Báo cáo khoa học: Stage-specific expression of Caenorhabditis elegans ribonuclease H1 enzymes with different substrate specificities and bivalent cation requirements ppt

In con-trast, Escherichia coli RNase HI requires both Mg2+ and Mn2+ ions for its activity [11] and contains one Mg2+-binding site or two Mn2+-binding sites [12,13].. coli RNase HII is ac

ribonuclease H1 enzymes with different substrate

specificities and bivalent cation requirements

Hiromi Kochiwa1,2, Mitsuhiro Itaya1,3, Masaru Tomita1,4and Akio Kanai1

1 Institute for Advanced Biosciences, Keio University, Tsuruoka, Japan

2 Graduate School of Media and Governance, Keio University, Fujisawa, Japan

3 Mitsubishi Kagaku Institute of Life Sciences, Machida, Japan

4 Department of Environmental Information, Keio University, Fujisawa, Japan

An enzyme that specifically degrades the RNA strand

of RNA–DNA hybrids was first characterized from

extracts of calf thymus tissue [1] and was named

ribo-nuclease H (RNase H; EC 3.1.26.4) [2] This protein

has also been identified in viruses [3], bacteria [4,5],

and archaea [6,7], indicating the essential nature of its

roles in cellular metabolism Prokaryotic RNase H

enzymes are divided by sequence similarity into three

groups: HI, HII, and HIII On the other hand, there

are two types of eukaryotic RNase H: RNase H1 is

homologous to prokaryotic RNase HI, and RNase H2

is homologous to prokaryotic RNase HII There is a

distinct difference between the two types of eukaryotic

RNase H in terms of the bivalent metal ion cofactor

Eukaryotic RNase H1 requires Mg2+ ions as a

cofac-tor, cannot use Mn2+ ions as a cofactor [8], and is

inhibited by the addition of Mn2+ ions [9,10] In con-trast, Escherichia coli RNase HI requires both Mg2+ and Mn2+ ions for its activity [11] and contains one

Mg2+-binding site or two Mn2+-binding sites [12,13] Eukaryotic RNase H2 is activated by either Mn2+ or

Mg2+ions, but E coli RNase HII is activated only in the presence of Mn2+ ions [14] Phylogenetic analysis suggests that Mn2+-dependent RNase H is universally present from bacteria to eukaryotes [15]

The primary structures of prokaryotic RNase HI and eukaryotic RNase H1 also differ from each other Most eukaryotic RNase H1 enzymes consist of a non-RNase H domain at the N-terminus and an non-RNase H domain at the C-terminus, in contrast with prokaryotic RNase HI, which contains only the RNase H domain This eukaryotic non-RNase H domain was first

Keywords

alternative splicing; C elegans;

development; metal ion; RNase H1

Correspondence

A Kanai, Institute for Advanced

Biosciences, Keio University, Tsuruoka

997-0017, Japan

Fax: +81 235 29 0525

Tel: +81 235 29 0524

E-mail: akio@sfc.keio.ac.jp

(Received 14 October 2005, revised 26

November 2005, accepted 1 December

2005)

doi:10.1111/j.1742-4658.2005.05082.x

Ribonuclease H1 (RNase H1) is a widespread enzyme found in a range of organisms from viruses to humans It is capable of degrading the RNA moiety of DNA–RNA hybrids and requires a bivalent ion for activity In contrast with most eukaryotes, which have one gene encoding RNase H1, the activity of which depends on Mg2+ions, Caenorhabditis elegans has four RNase H1-related genes, and one of them has an isoform produced by alter-native splicing However, little is known about the enzymatic features of the proteins encoded by these genes To determine the differences between these enzymes, we compared the expression patterns of each RNase H1-related gene throughout the development of the nematode and the RNase H activit-ies of their recombinant proteins We found gene-specific expression patterns and different enzymatic features In particular, besides the enzyme that displays the highest activity in the presence of Mg2+ ions, C elegans has another enzyme that shows preference for Mn2+ion as a cofactor We char-acterized this Mn2+-dependent RNase H1 for the first time in eukaryotes These results suggest that there are at least two types of RNase H1 in C ele-gansdepending on the developmental stage of the organism

Abbreviations

dsRHbd, double-stranded RNA and RNA–DNA hybrid-binding domain; Ec-RNHI, Escherichia coli ribonuclease HI; Pf-RNHII, Pyrococcus furiosus ribonuclease HII; PTC, premature termination codon, RNase H, ribonuclease H.

identified in the N-terminal portion of Crithidia

fas-ciculataRNase H1 in relation to the conserved domain

in caulimovirus ORF VI involved in translational

regu-lation [16] The non-RNase H domain binds not only

to dsRNA but also to RNA–DNA hybrids in vitro [17]

and has been defined as a dsRNA and RNA–DNA

hybrid-binding domain (dsRHbd) [18] The function

of the dsRHbd in eukaryotic RNase H1 has also been

discussed The dsRNA binding and RNase H activity

of Saccharomyces cerevisiae RNase H1 depends on the

concentration of Mg2+ ions and the existence of

dsRNA, and the activity of mutant enzymes lacking

dsRHbd is not as dependent on these conditions [17]

