Báo cáo khoa học: Purification and functional characterization of human 11b hydroxylase expressed in Escherichia coli doc

The functionality of hCYP11B1 was analyzed using different methods substrate conversion assays, stopped-flow, Bia-core.. Moreover, the determined NADPH coupling percentage for the hCYP11B

11b hydroxylase expressed in Escherichia coli

Andy Zo¨llner1, Norio Kagawa1,2, Michael R Waterman2, Yasuki Nonaka3, Koji Takio4,

Yoshitsugu Shiro4, Frank Hannemann1and Rita Bernhardt1

1 Department of Biochemistry, Saarland University, Saarbru¨cken, Germany

2 Department of Biochemistry, Vanderbilt University School of Medicine, Nashville, TN, USA

3 College of Nutrition, Koshien University, Takarazuka, Hyogo, Japan

4 Biometal Science Laboratory, Riken Spring-8 Center, Harima Institute, Hyogo, Japan

The final steps in the synthesis of the major human

glucocorticoid, cortisol, and the most important

miner-alocorticoid in humans, aldosterone [1], are catalyzed

by 95% identical mitochondrial cytochrome P450

iso-zymes, 11b-hydroxylase (CYP11B1; EC 1.14.15.4) and

CYP11B2 [2] Cortisol is synthesized from

11-deoxy-cortisol through a hydroxylation reaction at position

11b catalyzed by CYP11B1, whereas aldosterone is synthesized from 11-deoxycorticosterone via a series of reactions catalyzed by CYP11B2

CYP11B1 is expressed in the adrenal zona fasiculata and is regulated by adrenocorticotrophic hormone (ACTH) The human aldosterone synthase, CYP11B2,

on the other hand, is expressed in the zona glomerulosa

Keywords

Biacore measurements; congenital adrenal

hyperplasia; expression; human CYP11B1;

stopped-flow experiments

Correspondence

R Bernhardt, Department of Biochemistry,

Saarland University, 66123 Saarbru¨cken.

Germany

Fax: +49 681 302 4739

Tel: +49 681 302 3005

E-mail: ritabern@mx.uni-saarland.de

Website: http://bernhardt.biochem.uni-sb.de/

HP1.html

(Received 24 August 2007, revised 3

December 2007, accepted 18 December

2007)

doi:10.1111/j.1742-4658.2008.06253.x

The human 11b-hydroxylase (hCYP11B1) is responsible for the conversion

of 11-deoxycortisol into the major mammalian glucocorticoid, cortisol The reduction equivalents needed for this reaction are provided via a short elec-tron transfer chain consisting of a [2Fe-2S] ferredoxin and a FAD-contain-ing reductase On the biochemical and biophysical level, little is known about hCYP11B1 because it is very unstable for analyses performed

in vitro This instability is also the reason why it has not been possible to stably express it so far in Escherichia coli and subsequently purify it In the present study, we report on the successful and reproducible purification of recombinant hCYP11B1 coexpressed with molecular chaperones GroES⁄ GroEL in E coli The protein was highly purified to apparent homogene-ity, as observed by SDS⁄ PAGE Upon mass spectrometry, the mass-to-charge ratio (m⁄ z) of the protein was estimated to be 55 761, which is consistent with the value 55 760.76 calculated for the form lacking the translational initiator Met The functionality of hCYP11B1 was analyzed using different methods (substrate conversion assays, stopped-flow, Bia-core) The results clearly demonstrate that the enzyme is capable of hydroxylating its substrates at position 11-beta Moreover, the determined NADPH coupling percentage for the hCYP11B1 catalyzed reactions using either 11-deoxycortisol or 11-deoxycorticosterone as substrates was approx-imately 75% in both cases Biacore and stopped-flow measurements indi-cate that hCYP11B1 possesses more than one binding site for its redox partner adrenodoxin, possibly resulting in the formation of more than one productive complexes In addition, we performed CD measurements to obtain information about the structure of hCYP11B1

Abbreviations

ACTH, adrenocorticotrophic hormone; AdR, adrenodoxin reductase; Adx, adrenodoxin; bCYP11B1, bovine 11b hydroxylase; hCYP11B1, human 11b hydroxylase.

