Báo cáo khoa học: Altered expression of tumor protein D52 regulates apoptosis and migration of prostate cancer cells potx

In the present study, we inves-tigated the response of the LNCaP human prostate carcinoma cell line to deregulation of TPD52 expression.. Transfection of LNCaP cells with a specific small

apoptosis and migration of prostate cancer cells

Ramesh Ummanni1, Steffen Teller1, Heike Junker1, Uwe Zimmermann2, Simone Venz1, Christian Scharf3, Ju¨rgen Giebel4and Reinhard Walther1

1 Department of Medical Biochemistry and Molecular Biology, University of Greifswald, Germany

2 Department of Urology, University of Greifswald, Germany

3 Department of Otorhinolaryngology, Head and Neck Surgery, University of Greifswald, Germany

4 Department of Anatomy and Cell Biology, University of Greifswald, Germany

Prostate carcinoma (PCA) is the most common cancer

among men In 2002, an estimated 48 650 German

men were diagnosed with this disease and 11 839 died

from PCA (http://www.rki.de) Autopsy studies have

revealed that approximately 30% of men over the age

of 50 years have microscopic evidence of prostate cancer [1] In the sequence of molecular events playing

an important role in prostate cancer progression, genetic alterations such as the gain or loss of chromo-some 8 at 8q21 comprise important aberrations leading

Keywords

apoptosis; cell migration; cell proliferation;

prostate carcinoma; TPD52

Correspondence

R Walther, Department of Medical

Biochemistry and Molecular Biology,

University of Greifswald,

F.-Sauerbruchstraße, D-17487 Greifswald,

Germany

Fax: +49 3834 865402

Tel: +49 3834 865400

E-mail: rwalther@uni-greifswald.de

(Received 13 August 2008, revised 16

September 2008, accepted 22 September

2008)

doi:10.1111/j.1742-4658.2008.06697.x

Tumor protein D52 (TPD52) is a protein found to be overexpressed in prostate and breast cancer due to gene amplification However, its physio-logical function remains under investigation In the present study, we inves-tigated the response of the LNCaP human prostate carcinoma cell line to deregulation of TPD52 expression Proteomic analysis of prostate biopsies showed TPD52 overexpression at the protein level, whereas its transcrip-tional upregulation was demonstrated by real-time PCR Transfection of LNCaP cells with a specific small hairpin RNA giving efficient knockdown

of TPD52 resulted in significant cell death of the carcinoma LNCaP cells

As demonstrated by activation of caspases (caspase-3 and -9), and by the loss of mitochondrial membrane potential, cell death occurs due to apopto-sis The disruption of the mitochondrial membrane potential indicates that TPD52 acts upstream of the mitochondrial apoptotic reaction To study the effect of TPD52 expression on cell proliferation, LNCaP cells were either transfected with enhanced green fluorescence protein-TPD52 or a specific small hairpin RNA Enhanced green fluorescence protein-TPD52 overexpressing cells showed an increased proliferation rate, whereas TPD52-depleted cells showed the reverse effect Additionally, we demon-strate that exogenous expression of TPD52 promotes cell migration via avb3 integrin in prostate cancer cells through activation of the protein kinase B⁄ Akt signaling pathway From these results, we conclude that TPD52 plays an important role in various molecular events, particularly in the morphological diversification and dissemination of prostate carcinoma cells, and may be a promising target with respect to developing new thera-peutic strategies to treat prostate cancer

Abbreviations

2DE, 2D gel electrophoresis; DHT, dihydroxytestosterone; DIOC6, dihexyloxacarbocyanine iodide; EGFP, enhanced green fluorescence protein; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide; PCA, prostate carcinoma; PI, propidium iodide; PKB ⁄ Akt, protein kinase B; shRNA, small hairpin RNA; TPD52, tumor protein D52.