In contrast, investigation of human RNase H1 by

site-directed mutagenesis has suggested that the dsRHbd is

required not for RNase H activity but to place

RN-ase H in the appropriate position on the RNA primer

during DNA replication [19] However, because the

dsRHbd in mouse RNase H1 contributes to RNase H

processivity through formation of a dimer complex

[18], there is controversy about whether the dsRHbd is

in fact necessary for RNase H activity

A single RNase H1-related gene has been identified in

the genomes of most eukaryotes studied, and RNase H1

enzymes of Drosophila and mice are essential for

embry-ogenesis [20,21] Unlike in other eukaryotes, four

RNase H1-encoding genes have been found in the

Caenorhabditis elegansgenome, and cDNA sequencing

analysis has revealed that one of them has an alternative

splicing variant, resulting in a total of five transcripts

[22] Of these, one gene encodes an RNase H1 protein

that contains both dsRHbd and RNase H domains, and

its alternatively spliced transcript can be translated into

an RNase H1 protein that lacks a dsRHbd at the

N-ter-minus We analyzed the expression patterns of the five

transcripts, including the pair of alternative splicing

variants, throughout the development of C elegans

Furthermore, we successfully prepared and purified

some recombinant C elegans RNase H1 enzymes in

sol-uble form without using denaturants such as 6 m urea

or guanidine hydrochloride This enabled us to compare

the enzymatic features of each RNase H by using an

in vitro reconstitution system that recapitulated the

processing of Okazaki-primer RNA

Results and Discussion

Primary structures of multiple RNase H1 enzymes

in C elegans

Four RNase H1-related genes have been identified in

C elegans, and one of them has been found to have

an alternative splicing isoform [22] We conducted

cDNA cloning of the transcripts that corresponded to each gene and confirmed their primary structures inde-pendently In accordance with their nomenclature [22],

we represented these four genes as rnh-1.0a, rnh-1.1, rnh-1.2, and rnh-1.3 and the alternative splicing iso-form of rnh-1.0a as rnh-1.0b In contrast with rnh-1.0a, which encodes a 251-amino-acid protein (Ce-RNH1a), rnh-1.0b contains a premature termination codon (PTC) in the alternatively spliced exon Although cis-acting nonsense-mediated mRNA decay elements in

C elegans have yet to be characterized [23], in several experiments the alternatively spliced transcript that introduces a PTC is degraded by an mRNA surveil-lance system in C elegans [24,25] On the other hand, despite the fact that the mRNA for mouse glutamic acid decarboxylase has a PTC inserted by alternative splicing, the N-terminal truncated protein has been shown to be produced from the downstream ORF

in vivo and has been shown to exhibit enzyme activity [26], suggesting that the mRNA escapes degradation

by nonsense-mediated mRNA decay Therefore, if rnh-1.0b also evades the mRNA surveillance system, this mRNA may produce a 41-amino-acid protein encoded

by the upstream ORF and a 198-amino-acid protein (Ce-RNH1b) encoded by the downstream ORF

We defined the C elegans RNase H1 enzymes enco-ded by rnh-1.0a, rnh-1.0b, rnh-1.1, rnh-1.2, and rnh-1.3

as Ce-RNH1a, Ce-RNH1b, Ce-RNH1A, Ce-RNH1B, and Ce-RNH1C, respectively The domain structures

of these proteins are summarized in Fig 1 Most eukaryotic RNase H1 enzymes contain one or two dsRHbds at the N-terminus and an RNase H domain

at the C-terminus However, only Ce-RNH1a fits the typical structure, and the other RNase H1 enzymes (Ce-RNH1b, Ce-RNH1A, Ce-RNH1B, and Ce-RNH1C) each contained only one RNase H domain

Ce-RNH1α

(rnh-1.0α)

Ce-RNH1β

(rnh-1.0β)

Ce-RNH1B

(rnh-1.2)

Ce-RNH1A

(rnh-1.1)

Ce-RNH1C rnh-1.3

RNH RNH

RNH

RNH

RNH

dsRHbd 1

1

1

1

251

198

487

192

Fig 1 Schematic diagrams of RNase H1-related gene family in

C elegans Each domain is indicated as a shaded box dsRHbd, dsRNA or RNA–DNA hybrid-binding domain; RNH, RNase H domain Each gene name is in parentheses below the protein name Numbers above boxes indicate positions of amino acids.

RNase H gene expression during C elegans

development

Although eukaryotic RNase H1 enzymes are thought to

be concerned with several regulatory steps, including

DNA replication, DNA repair, and RNA transcription,

C elegans, unlike other model organisms, may use the

appropriate RNase H1 for a specific situation To

evalu-ate this hypothesis, we first conducted RT-PCR analysis

during C elegans development [larval stages 1–2 (L1–

L2), 2–3 (L2–L3), 3–4 (L3–L4), and 4 to adult (L4–

adult)] to compare the expression patterns of each

RNase H1 RNase H1-related gene expression can be

described as one of three patterns (Fig 2): (a) expressed

constantly throughout development (1.0a and

rnh-1.0b); (b) expressed from the L3 to adult stages (rnh-1.1

and rnh-1.3); (c) preferentially expressed in the egg and

adult stages (rnh-1.2) These results suggest that multiple

RNase H1-encoding genes may be regulated differently

throughout C elegans development

In particular, because both RNH1a and

Ce-RNH1A have RNase H activity (see below in detail), it

should be noted that the expression pattern of rnh-1.0a

differed considerably from that of rnh-1.1 This result

raises the possibility that these two proteins have

dis-tinctly different functions because of their production at

different developmental stages These gene-specific

expression patterns also suggest that rnh-1.2 and rnh-1.3

are not pseudogenes, despite the fact that Ce-RNH1B

and Ce-RNH1C were not detected to have RNase H

activity [22], even though it has been reported that 20%

of all annotated C elegans genes may be pseudogenes

[27]

The question of why rnh-1.0a and rnh-1.0b had the same expression pattern required further investigation The third exon of rnh-1.0a and rnh-1.0b is alternatively spliced (Fig 3A) In C elegans, the highly conserved consensus sequence UUUUCAG⁄ R at the 3¢ splice sites is recognized by subunits of U2AF in the process

of intron removal [28] We checked the sequences around the alternatively spliced sites of rnh-1.0a and rnh-1.0b and found that the sequences were similar

to each other (AUUUAG⁄ G and UUUUAG ⁄ A) (Fig 3B) Hence, rnh-1.0a and rnh-1.0b have the same expression pattern because these alternatively spliced sites may be chosen evenly when the splicing reaction occurs, suggesting that a specific alternative splicing factor or an exonic enhancer may not regulate this alternative splicing for each transcript At this point it

is not certain whether rnh-1.0b is the result of regula-ted alternative splicing or of aberrant splicing, because the mRNA contains a PTC in the alternatively spliced exon