and is regulated by angiotensin II and potassium, with

ACTH having mostly a short-term effect on expression

[3,4] Interestingly, in bovine CYP11B1 (bCYP11B1),

which is the most widely studied CYP11B1 so far due

to its availability, both functions of the human

CYP11B isoforms (cortisol and aldosterone formation)

are performed by a single protein

CYP11B1 deficiency results in decreased

cortisol-production leading subsequently to an elevated plasma

ACTH level, and an accumulation of steroid

precur-sors Such an enzyme deficiency is known to be the

cause in 5–8% [5,6] of patients suffering from

congeni-tal adrenal hyperplasia, an autosomal recessive

inher-ited inborn error in steroidogenesis that ranks among

the most frequent inborn errors of metabolism

CYP11B1 deficiency leads to flooding of the androgen

synthesis pathway by accumulation of steroid

precur-sors, resulting in hyperandrogenism In approximately

two thirds of patients, hypertension can be diagnosed

because of the accumulation of 11-deoxycorticosterone

and its metabolites Overproduction of androgens such

as in classic CYP11B1 deficiency leads, for example, to

severe virilization of external genitalia in newborn

females as well as to bone age acceleration in both

sexes [2,6,7]

On the other hand, hCYP11B1 can also be a target

of drug action in the case of hydrocortisolism, which

plays an important role in the metabolic syndrome So

far, the development of selective and specific inhibitors

was only possible using recombinant yeast or V79 cells

for inhibition studies [8]

The reduction equivalents needed for all

CYP11B1⁄ B2 catalyzed reactions are provided via a

short electron transfer chain consisting of a [2Fe-2S]

ferredoxin, adrenodoxin (Adx) and a

NADPH-depen-dent, FAD containing reductase, adrenodoxin

reduc-tase (AdR; EC 1.18.1.2) [8,9] This electron transfer

chain is also responsible for providing electrons for the

conversion of cholesterol to pregnenolone, the

precur-sor molecule of all steroid hormones, which is

pro-duced in a reaction catalyzed by CYP11A1 [10,11]

So far, little is known about the interaction between

hCYP11B1 and its redox partner Adx This is mainly

due not only to the scarce availability of human

adre-nals, but also to the instability of this protein, which

has hindered its expression in Escherichia coli and its

subsequent purification Therefore, most of the studies

performed to date have been carried out using bovine

CYP11B1 in a detergent solubilized system or in

lipo-somes [12,13] However, the instability of the

solubi-lized enzyme, mainly due to its hydrophobic nature,

has hindered any detailed investigation [13] Moreover,

purification of the homologous bovine protein from

adrenal glands is known to be difficult, time consum-ing and renders only small quantities of the purified protein (4–8 mg from 1.25 g of mitochondrial pellets [14]) In the present study, we describe the successful expression of human CYP11B1 in E coli as well as its subsequent purification in significant quantities Addi-tionally, we were able to functionally characterize this enzyme by using bovine Adx and AdR as electron donors Taking this into account, this study opens new perspectives for the investigation of the structure and functions of this physiologically important protein

Results and Discussion

Previously, rat CYP11B1 and CYP11B2 was expressed

in E coli JM109 using a bacterial expression vector pTrc99A [15] However, the expression level of the proteins was 10–20 nmolÆL)1 culture media, which is too low to obtain quantities of the purified proteins for in depth characterization

As it was very efficacious for the expression of human CYP19 [16], mouse CYP27B1 [17] and bovine CYP21 [18], the coexpression of molecular chaperones GroES⁄ GroEL also resulted in an efficient expression

of human CYP11B1 Utilizing the pET⁄ BL21 expres-sion system with the coexpresexpres-sion of molecular chaper-ones GroES⁄ GroEL, the human CYP11B1 has been expressed in E coli with a yield of approxi-mately 400 nmolÆL)1 culture In addition to greatly increasing the expression level, our expression system using pET⁄ BL21 shortened the incubation time to approximately 24 h compared to 45 h for the pTrc99A⁄ JM109 system used for the expression of rat CYP11B1 and CYP11B2 [15]

The expressed form of hCYP11B1 was stable in the presence of detergents and glycerol and highly purified through three chromatographic steps to the specific content of 19.8 nmolÆmg)1, as estimated from the reduced CO-difference spectrum and protein assay (the theoretical value 17.8 nmolÆmg)1) The purified protein was apparently homogeneous upon SDS⁄ PAGE (Fig 1) and showed a single major peak on HPLC analysis using a POROS column (Fig 2A) The peak was collected and subjected to MALDI-TOF analysis Signals of singly (m⁄ z = 55761) and doubly (m⁄ z = 27898) charged apoprotein were observed (Fig 2B) The m⁄ z value is in good agreement with the calculated molecular mass of 55760.76 for the transla-tional initiator Met-deleted hCYP11B1

