Selenomethionine regulation of p53 by a ref1-dependent redox mechanism Proc Natl Acad Sci USA 99, 14548–14553.

54 Bettger, W.J (1993) Zinc and selenium, site-specific versus general antioxidation Can J Physiol Pharmacol 71, 721–724.

55 Knoepfel, L., Steinkuhler, C., Carri, M.T & Rotilio, G (1994) Role of zinc-coordination and of the glutathione redox couple

in the redox susceptibility of human transcription factor Sp1 Biochem Biophys Res Commun 201, 871–877.

56 Robbins, A.H., McRee, D.E., Williamson, M., Collett, S.A., Xuong, N.H., Furey, W.F., Wang, B.C & Stout, C.D (1991) Refined crystal structure of Cd, Zn metallothionein at 2.0 A resolution J Mol Biol 221, 1269–1293.

57 Romero-Isart, N & Vasak, M (2002) Advances in the struc-ture and chemistry of metallothioneins J Inorg Biochem 88, 388– 396.

58 Ikegami, T., Kuraoka, I., Saijo, M., Kodo, N., Kyogoku, Y., Morikawa, K., Tanaka, K & Shirakawa, M (1998) Solution structure of the DNA- and RPA-binding domain of the human repair factor XPA Nat Struct Biol 5, 701–706.