Cleavage specificity of C elegans RNase H1 enzymes on RNA–DNA⁄ DNA hybrid

In light of the results of the gene expression analysis,

we assumed that the multiple RNase H1 enzymes in

C elegans had distinct enzymatic characteristics Although Arudchandran et al [22] detected RNase H activity by a renaturation gel assay, we wanted to make more detailed comparisons by using purified soluble enzymes Therefore, we overexpressed the recombinant RNase H1 enzymes and purified them to

rnh-1.0α

rnh-1.0β

rnh-1.3

rnh-1.1

rnh-1.2

eft-3

Egg L1-L2 L2-L3 L3-L4 L4-Adult RNA(-)

Fig 2 Expression patterns of RNase H1-related genes during the

developmental stages of C elegans RT-PCR was carried out using

gene-specific primers (see Experimental procedures) Negative

con-trol without addition of cDNA template is indicated as RNA (–) eft-3

encoding a translation elongation factor 1-alpha homolog was the

positive control The same results were obtained in at least two

inde-pendent experiments for each gene.

rnh-1.0α

rnh-1.0β

α

β

A

UGAAAAUUUAGGAGUCAAACGUUGUUUUAGAUUCAAGAAA

α β

B

Fig 3 Alternative splicing of rnh-1.0a and rnh-1.0b (A) Schematic presentation of alternative splicing Exons are represented as boxes, and the characters a and b above the third exons indicate alternatively spliced sites of rnh-1.0a and rnh-1.0b (B) Premature mRNA sequences around alternatively spliced sites The underlined sequences labeled with a or b correspond to the sequences around the 3¢ exon–intron junction of rnh-1.0a or rnh-1.0a AGs enclosed in squares represent splice acceptor sites Arrows indicate 3¢ exon– intron junctions.

near-homogeneity The molecular masses of the

puri-fied recombinant proteins Ce-RNH1a, Ce-RNH1b,

Ce-RNH1A, Ce-RNH1B, and Ce-RNH1C were

esti-mated to be 33, 28, 62, 25, and 17 kDa, respectively,

by SDS⁄ PAGE (Fig 4)

The enzymatic activity of each recombinant C

ele-gans RNase H1 was analyzed by using two different

30-mer RNA–DNA⁄ DNA hybrids as substrates so that

the cleavage site of the RNA strand could be

determined RNase HI from the bacterium E coli

(Ec-RNHI) and RNase HII from the archaeon

Pyro-coccus furiosus(Pf-RNHII) also were used to compare

cleavage specificity with those of C elegans RNase H1

enzymes When the RNase H assay was performed

using 6-carboxyfluorescein (FAM) labeling at the 5¢ end

of the RNA–DNA strand, the degradation patterns of

Ce-RNH1a and Ce-RNH1b were completely the same,

but the other proteins exhibited different patterns

(Fig 5A) On the other hand, when the RNase H assay

was performed using fluorescein isothiocyanate labeling

at the 3¢ end of the RNA–DNA strand, in contrast with

Ec-RNHI, which cleaved the 5¢ phosphodiester bond of

the third ribonucleotide from the RNA–DNA junction,

C elegans RNase H1 enzymes and Pf-RNHII cleaved

the 5¢ phosphodiester bond of the last ribonucleotide at

the RNA–DNA junction (Fig 5B) The cleavage

pat-terns of Ce-RNH1a and Ce-RNH1b were closer to that

of Pf-RNHII than to that of Ec-RNHI, whereas

250

150

100

75

50

37

25

15

20

Fig 4 Purified recombinant RNase H1 enzymes of C elegans.

Samples were analyzed by SDS ⁄ PAGE on a 10–20% gel and

stained with Coomassie Brilliant Blue Lane 1, molecular mass

markers; lane 2, Ce-RNH1a; lane 3, Ce-RNH1b; lane 4, Ce-RNH1A;

lane 5, Ce-RNH1B; lane 6, Ce-RNH1C Dots indicate positions of

each recombinant protein.

Ce-RNH1 α Ce-RNH1β Ce-RNH1A Pf-RNHII Ec-RNHI

30 mer

A G C

U

G G A U A G C G U 3'

5'

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

A

5'-GCGAAUUUAGGGCGAgagcaaacttctcta-3'

5'-GCGAAUUUAGGGCGAgagcaaacttctcta-3'

5'-GCGAAUUUAGGGCGAgagcaaacttctcta-3'

5'-GCGAAUUUAGGGCGAgagcaaacttctcta-3'

Ce-RNH1 α, Ce-RNH1β

Ce-RNH1A

Ec-RNHI Pf-RNHII

C

B

3' 5'

Ce-RNH1 α Ce-RNH1β Ce-RNH1A Pf-RNHII Ec-RNHI

30 mer

A G C G

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

Fig 5 Cleavage specificity of RNase H enzymes on (A) 5¢ FAM-labeled or (B) 3¢ fluorescein isothiocyanate-FAM-labeled RNA–DNA ⁄ DNA hybrid RNase H digestion products were analyzed using denaturing polyacrylamide gel (see Experimental procedures) Lane 1, no enzyme control; lanes 2–4, 0.05, 0.25, 1 n M Ce-RNH1a; lanes 5–7,

20, 100, 400 n M Ce-RNH1b; lanes 8–10, 10, 50, 200 n M Ce-RNH1A; lanes 11–13, 0.02, 0.1, 0.4 n M Pf-RNHII; lanes 14–16, 0.02, 0.1, 0.4

U Ec-RNHI Metal ion concentrations are: lanes 1–7 and 14–16,

1 m M MgCl 2 ; and lanes 8–13, 1 m M MnCl 2 Positions of nucleo-tides are indicated on the right (C) Summary of cleavage sites Ribonucleotides are represented as uppercase letters and deoxy-ribonucleotides as lower case letters Arrows indicate cleavage sites.