As shown in Fig 3, the UV⁄ visible spectrum of purified recombinant CYP11B1 revealed a pronounced Soret peak at 392 nm in the absence of substrates (Fig 3, spectrum 1), indicating that the protein is in its

high spin state The spectrum was not changed by the

addition of 17,21-hydroxyprogesterone (spectrum 2),

although the P450 was reduced by sodium dithionite

(spectrum 3) and formed the reduced CO complex

(spectrum 4) that produced a typical P450 peak of

reduced CO-difference spectrum at 448 nm (Fig 3,

lower panel) The finding that the recombinant protein

is in its five coordinated high spin state [9,19] is of

importance because it has been postulated that the

high spin state of cytochrome P450s is more stable

compared to its low spin state probably due to slight

conformational differences of the active site

Additional spectroscopic measurements have been performed using CD spectropolarimetry The CD spectrum of 11B1 in the far-UV region (Fig 4A) describes a mainly alpha helical conformation, as expected for a cytochrome P450 enzyme because all P450 structures solved to date are predominantly alpha helical The spectrum of CYP11B1 is characterized in this region by a negative dichroic double band with minima at 210 and 221 nm, which do not change after substrate supplementation (data not shown) The heli-cal content of the protein at 20C was determined to

be greater than 50% according to the contin and selcon prediction programs [20,21] In the near-UV and visible region, the CD spectra of CYP11B1 display two large signals of negative sign (Fig 4B), one with a minimum below 280 nm and a second with a minimum near the position of the Soret maximum (386 nm) in the absorption spectrum The negative cotton effect in the Soret region has been observed in other cyto-chromes P450 and can be attributed to a solvent-acces-sible heme pocket In addition, two signals of positive sign appeared at 290 and 326 nm The 260–280 nm region reflects mainly tyrosine transitions, whereas the signal at 326 can be attributed to an anisotropy of the porphyrin absorption band [22] Upon addition

of substrate, the signal of the positive CD band

at 290 nm and the negative band at 386 nm decreased (Fig 4B) A similar observation was described for sub-strate binding of cytochrome P450RR1 from Rhodo-coccus rhodochrous[23]

The functionality of the enzyme was demonstrated

by performing hCYP11B1-dependent substrate conver-sion assays using 11-deoxycorticosterone and 11-de-oxycortisol as substrate and by a subsequent HPLC analysis of the steroid product pattern (Fig 5) The hCYP11B1 electron transfer chain was always reconsti-tuted using bovine AdR and bovine Adx, which is

Purified human CYP11B1

Fig 1 SDS polyacrylamide gel electrophoresis of the purified

CYP11B1 Different amounts of the purified hCYP11B1 (2, 4, 8 lg

per lane) were separated by SDS⁄ PAGE (10%) and visualized by

Coomassie staining.

A

27898

55761

B

Fig 2 HPLC and mass spectral analysis of the purified hCYP11B1 (A) The purified hCYP11B1 was applied on RP-HPLC analysis using POROS R1⁄ 10 (2.1 · 100 mm; Applied Biosystems) as described in Experimental procedures The protein absorbance was monitored at

215 nm (B) The apoprotein peak (15.5 min peak in Fig 2A) was collected and subjected to MALDI-TOF MS with sinapic acid as matrix.

capable of interacting with hCYP11B1 possessing a

90% amino acid sequence identity with human Adx

As shown in Fig 6, the recombinant enzyme was

able to efficiently convert 11-deoxycortisol to cortisol

with a kcatof 1.67 s)1 and a Kmof 338.4 ± 30.2 lm

for 11-deoxycortisol Human CYP11B1 is also able

to convert 11-deoxycorticosterone to corticosterone

(kcat= 0.85 s)1and Km= 179.5 ± 19.1 lm

11-deoxy-corticosterone)

The fact that the binding affinity of hCYP11B1 to

11-deoxycorticosterone is significantly higher compared

to the affinity for its natural substrate,

11-deoxycorti-sol, might be caused by the additional hydroxyl group

at position C17 of 11-deoxycortisol This additional

OH group is likely to hinder the entrance of the

slightly more hydrophilic and bulky substrate

11-de-oxycortisol into the active site of the enzyme

Compared with the published values for the

forma-tion of corticosterone by the bovine enzyme,

bCYP11B1 (kcat= 0.1 s)1), the obtained values using hCYP11B1 are approximately ten-fold higher This finding is quite surprising because the sequence identity between the human enzyme and the bovine enzyme is high (73%) However, some of the main differences between human and bovine CYP11B1 are located in

0.15

0.10

0.05

1

3

2: 17,21-OH-Prog 3: Reduced 4: Reduced-CO

0.00

0.15

0.10

0.05

0.00

-0.05

4-3

Wavelength (nm)

Fig 3 UV ⁄ visible spectra of the purified human CYP11B1 The

absolute spectra of the purified CYP11B1 (0.15 l M ) was analyzed

without substrate (1), with 0.1 m M of

17,21-hydroxy-progester-one (2), as a reduced form with 17,21-hydroxy-progester17,21-hydroxy-progester-one in the

presence of sodium dithionite (3), and as a reduced CO complex

with 17,21-hydroxy-progesterone (4) The reduced CO-different

spectrum (4-3) in the presence of 17,21-hydroxy-progesterone is

shown in the lower panel.