Ce-RNH1A exhibited a unique digestion pattern

(Fig 5C) Above all, the finding that Ce-RNH1a and

Ce-RNH1b showed the same cleavage patterns is in

contrast with the fact that the dsRHbd deletion mutant

of human RNase H1 exhibits a degradation pattern

different from that of the wild-type [19], because

Ce-RNH1b also lacks a dsRHbd at the N-terminus We

also checked the activity of a dsRHbd deletion mutant

of Ce-RNH1a: the mutant proteins showed exactly the

same cleavage pattern as Ce-RNH1a and Ce-RNH1b

(data not shown) This result also supports the idea

that the dsRHbd of Ce-RNH1a does not affect the

specificity of the cleavage site

To compare the enzymatic activities of Ce-RNH1a

and Ce-RNH1b, we determined the kinetic parameters

of both enzymes and calculated the relative Km and

kcat values as in a previous study [29] The results are

summarized in Table 1 The Km value of Ce-RNH1a

was comparable to that of Ce-RNH1b, whereas the

kcatvalue of the former enzyme was
91 times higher

than that of the latter Consequently, we can presume

that the N-terminus portion of Ce-RNH1a helps to

enhance the hydrolysis rate but affects neither the

clea-vage site nor the binding affinity for the substrate

The activities of Ce-RNH1B and Ce-RNH1C were

also examined by the same RNase H assay, but no

activity was detected (data not shown), in agreement

with the results of a previous report describing the

inactivity of Ce-RNH1B and Ce-RNH1C [22] The

fact that yeast two-hybrid analysis revealed that

Ce-RNH1C formed a complex with several other

pro-teins [30] suggests that other factors may be necessary

for the activation of Ce-RNH1C The inactivity of

Ce-RNH1B may be due to protein misfolding, because

we used urea as a denaturant to prepare and purify

the recombinant protein

Metal ion preferences of C elegans RNase H1

enzymes

We also compared the RNase H1 enzymes in C

ele-gans in terms of their preferences for bivalent ions

For this purpose, we performed RNase H assays in the

presence of Mg2+or Mn2+ions at concentrations ran-ging from 0.01 to 20 mm Increased RNase H activity

of Ce-RNH1a was associated with an increase in the concentration of Mg2+ ions but not of Mn2+ ions (Fig 6A) On the other hand, although Ce-RNH1b has an optimum concentration of Mg2+ ions similar

to that of the mutant human RNase H1 with deleted dsRHbd at the N-terminus [18], this enzyme was also

Table 1 Kinetic parameters of Ce-RNH1a and Ce-RNH1b The

kin-etic parameters were determined from two independent

experi-ments Relative Kmand kcatvalues were calculated by dividing the

values for Ce-RNH1b by those for Ce-RNH1a.

Enzyme

Relative

Kmvalue

Relative

kcatvalue

30 mer

0.01 0.1 0.5 1 5 10

C

Ce-RNH1A

30 mer

B

0.01 0.1 0.5 1 5 10

Ce-RNH1β

30 mer

A

0.01 0.1 0.5 1 5 10

Ce-RNH1α

Fig 6 Metal ion preferences of C elegans RNase H1 enzymes Reactions were carried out in the presence of 0.01–20 m M MgCl2

or MnCl 2 using 5¢ FAM-labeled RNA–DNA ⁄ DNA hybrid No enzyme control is indicated as (–) Concentrations of each recombinant pro-tein were (A) 0.5 n M Ce-RNH1a, (B) 100 n M Ce-RNH1b, and (C)

150 n M Ce-RNH1A.

activated in the presence of Mn2+ ions (Fig 6B) To

investigate the dependence of enzymatic activity on

metal ions more precisely, we also determined the

spe-cific activities of Ce-RNH1a and Ce-RNH1b in the

presence of Mg2+or Mn2+ions, as shown in Table 2

Although the specific activity of Ce-RNH1a in the

presence of Mg2+ was higher than in the presence of

Mn2+, Ce-RNH1a could use Mn2+ as a cofactor for

cleavage of Okazaki fragment substrates This result is

inconsistent with those of previous reports in the calf

thymus [8] and humans [10]; however, Bacillus

halodu-rans RNase HI, which, like eukaryotic RNase H1,

contains a dsRHbd at the N-terminus, is also activated

in the presence of Mn2+(Wei Yang, personal

commu-nication) Therefore, this feature of Ce-RNH1a is

thought to be more similar to that of bacterial

RNase HI than to that of mammals On the other

hand, the specific activity of Ce-RNH1b is only about

one-hundredth that of Ce-RNH1a in the presence

of Mg2+ and about one-fortieth in the presence of

Mn2+ The difference in specific activities between

Ce-RNH1a and Ce-RNH1b suggests that the existence

of the dsRHbd may be related to RNase H activity

and supports the idea that eukaryotic RNase H1

enzymes act processively by interactions through the

dsRHbd, leading to dimerization of the protein [18]

However, Ce-RNH1b function in vivo is still unclear,

because this protein has low RNase H activity It is

likely that the rnh-1.0b encoding Ce-RNH1b may not

produce a functional protein; instead, aberrant splicing

or alternative splicing may contribute to the regulation

of gene expression in combination with the

nonsense-mediated mRNA decay system [31]