B A

Fig 4 CD spectra of CYP11B1 The CD spectrum recorded in the far-UV of CYP11B1 is shown in the absence of substrate

at 20 C (A) The protein concentration was 5 l M in 10 m M potas-sium phosphate buffer, pH 7.4 CD spectra in the near ultraviolet and visible light were recorded in the absence (black) and in the presence of substrate 11-deoxycortisol (gray) at 20 C (B) The con-centration of CYP11B1 was 10 l M in 10 m M potassium phosphate buffer, pH 7.4 Substrate was added to a concentration of 20 l M

substrate recognition sites 2 and 3 (SRS2 and SRS3), which are mainly composed of the F and G helix of the cytochrome [24] This inconsistency might be the cause for the significantly different interspecies conver-sion rates However, the alterations may also be explained by the broader substrate-binding spectrum

of bCYP11B1 resulting from the combination of the functions of CYP11B1 and CYP11B2 within one enzyme

Comparison of the kcatvalues obtained for the con-version of 11-deoxycorticosterone by hCYP11B1 with values published for corticosterone formation by rec-ombinantly expressed and purified CYP11B1 from rats (2.18 s)1) indicated that the maximal rate determined for hCYP11B1 has not been significantly altered (approximately 2.5-fold lower)

The kcatvalues obtained for hCYP11B1 catalyzed reactions are in the range of values previously reported for CYP106A2 catalyzed steroid hydroxylations and significantly faster than the kcatvalue determined for the formation of pregnenolone from cholesterol cata-lyzed by CYP11A1, which is the rate limiting step in steroidogenesis

Additional studies performed to correlate the NADPH consumption during the reaction with the amount of product formed (i.e the coupling percent-age) revealed a 72% coupling when using 11-deoxy-corticosterone as substrate and a 76% coupling when using 11-deoxycorticosterone as substrate, respectively These findings indicate that, during the reaction

of hCYP11B1 with either 11-deoxycorticosterone or 11-deoxycortisol, approximately 25% of the consumed NADPH is spent in other reactions (e.g hydrogen

B A

Fig 5 Typical steroid product pattern

recorded at 440 nm after HPLC separation

with an isocratic solvent system consisting

of acetonitrile ⁄ water (60 : 40) at a flow rate

of 1 mLÆmin)1on a C18 reversed phase

col-umn Substrate conversions of CYP11B1

were performed with increasing amounts

of Adx (gray, dark gray, black lines).

(A) Conversions of the substrate

11-deoxy-corticosterone (DOC) to the products B

(cor-ticosterone) and 18OH-B using cortisol (F)

as internal standard (B) shows the

conver-sion of the substrate 11-deoxycortisol (RSS)

to F using 11-deoxycorticosterone as

inter-nal standard.

A

B

k

k

m

m

Fig 6 hCYB11B1 substrate conversion assays were performed

using the reconstituted electron transfer chain consisting of bovine

Adx and bovine AdR as well as different substrate concentrations:

11-deoxycortisol (A) and 11-deoxycorticosterone (B) Steroid

separa-tion was achieved via HPLC analysis as indicated in Experimental

procedures Vmaxvalues (nmol productÆmin)1Ænmol)1hCYP11B1)

were subsequently converted into kcatvalues (s)1).