In contrast with the activities of Ce-RNH1a and

Ce-RNH1b, that of Ce-RNH1A was enhanced in the

presence of Mn2+ ions rather than Mg2+ ions

(Fig 6C) We also found that the pattern of digestion

by Ce-RNH1A differed with the metal ion A previous

report defined eukaryotic RNase H1 as an enzyme that

requires Mg2+ ions for activity but cannot use Mn2+ ions as cofactors [8] However, our study revealed that this description does not apply to Ce-RNH1A, which can be classified as a eukaryotic RNase H1 on the basis of amino-acid sequence similarity Phylogram analysis shows that Ce-RNH1a is orthologous to human RNase H1 and that Ce-RNH1A is out-grouped with S cerevisiae and S pombe RNase H1 enzymes [22], but that S cerevisiae RNase H1 prefers Mg2+ ions as a cofactor, as do other eukaryotic RNase H enzymes [32] To our knowledge, Ce-RNH1A is the only eukaryotic RNase H1 that prefers Mn2+ ions for activity These results suggest that at least two types

of RNase H1, Ce-RNH1a and Ce-RNH1A, occur in

C elegans

Comparative analysis of RNase H1-encoding genes in C elegans and C briggsae

C eleganshas multiple RNase H1-related genes, unlike other eukaryotes, and Ce-RNH1A seems to be the only exception found so far among eukaryotic RN-ase H1 enzymes from the perspective of ionic prefer-ence, as described in the previous section Are these features limited to C elegans? To clarify this, we con-ducted a comparative analysis of the RNase H1-enco-ding genes in C elegans and C briggsae, which diverged from a common ancestor
100 million years ago, because the complete C briggsae genome was published recently [33] and its protein database was useful for this analysis Comparative analysis showed that Ce-RNH1a, Ce-RNH1A, and Ce-RNH1C had independent orthologous proteins in C briggsae (Table 3), leading us to conclude that these RNase H1-related genes were generated before the two species diverged On the other hand, the fact that Ce-RNH1B is more similar to Ce-RNH1C than to any other eukaryotic RNase H1 enzymes (data not shown) suggests that these two genes may have been generated

as a result of gene duplication within the C elegans genome In summary, C elegans RNase H1 enzymes

Table 2 Specific activities of Ce-RNH1a and Ce-RNH1b in the

pres-ence of Mg2+ or Mn2+ ions One unit of enzymatic activity was

defined as the amount of enzyme hydrolyzing 1 lmol substrate per

minute, and the specific activity was defined as the enzymatic

activity per mg protein The activity derived from Ce-RNH1a in the

presence of MgCl2was set as 100 The specific activity values

rep-resent means from two separate experiments.

Specific activity (UÆmg)1)

Relative activity (%)

Table 3 Protein conservation among three species Numerical val-ues indicate sequence identities (%) between proteins Ortholo-gous proteins are underlined C elegans enzymes are indicated along the top, and C briggsae enzymes down the side.

Ce-RNH1a Ce-RNH1A Ce-RNH1B Ce-RNH1C

can be classified into three groups: (a) Ce-RNH1a may

have functions common to other eukaryotic RNase H1

enzymes; (b) Ce-RNH1A and Ce-RNH1C may provide

a lineage-specific function for C elegans and C

brigg-sae; (c) Ce-RNH1B may be specific to C elegans

Comparative analysis has shown the possibility that

the N-terminal sequences of C elegans RNase H1

enzymes serve as localization signals Alteration of the

N-terminal portion contributes to the subcellular

local-ization of RNase H1 in the mouse [21] and Cr

fascicu-lata [34], and protein diversity in these cases may be

caused by translation from different start codons In

C elegans, phylogenetic profiling of eukaryotic

proteins has also determined that there are
660

nucleus-encoded mitochondrial genes, and C elegans

RNase H1 enzymes are also predicted to be

mitoch-ondrial [35] In particular, we found that rnh-1.1 of

C eleganshas two potential start codons at the 5¢ ends

of the ORF, and the 17-amino-acid sequence

(MIR-WFRNFGALFKKPRG) from the first methionine

was conserved in the gene orthologous to rnh-1.1 in

C briggsae, with high similarity (88%) The

amino-acid sequence of C briggsae is

MIRWFRNL-GTLFKKPRG (amino acid residues identical with

those of Ce-RNH1A are underlined) Because the

mit-ochondrial localization signal of mouse RNase H1 is

27 amino-acid residues from the first methionine and is

conserved in several vertebrates [21], the N-terminal

portion of Ce-RNH1A may also serve as some sort of

localization signal From this result, we propose that

the multiple RNase H1 enzymes in C elegans are

regu-lated not only at a transcriptional level but also at a

post-transcriptional level Taking into consideration

the conservation of RNase H1 enzymes between

C elegans and C briggsae and the enzymatic features

described in the previous sections, we suggest that

C elegans may have obtained various types of

RNase H1 in a phased manner and that the roles of

C elegans RNase H1 enzymes may have diverged in

accordance with their evolution

Experimental procedures

Strain maintenance

The N2 nematode strain and E coli strain OP50 used in

this work were provided by the Caenorhabditis Genetics

Center, which is funded by the NIH National Center for

Research Resources (NCRR) To synchronize worm

devel-opmental staging, eggs were collected from adult worms

and incubated on nematode growth medium agar plates

overnight at 25
C L1 larval stage worms were collected

from plates with M9 buffer and plated on to nematode

growth medium agar plates inoculated with E coli strain OP50 L1 worms were incubated at 25
C, and worms at each developmental stage were harvested after the appropri-ate incubation times [36]

RT-PCR analysis Total RNAs from eggs and from larval stages 1–2 (L1–L2), 2–3 (L2–L3), 3–4 (L3–L4), and 4 to adult (L4 –adult) were prepared with TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) To detect the expression of each gene during C ele-gans development, RT-PCR was performed with ReverTra Dash (Toyobo, Osaka, Japan) using gene-specific primers (Table S1) to amplify the entire coding sequences of rnh-1.1 (GenBank accession no ZK1290.6), rnh-1.2 (GenBank accession no ZK938.7), and rnh-1.3 (GenBank accession

no C04F12.9), the partial coding sequences of rnh-1.0a (GenBank accession no F59A6.9), the alternative spliced transcript (defined as rnh-1.0b) of rnh-1.0a, and eft-3 (Gen-Bank accession no F31E3.5) PCRs were performed under the following conditions: 3 min at 94
C; 10 s at 98
C, 2 s

at 60
C, and 20 s (rnh-1.0a, rnh-1.0b, rnh-1.2, rnh-1.3, and eft-3) or 1 min (rnh-1.1) at 74
C for 30 cycles; and 5 min

at 74
C These conditions were set up to make a linear dose–response relationship between each RNA and its PCR product PCR products were separated by 1.2% agarose gel electrophoresis and stained with ethidium bromide

cDNA cloning

To obtain cDNA clones of rnh-1.1, rnh-1.2, and rnh-1.3, the amplified PCR products described in the previous sec-tion were used For cloning of rnh-1.0a and rnh-1.0b alter-natively spliced from the same transcripts, the coding sequences were amplified by RT-PCR using H0AB-S (5¢-CCAGTTACTCAAGATTTTGAACGC-3¢) as a for-ward primer and H0AB-A (5¢-CGTTTAATGAACAT TTGGGCTCC-3¢) as a reverse primer PCR products were purified with GFX PCR DNA and a Gel Band Purification Kit (Amersham Biosciences, Piscataway, NJ, USA) and cloned into pPCR-Script Amp SK(+) vectors (Stratagene,

La Jolla, CA, USA) Plasmid DNAs were transformed into

E coli strain DH5a competent cells (Toyobo) and purified with a QIAprep Spin Miniprep Kit (Qiagen GmbH, Hilden, Germany) The nucleotide sequences of each insert DNA were determined and confirmed to be identical with those

in the database

Expression and purification of recombinant proteins

The ORFs of each gene were PCR-amplified from plasmids containing each cDNA by using ReverTra Dash (Toyobo) and gene-specific primers containing NdeI and XhoI or

NotI sites (Table S2) The amplified PCR fragments were

treated with appropriate restriction enzymes and subcloned

into pET-23b expression vector (Novagen, Darmstadt,

Ger-many) and sequenced to confirm their correct nucleotide

sequences The resulting plasmids were transformed into

E colistrain BL21(DE3)pLysS (Novagen) The

transform-ants were incubated at 37
C for
6 h in Luria–Bertani

medium containing 100 lgÆmL)1ampicillin and 40 lgÆmL)1

chloramphenicol and then subjected to induction at 20
C

overnight with 0.4 mm isopropyl

b-d-thiogalactopyrano-side The recombinant proteins were extracted by

sonica-tion in buffer A [20 mm sodium phosphate (pH 7.4),

10 mm imidazole, and 500 mm NaCl] and centrifuged at

12 000 g for 10 min Except for Ce-RNH1B, the

superna-tant of each recombinant protein was loaded on to a

nickel–Sepharose column (Amersham Biosciences) and

elut-ed with buffer B [20 mm sodium phosphate (pH 7.4),

500 mm imidazole, and 500 mm NaCl] by AKTA FPLC

(Amersham Biosciences) The partly purified recombinants

were loaded on to a HiTrap Desalting Column (Amersham

Biosciences) and desalted with buffer C, containing 50 mm

Tris⁄ HCl (pH 7.5), 0.02 mm EDTA (pH 8.0), 0.05%

2-mercaptoethanol, 0.02% Tween 20, and 10% glycerol For

extraction of Ce-RNH1B, after sonication and

centrifuga-tion, the pellet was washed with buffer D [0.5% Triton

X-100, 1 mm EDTA (pH 8.0)] several times and resolved in

buffer A containing 6 m urea, loaded on to a

nickel–Seph-arose column, and eluted with buffer B containing 6 m

urea The eluted sample was dialyzed against buffer C

con-taining 6 m urea, loaded on to a HiTrap Desalting

Col-umn, and desalted with buffer C Purified recombinant

proteins were analyzed by SDS⁄ PAGE on a 10–20%

gradi-ent gel and stained with Quick-CBB (Wako, Osaka,

Japan)

In vitro assay for RNase H activity

RNase H activity was assayed by analyzing the stability of

an RNA–DNA hybrid in the presence of enzymatic

sam-ples A 5¢ FAM-labeled or 3¢ fluorescein

isothiocyanate-labeled 30-nucleotide-long RNA–DNA oligonucleotide

(5¢-GCGAAUUUAGGGCGAgagcaaacttctcta-3¢) and its

cDNA oligonucleotide (5¢-tagagaagtttgctctcgccctaaattcgc-3¢)

(ribonucleotides denoted by uppercase letters and

deoxy-ribonucleotides by lowercase letters) were chemically

syn-thesized by Hokkaido System Science (Hokkaido, Japan)

and annealed for use as a substrate RNase H reactions

were performed in 20 lL reaction buffer containing 20 mm

Tris⁄ HCl (pH 8.0), 1 mm dithiothreitol, 50 mm KCl, 0.01–

20 mm MgCl2 or MnCl2, 1 mgÆmL)1 BSA, 100 nm

sub-strate, and 0.05–400 nm purified recombinant C elegans

RNase H1 or purified recombinant Pf-RNHII (provided by

A Sato) [37], or Ec-RNHI (purchased from Toyobo,

Osaka, Japan) Samples were incubated for 15 min at room

temperature (C elegans RNase H1 enzymes) or at 37
C

(Ec-RNHI) or 50
C (Pf-RNHII) We then added an equal volume of stop solution [8 m urea⁄ 1 m Tris ⁄ HCl, pH 7.2, and a small amount of blue dextran (Sigma Chemical, St Louis, MO, USA)] to stop the reactions The reaction mix-tures were heated at 70
C for 3 min, loaded on to a 20% polyacrylamide gel containing 8 m urea, and run for 20 min

at 2000 V and 50 min at 2200 V The reaction products were visualized with a Molecular Imager FX Pro (Bio-Rad Laboratories, Hercules, CA, USA)