peroxide formation) Besides the formation of

hydro-gen peroxide, other NADPH consuming reactions

probably involving the redox partners AdR and Adx

are taking place Further studies will focus on

investi-gating this interesting question

Experiments performed to determine the Adx

depen-dency of the hCYP11B1 catalyzed reaction were

car-ried out under substrate saturation conditions The

kcatvalues obtained in these experimental set ups were

in the range of the values shown above using different

substrate concentrations (Table 1) The Adx-dependent

Kmvalues obtained from these studies using

11-deoxy-corticosterone or 11-deoxycortisol as substrate did not

reveal any significant differences, indicating that the

interaction between Adx and hCYP11B1 is not

affected by the different substrates (Table 1) In

addi-tion to this, the obtained Adx-dependent Kmvalue

using 11-deoxycorticosterone as substrate was in the

range of values determined in previous studies for the

interaction between bovine Adx and bCYP11B1

Biacore measurements were performed to investigate

the binding behavior between bovine Adxox and

hCYP11B1ox or bCYP11B1ox in more detail Among

the binding models available in the standard software

(e.g 1 : 1 binding or complexes with higher

stoichio-metry), the best fit was always observed with the

‘bivalent analyte’ model This suggested that CYP11B1

possesses more than one binding site for Adx Taking

possible steric hindrances on the chip surface into

account, only the formation of the first predominant

1 : 1 complex has been considered (Table 2), as was

the case in a previous study [25] As seen in Table 2,

the KDvalues obtained for the predominant 1 : 1 com-plexes for both CYP11B1 species were in the nm range Surprisingly, the konrate of the bCYP11B1⁄ Adx com-plex was two-fold slower compared with the on-rate for the hCYP11B1⁄ Adx complex On the other hand, the off rate was five-fold faster for the hCYP11-B1⁄ Adx, indicating a slightly weaker stability com-pared to the physiological interaction

To characterize the electron transfer from Adx to hCYP11B1, we performed stopped flow experiments The recorded reaction traces displayed three phases that could be fitted separately (Fig 7) This might indi-cate that there are three different Adx binding sites on hCYP11B1 or that complex rearrangements leading to different reduction rates take place during the reaction The kobsvalues determined for the first phase were always in the range of 60 s)1, indicating a fast process However, the amplitude of this phase was only approximately 15–20% of the overall reaction ampli-tude, indicating that this productive complex might be thermodynamically less favored Due to the velocity and the small amplitude change, it was not possible to determine the Adx dependency of this first process Both the second phase and the third phase displayed

an Adx dependency of the kobsrate, which could be evaluated using the Michaelis–Menten equation (Fig 7) Combined with the data obtained from Bia-core experiments, which indicated the possibility of more than one complex formation, and considering that no impurities could be detected in polyacrylamid gel electrophoresis using our hCYP11B1 preparation,

it is unlikely that the observed phases are a result of a heterogenous sample composition Since it is known that the Adx concentration plays a role in the regula-tion of the activity of CYP11A1 [26], CYP11B1 [27] and CYP11B2 [28], this finding is not surprising The maximal velocities extracted from the plots shown in Fig 7B,C for the second and third phase were 3.89 s)1 and 0.65 s)1, respectively The KDvalues obtained from these experiments for the interaction between the relevant redox states of Adx and hCYP11B1 were 0.78 lm for the second phase and 2.2 lm for the third phase Since the KDvalue obtained from the optical

Table 1 Kinetic parameters obtained for the conversion of 11-deoxycorticosterone or 11-deoxycortisol using different Adx concentrations under substrate saturation (left) Kinetic parameters obtained using different substrate concentrations are also shown (right).

Substrate

Table 2 Values obtained for the complex formation between

bovine Adx and CYP11B1 from different species using a Biacore

3000 system Values were determined using a bivalent mechanism.

The values shown below characterize the formation of the

predomi-nant 1 : 1 complex The 2 : 1 complex was not considered (see

Results and Discussion).

Complex k on (s)1Æ M )1) k

off (s)1) K D ( M · 10)6)

biosensor measurements and the value obtained for the

productive complex leading to the second reaction

phase are in the same range, it can be assumed that

this complex is the predominant complex seen with the

Biacore device Moreover, analysis of the amplitude

change of these phases extracted from the stopped-flow

experiments indicates that the second complex is

fur-ther stabilized in the presence of increasing amounts of

Adx, whereas the complex leading to the third reaction

phase is favored in the presence of small amounts of

Adx (Fig 7) These findings suggest different

thermo-dynamic attributes for the productive complexes

Nevertheless, it cannot be ruled out that the

differ-ent reaction phases observed in these experimdiffer-ents are

caused by complex rearrangements or conformational gating that might be necessary before an efficient elec-tron transfer can take place More investigations including Adx and CYP11B1 mutants will be necessary

to investigate this question in more detail However, considering the current data, it is very likely that a productive interaction (complex formation) between Adx and CYP11B1 can take place through more than one productive complex, as previously postulated for the interaction between bovine CYP11B1 and Adx [29]

Moreover, comparison of the kcatvalues obtained from the substrate conversion experiments with the maximal observed reduction rates from the

Fig 7 Stopped flow analysis of the Adx-dependent hCYP11B1-CO complex formation The transient reaction traces obtained for this inter-action displayed three different phases that could be evaluated by using mono- or biexponential fits (A) k obs values for the first fast phase using different Adx concentrations were obtained after evaluation using a monoexponential function as shown in the insert (B) k obs values obtained for the second phase plotted against the corresponding Adx concentration kobs,maxand Kmvalues were determined by using a hyperbolic equation as shown in the plot The insert shows the curve trajectory excluding the first phase, which was best described by a bi-exponential fit (C) Plot showing the Adx dependency of the kobs values obtained for the third reaction phase along with the deter-mined kobs,maxand Kmvalues (D) Adx concentration-dependent amplitude change of the different reaction phases expressed as a percent.

flow experiments indicates that only the first fast phase

can enable such high turnover rates Additionally, it

appears that the second and the third phase seen in

the stopped-flow measurements are negligible during

the hydroxylation reaction, although possessing a

higher amplitude change in the stopped-flow

measure-ments compared to phase 1 Otherwise, the kcatvalues

from the substrate conversion assays were likely to be

in the range of the kobs,maxvalues obtained for these

phases However, more investigations are necessary to

clarify this assumption In this context, it is possible

that the predominant, but slower phases observed in

the stopped-flow experiments play a role in the

regula-tion of the activity of CYP11B1, especially since the

absolute amplitude change of these phases when using

higher Adx concentrations increases and an

involve-ment of the Adx concentration in the regulation of

CYP11B1 has been demonstrated previously [27]

Nev-ertheless, the physiological relevance of these different

phases and the postulated different complexes remains

unclear and should be subject of further studies

In summary, the present study reports on the

suc-cessful purification of functional hCYP11B1 expressed

in E coli This will open new possibilities for analyzing

this very important cytochrome P450 in vitro, including

the detailed investigation of the interaction of

hCYP11B1 with its redox partner, Adx As indicated

by stopped-flow and optical biosensor experiments, it

is very likely that the reaction between hCYP11B1 and

Adx can proceed through more than one productive

complex

In addition, the purification protocol provided here

will facilitate the examination of mutations in

hCYP11B1 that lead to congenital adrenal hyperplasia,

indicating the medical relevance of the present study

To date, the examination of such hCYP11B1 mutants

has been only possible through cell culture

experi-ments, which do not provide detailed information on

the influence of such mutations on the protein

struc-ture or on its redox behavior Finally, the expression

and purification of hCYP11B1 is a necessary

prerequi-site for its future structural characterization

Experimental procedures

Protein expression and purification

The human CYP11B1 was expressed as a mature form

with N- and C-terminal modifications The cDNA fragment

encoding the modified CYP11B1 was produced by PCR

using the 5¢-primer (CGCCATATGGCTACTAAAGCTG

CTCGTGTTCCACGTACAGTGCTGCCA) and 3¢-primer

(GCGAAGCTTAATGATGATGATGATGATGGTTGAT

cDNA template was as described previously [30] The DNA sequence was determined by automated sequencing This 5¢-primer was designed to alter the N-terminus from

3¢-primer was designed to add six histidine residues at the C-terminus to facilitate the purification The CYP11B1 expression plasmid was introduced into E coli strain

vector pGro12 [31]

The human CYP11B1 was expressed and extracted from

described for the expression of CYP19 and CYP21 [18] The extracts (100 mL) from 1 L culture were applied on a Ni-NTA agarose (10 mL bed volume) column equilibrated with buffer A (50 mm potassium phosphate, pH 7.4,

0.1 mm dithiothreitol, 1% sodium cholate, 1% Tween 20,

20 mL of buffer B (50 mm potassium phosphate, pH 7.4,

0.1 mm ATP and 0.1 mm phenylmethanesulfonyl fluoride) Proteins were eluted with buffer C (200 mm imidazole acetate, pH 7.4, 20% glycerol, 0.1 mm EDTA, 0.1 mm di-thiothreitol, 1% sodium cholate, 1% Tween 20) The red-colored fractions were combined and diluted with five

0.1 mm dithiothreitol, 1% sodium cholate, pH 7.4) and

The column was washed with 40 mL of buffer E Pass-through fractions were then applied on a SP-Sepharose

20 mL of buffer F, and eluted with 0–125 mm NaCl gradi-ent in buffer G (40 mm potassium phosphate, pH 7.4,

10 mm imidazole, 1% sodium cholate) The major red frac-tions were combined, and repeatedly concentrated and diluted using a centrifugal device to replace the buffer with buffer H (50 mm potassium phosphate, pH 7.4, 20%

cholate, 0.05% Tween 20)