Kinetic analysis

To determine the kinetic parameters, the enzymatic activity was observed in the presence of 1 mm MgCl2 using the RNA–DNA⁄ DNA hybrid as substrate The concentrations

of the substrate varied from 0.1 to 1.0 lm and the amount

of enzyme was controlled such that the cleavage rate of the substrate did not exceed 30% of the total, as previously described [38] Hydrolysis of the substrate with the enzyme followed Michaelis–Menten kinetics, and the kinetic param-eters were obtained from the Lineweaver–Burk plot kcat was calculated from kcat¼ Vmax⁄ [E] To determine the spe-cific activity, one unit of enzymatic activity was defined as the amount of enzyme hydrolyzing 1 lmol substrate per minute, and the specific activity was defined as the enzy-matic activity per mg protein Enzyenzy-matic activity was observed in the presence of 1 mm MgCl2 or 5 mm MnCl2 using the RNA–DNA⁄ DNA hybrid as substrate, and the substrate concentration was 0.1 lm Each value given is the mean from two separate experiments

Comparative analysis of C elegans and

C briggsae BLAST analysis [39] was conducted against a C briggsae protein database provided by WormBase [40], by using the amino-acid sequence of human RNase H1 (GenBank acces-sion no NP_002927) as a query sequence Four proteins of

C briggsae(WormBase protein IDs CBP16719, CBP03109, CBP19944, CBP07225) were detected as similar to human RNase H1 The RNase H domain of each C elegans and

C briggsae RNase H1 was identified by using hmmpfam [41], and we extracted the amino-acid sequences corres-ponding to the RNase H domain fasta analysis [42] was performed to analyze protein similarity by comparing the amino-acid sequences of each RNase H domain

Acknowledgements

We thank Asako Sato (Keio University, Japan) for technical assistance with the RNase H assay and Dr Naoto Ohtani, Azusa Kuroki, Koji Numata (Keio University, Japan), Dr Robert J Crouch (National Institutes of Health, Bethesda, MD, USA), Dr Yuji

Kohara, and Dr Hideaki Hiraki (National Institute of

Genetics, Japan) for their helpful discussions We also

appreciate the help of Dr Wei Yang, Dr Marcin

Now-otny, and Dr Sergei A Gaidamakov (National

Insti-tutes of Health, USA) for providing unpublished data

and suggestions This research was supported in part

by: a Grant-in-Aid for Scientific Research on Priority

Areas; a Grant-in-Aid from the 21st Century Center of

Excellence (COE) Program, entitled ‘Understanding

and Control of Life’s Function via Systems Biology

(Keio University)’; and grants from the Japan Society

for the Promotion of Science (JSPS) and Keio

Univer-sity

References

1 Stein H & Hausen P (1969) Enzyme from calf thymus

degrading the RNA moiety of DNA-RNA Hybrids:

effect on DNA-dependent RNA polymerase Science

166, 393–395

2 Hausen P & Stein H (1970) Ribonuclease H An enzyme

degrading the RNA moiety of DNA-RNA hybrids Eur

J Biochem 14, 278–283

3 Hansen J, Schulze T, Mellert W & Moelling K (1988)

Identification and characterization of HIV-specific

RNase H by monoclonal antibody EMBO J 7, 239–243

4 Itaya M (1990) Isolation and characterization of a

sec-ond RNase H (RNase HII) of Escherichia coli K-12

encoded by the rnhB gene Proc Natl Acad Sci USA 87,

8587–8591

5 Henry CM, Ferdinand FJ & Knippers R (1973) A

hydridase from Escherichia coli Biochem Biophys Res

Commun 50, 603–611

6 Ohtani N, Yanagawa H, Tomita M & Itaya M (2004)

Identification of the first archaeal Type 1 RNase H gene

from Halobacterium sp NRC-1: archaeal RNase HI can

cleave an RNA–DNA junction Biochem J 381, 795–802

7 Ohtani N, Haruki M, Morikawa M & Kanaya S (1999)

Molecular diversities of RNases H J Biosci Bioeng 88,

12–19

8 Vonwirth H, Frank P & Busen W (1989) Serological

analysis and characterization of calf thymus

ribonu-clease H IIb Eur J Biochem 184, 321–329

9 Wu H, Lima WF & Crooke ST (1998) Molecular

clon-ing and expression of cDNA for human RNase H

Antisense Nucleic Acid Drug Dev 8, 53–61

10 Frank P, Albert S, Cazenave C & Toulme JJ (1994)

Purification and characterization of human ribonuclease

HII Nucleic Acids Res 22, 5247–5254

11 Berkower I, Leis J & Hurwitz J (1973) Isolation and

characterization of an endonuclease from Escherichia

colispecific for ribonucleic acid in ribonucleic acid–

deoxyribonucleic acid hybrid structures J Biol Chem

248, 5914–5921

12 Katayanagi K, Okumura M & Morikawa K (1993) Crystal structure of Escherichia coli RNase HI in com-plex with Mg2+at 2.8 A˚ resolution: proof for a single Mg(2+)-binding site Proteins 17, 337–346

13 Goedken ER & Marqusee S (2001) Co-crystal of Escherichia coliRNase HI with Mn2+ions reveals two divalent metals bound in the active site J Biol Chem

276, 7266–7271

14 Ohtani N, Haruki M, Muroya A, Morikawa M & Kanaya S (2000) Characterization of ribonuclease HII from Escherichia coli overproduced in a soluble form

J Biochem (Tokyo) 127, 895–899

15 Ohtani N, Haruki M, Morikawa M, Crouch RJ, Itaya M & Kanaya S (1999) Identification of the genes encoding Mn2+-dependent RNase HII and

Mg2+-dependent RNase HIII from Bacillus subtilis: classification of RNases H into three families Bio-chemistry 38, 605–618

16 Mushegian AR, Edskes HK & Koonin EV (1994) Eukaryotic RNAse H shares a conserved domain with caulimovirus proteins that facilitate translation of poly-cistronic RNA Nucleic Acids Res 22, 4163–4166