The protease deficient E coli strain BL21 was used as host strain for the heterologous expression of AdR and Adx The plasmid containing the coding sequence for AdR was kindly provided by Y Sagara [32] Recombinant Adx and AdR were purified as described previously [33,34]

Isolation of CYP11B1 from bovine adrenals was performed

as described by Ikushiro et al [13] with slight

modifica-tions

RP-HPLC and mass spectrometry of the purified

hCYP11B1

Purity of the h11B1 was assessed by RP-HPLC RP-HPLC

Applied Biosystems, Foster City, CA, USA) using a liquid

chromatograph (Agilent model 1100; Agilent Technologies,

Palo Alto, CA, USA) with a 16 min linear gradient of

8–72% CH3CN in 0.1% trifluoroacetic acid at a flow rate

absor-bance at 215 nm, 254 nm, 275 nm, 290 nm and 400 nm

The peak eluted at 13.5 min contained the heme extracted

from h11B1 and that at 15.5 min contained the apoprotein

The apoprotein peak was collected and subjected to

MALDI-TOF MS to verify the integrity of the protein

moiety on Voyager DE-Pro (Applied Biosystems) with

sina-pic acid as matrix

UV/visible and CD spectroscopy

temperature on a Shimadzu double-beam

spectrophoto-meter (UV2100PC; Shimadzu, Kyoto, Japan) The

con-centration of the 11b-hydroxylase was estimated by carbon

concentra-tions were determined using the molar extinction coefficient

respectively

spec-tropolarimeter (Jasco Corporation, Tokyo, Japan) Samples

contained 10 lm CYP11B1 in 10 mm potassium phosphate

buffer (pH 7.4) in a 1 cm cuvette for measurements in the

250–650 nm range and 5 lm CYP11B1 in the same buffer

250 nm range The spectra were accumulated five times and

then smoothed The spectrum of the potassium phosphate

buffer was recorded in each case as a baseline Substrate

11-deoxycortisol was added to a concentration of 20 lm

Secondary structure content analysis was performed using

the contin and selcon programs [20,21]

Enzyme activity assays

These assays served the purpose to demonstrate the ability

of the recombinant CYP11B1 enzyme to 11b-hydroxylate

its natural substrates, 11-deoxycortisol and

11-deoxycorti-costerone, to form cortisol and corti11-deoxycorti-costerone, respectively

Assays aimed at the characterization of the CYP11B1

activ-ity depending on the Adx concentration were performed as

previously described for CYP11A1 reconstitution assays [38] with slight modifications All experiments were per-formed using bovine Adx, which is capable of interacting with hCYP11B1 Bovine and human Adx exhibit a 90% primary structure identity Briefly, the reaction

(0.5 lm), Adx (2–20 lm), 11-deoxycortisol or

glucose 6-phosphate (5 lm) and glucose 6-phosphate dehy-drogenase (1 U) was applied

In another set of experiments, we varied the substrate concentration in the range 0–700 lm for both substrates whereas the Adx concentration was fixed at 10 lm All other components were as described above All reactions were ini-tiated by the addition of 100 lm NADPH and were carried

add-ing chloroform, either cortisol (for 11-deoxycorticosterone conversion assays) or 11-deoxycorticosterone (for 11-deoxy-cortisol conversion) was added to the corresponding reac-tion mixture as an internal standard After extracreac-tion of the steroids and evaporation of the chloroform phase, the ste-roids were resuspended in 200 lL acetonitrile and separated

on a Jasco reversed phase HPLC system of the LC900 series

(Waters Corporation, Milford, MA, USA) Column

mobile phase used for steroid separation was a mixture of

Steroid separation was monitored at 240 nm over a period

of 3 min Product quantification was performed by correlat-ing the product peak area with the peak area of the known internal standard steroid (5 nmol cortisol or 11-deoxycorti-costerone) added prior to the chloroform extraction

sub-strate conversion velocities versus the corresponding Adx

or substrate concentrations and by subsequently applying Michaelis–Menten kinetics (hyperbolic fit) using the pro-gram sigmaplot 2001 (Systat Software, San Jose, CA,

To correlate the NADPH consumption with the amount

of product formed (i.e the coupling percentage), we per-formed additional experiments Samples generated for this purpose contained 400 lm substrate (11-deoxycortisol

or 11-deoxycorticosterone), 0.4 lm hCYP11B1, 3 lm Adx, 0.5 lm AdR in 50 mm Hepes buffer, pH 7.4, containing 0.05% Tween 20 The reaction was initiated by addition of NADPH to a final concentration of 100 lm Reaction con-ditions were as described above The sample volume was