17 Cerritelli SM & Crouch RJ (1995) The non-RNase H domain of Saccharomyces cerevisiae RNase H1 binds double-stranded RNA: magnesium modulates the switch between double-stranded RNA binding and RNase H activity RNA 1, 246–259

18 Gaidamakov SA, Gorshkova II, Schuck P, Steinbach

PJ, Yamada H, Crouch RJ & Cerritelli SM (2005) Eukaryotic RNases H1 act processively by interactions through the duplex RNA-binding domain Nucleic Acids Res 33, 2166–2175

19 Wu H, Lima WF & Crooke ST (2001) Investigating the structure of human RNase H1 by site-directed mutagen-esis J Biol Chem 276, 23547–23553

20 Filippov V, Filippov M & Gill SS (2001) Drosophila RNase H1 is essential for development but not for pro-liferation Mol Genet Genomics 265, 771–777

21 Cerritelli SM, Frolova EG, Feng C, Grinberg A, Love

PE & Crouch RJ (2003) Failure to produce mitochon-drial DNA results in embryonic lethality in Rnaseh1 null mice Mol Cell 11, 807–815

22 Arudchandran A, Cerritelli SM, Bowen NJ, Chen X, Krause MW & Crouch RJ (2002) Multiple ribonuclease H-encoding genes in the Caenorhabditis elegans genome contrasts with the two typical ribonuclease H-encoding genes in the human genome Mol Biol Evol 19, 1910– 1919

23 Lejeune F & Maquat LE (2005) Mechanistic links between nonsense-mediated mRNA decay and pre-mRNA splicing in mammalian cells Curr Opin Cell Biol

17, 309–315

24 Morrison M, Harris KS & Roth MB (1997) smg mutants affect the expression of alternatively spliced SR

protein mRNAs in Caenorhabditis elegans Proc Natl

Acad Sci USA 94, 9782–9785

25 Mitrovich QM & Anderson P (2000) Unproductively

spliced ribosomal protein mRNAs are natural targets of

mRNA surveillance in C elegans Genes Dev 14, 2173–

2184

26 Szabo G, Katarova Z & Greenspan R (1994) Distinct

protein forms are produced from alternatively spliced

bicistronic glutamic acid decarboxylase mRNAs during

development Mol Cell Biol 14, 7535–7545

27 Mounsey A, Bauer P & Hope IA (2002) Evidence

suggesting that a fifth of annotated Caenorhabditis

elegansgenes may be pseudogenes Genome Res 12,

770–775

28 Zorio DA & Blumenthal T (1999) Both subunits of

U2AF recognize the 3¢ splice site in Caenorhabditis

ele-gans Nature 402, 835–858

29 Chai Q, Qiu J, Chapados BR & Shen B (2001)

Archaeo-globus fulgidusRNase HII in DNA replication:

enzymo-logical functions and activity regulation via metal

cofactors Biochem Biophys Res Commun 286, 1073–1081

30 Li S, Armstrong CM, Bertin N, Ge H, Milstein S, Boxem

M, Vidalain PO, Han JD, Chesneau A, Hao T, et al

(2004) A map of the interactome network of the

meta-zoan C elegans Science 303, 540–543

31 Baek D & Green P (2005) Sequence conservation,

rela-tive isoform frequencies, and nonsense-mediated decay

in evolutionarily conserved alternative splicing Proc

Natl Acad Sci USA 102, 12813–12818

32 Wintersberger U & Frank P (2001) Ribonucleases H of

the budding yeast, Saccharomyces cerevisiae Methods

Enzymol 341, 414–429

33 Stein LD, Bao Z, Blasiar D, Blumenthal T, Brent MR,

Chen N, Chinwalla A, Clarke L, Clee C, Coghlan A,

et al.(2003) The genome sequence of Caenorhabditis

briggsae: a platform for comparative genomics Plos

Biol 1, 166–192

34 Engel ML, Hines JC & Ray DS (2001) The Crithidia

fasciculataRNH1 gene encodes both nuclear and

mito-chondrial isoforms of RNase H Nucleic Acids Res 29,

725–731

35 Marcotte EM, Xenarios I, van Der Bliek AM & Eisen-berg D (2000) Localizing proteins in the cell from their phylogenetic profiles Proc Natl Acad Sci USA 97, 12115–12120

36 Lewis JA & Fleming JT (1995) Basic culture methods: Caenorhabditis elegans Modern Biological Analysis of an Organism, pp 4–9 Academic Press, San Diego, CA

37 Sato A, Kanai A, Itaya M & Tomita M (2003) Coop-erative regulation for Okazaki fragment processing by RNase HII and FEN-1 purified from a hyperthermophi-lic archaeon, Pyrococcus furiosus Biochem Biophys Res Commun 309, 247–252

38 Haruki M, Tsunaka Y, Morikawa M & Kanaya S (2002) Cleavage of a DNA-RNA-DNA⁄ DNA chimeric substrate containing a single ribonucleotide at the DNA–RNA junction with prokaryotic RNases HII FEBS Lett 531, 204–208

39 Altschul SF, Gish W, Miller W, Myers EW & Lipman

DJ (1990) Basic local alignment search tool J Mol Biol

215, 403–410

40 Chen N, Harris TW, Antoshechkin I, Bastiani C, Bieri

T, Blasiar D, Bradnam K, Canaran P, Chan J, Chen

CK, et al (2005) WormBase: a comprehensive data resource for Caenorhabditis biology and genomics Nucleic Acids Res 33, 383–389

41 Eddy SR (1998) Profile hidden Markov models Bio-informatics 14, 755–763

42 Pearson WR (1990) Rapid and sensitive sequence com-parison with FASTP and FASTA Methods Enzymol

183, 63–98

Supplementary material

The following supplementary material is available online:

Table S1 Oligonucleotides used for RT-PCR analysis Table S2 Oligonucleotides used for expression clo-ning Restriction sites are underlined

This material is available as part of the online article from http://www.blackwell-synergy.com