500 lL NADPH consumption was determined spectro-scopically by recording the absorption changes of the

reaction mixture at 340 nm, corresponding to the

absorp-tion maximum of NADPH, at the start of the reacabsorp-tion

(t = 0) and after 10 min To subtract protein absorption at

this wavelength, we used a reference reaction sample

with-out NADPH NADPH consumption (i.e the amount

of NADPH consumed during the reaction) was

sub-sequently determined by using the Lambert–Beer law

Product formation was determined as described above by

stopping the reaction with chloroform after 10 min and

subsequently separating the extracted steroids via HPLC

Product quantification was performed as described before

NADPH consumption values were subsequently correlated

with the amount of product formed to provide coupling

values expressed in percent (i.e amount of product

Optical biosensor measurements

complexes was assayed on a Biacore 3000 system (Biacore,

Uppsala, Sweden), using the optical biosensor method

described previously [39] with slight modifications

After activation of the CM5 chip with

N-hydroxysuccini-mide, 75 lL of a 200 lm Adx solution was injected with a

was completed by injecting 1 m ethanolamine hydrochloride

400 response units of Adx were immobilized on the dextran

matrix Binding of hCYP11B1 or bCYP11B1 was analyzed

after injection of solutions with varying concentrations in

the range 10–500 nm Each concentration was injected at

least three times To visualize unspecific background

inter-actions between the dextran matrix and CYP11B1, a

refer-ence cell was created To remove the bound CYP11B1,

were determined using the software biaeval, version 3.1

Averaged binding curves for the interaction between Adx

and varying CYP11B1 concentrations were fitted

simulta-neously using different binding models available in the

eval-uation software (e.g 1 : 1 Languimir-binding or a bivalent

binding model as at least two possible interaction sites for

the fit with the lowest standard deviation

Kinetics by rapid mixing

Stopped flow measurements were carried out on a SFM 300

cuvette and a MPS 60 data-processing unit (Biologic SAS,

by incubation of the stopped-flow device for 20 min with

argon-bubbled buffer containing 5 mm dithionite followed

by repeated flushing with excessively Ar-bubbled reaction

buffer to remove oxygen and remaining dithionite from the system All samples were prepared in a glove box in an oxy-gen-free atmosphere The reaction buffer applied for all mea-surements was a 50 mm Hepes buffer (pH 7.4) containing 0.05% Tween 20 [39]

To follow the reduction of cytochrome CYP11B1 by AdR-reduced Adx, the absorption changes were monitored

at 450 nm, which corresponds to the formation of the ferrous–carbon monoxide complex [40–43] as previously described for measurements carried out with CYP11A1 [29,39] Prior to mixing, syringe A contained CYP11B1 (2 lm) whereas syringe B was filled with NADPH (200 lm), AdR (2 lm) and varying concentrations of Adx in the range 0.5–32 lm The mixture in syringe B was allowed to age for 5 min to assure complete reduction of Adx The solutions in the two syringes were saturated with CO prior

to loading into the driving syringes All resulting curves were evaluated using sigmaplot 2001 Kinetic traces were analyzed using monoexponential or biexponential fits to

plotted against the corresponding Adx concentration and the curve was fitted with a hyperbolic equation to extract

relevant redox states of the reacting proteins

Acknowledgements

This work was supported by a grant from the Fonds der Chemischen Industrie to RB and GM37942 to MRW The authors would like to thank K Neumann,

A Eiden-Plach and W Reinle for their excellent tech-nical support

References

1 Miller WL & Tyrell JB (1995) The adrenal cortex In

Frohman L, eds), pp 555–711 McGraw-Hill Press, New York, NY

2 White PC, Curnow KM & Pascoe L (1994) Disorders

of steroid 11-beta-hydroxylase isozymes Endocr Rev 15, 421–438

3 Mornet E, Dupont J, Vitek A & White PC (1989) Char-acterization of two genes encoding human steroid 11 beta-hydroxylase (P-450(11) beta) J Biol Chem 264, 20961–20967

4 Kawamoto T, Mitsuuchi Y, Toda K, Miyahara K, Yo-koyama Y, Nakao K, Hosoda K, Yamamoto Y, Imura

H & Shizuta Y (1990) Cloning of cDNA and genomic DNA for human cytochrome P-45011 beta FEBS Lett

269, 345–349

5 Zachmann M, Tassinari D & Prader A (1983) Clinical and biochemical variability of congenital