to prostate cancer [2,3] cDNA library analysis has

revealed the differential expression of a gene that was

further assigned as TPD52 and its locus has been

mapped on chromosome 8q21 [4,5] Its encoding gene

is also referred to as PrLZ and is a member of the

tumor protein D52 (TPD52) gene⁄ protein family and

is designated a proto-oncogene [6] TPD52 is

over-expressed in breast cancer [7,8] prostate cancer [9,10]

as well as ovarian cancer [11] due to gene

amplifica-tion The identification of TPD52 as a tumor

associ-ated antigen in breast cancer patients highlights its role

as a gene amplification target [12] One study on

TPD52 gene characterization reported that epithelial

cells express TPD52 predominantly and that it may

play a role in the development of the epithelial cell

phenotype [13] Its expression is controlled by

gens in LNCaP cells [9] The major circulating

andro-gen, testosterone, interacts with the androgen receptor

to control cellular processes such as proliferation,

apoptosis and other metabolic events in prostate

cancer [14] Taken together, a combination of gene

amplification and androgen stimulation may cause

overexpression of TPD52 in prostate cancer TPD52

undergoes post-translational modification (e.g

phos-phorylation) and interacts with annexinVI and MAL2

in a calcium dependent manner [15–18] Murine

TPD52 induces tumorigenesis and metastasis of

NIH3T3 fibroblasts [19] Recent studies have

demon-strated that the PrLZ gene is reactivated and its

expression increases with cancer progression from

pri-mary to tumor metastasis [20] and that it activates the

protein kinase B (PKB⁄ Akt) pathway, which plays an

important role in prostate cancer development and

progression [21] Because the precise mechanism of the

function of TPD52 in prostate cancer progression is

still under investigation, the main objective of the

pres-ent study was the functional characterization of

TPD52 alterations in the androgen responsive prostate

cancer cell line LNCaP The effect of TPD52

expres-sion on different cellular events was examined to

deter-mine the role of TPD52 expression in prostate cancer

Results

A protein profiling study on prostate biopsies

identi-fied differentially expressed proteins in cancer

contain-ing several proteins that are known to be dysregulated

in prostate cancer [22] Among them, we identified

TPD52 as being overexpressed in PCA compared to

benign prostate epithelium (Fig 1A) To determine

whether TPD52 is also overexpressed at the

transcrip-tional level, TPD52 mRNA was estimated by

quantita-tive real-time PCR from RNA isolated from the same

biopsies used for proteomic analysis RPLP0 was used

as a house keeping gene to normalize expression levels (Fig 1B) Real-time PCR data have shown a signifi-cant increase (Fig 1C, box plots) of the amount of TPD52 mRNA in PCA compared to benign prostatic hyperplasia, suggesting that upregulated protein expression in PCA is caused by an enhanced transcrip-tion rate

To assess the physiological effects of TPD52 expres-sion on prostate cancer progresexpres-sion, enhanced green fluorescence protein (EGFP)-TPD52 fusion protein producing constructs were generated and expression of the fusion protein in LNCaP cells was estimated by fluorescence microscopy (Fig 2A) and western blotting

TPD52 TPD52

0.0 2.5 5.0 7.5 10.0

BPH

(n = 8)

PCA

(n = 12)

P < 0.0229

0 2.5 5 7.5 10

A

B

C

Fig 1 TPD52 is overexpressed in prostate cancer (A) Enlarged region of SYPRO  Ruby stained 2DE gel images indicating tumor protein D52 (TPD52) upregulation in PCA (right panel) and benign prostatic hyperplasia (BPH) (left panel) (B) Quantitative reverse transcription PCR of TPD52 transcripts shown from benign prostate tissue (white bars, n = 8) and localized prostate cancer (black bars,

n = 12) (C) The ratio of PHB expression was normalized against RPLP0 expression and this is graphically presented by box plots with 95% confidence intervals (nonparametric two-tailed Mann– Whitney test performed at 95% confidence interval, P < 0.0229).

(Fig 2B) using anti-EFGP serum On the other hand,

co-transfection (1 : 10 ratio) of pSUPER.neo-gfp

vector expressing small hairpin RNA (shRNA)

designed to downregulate TPD52 and recombinant

psiCHECK-2-TPD52 vector followed by luciferase

assays confirmed the specificity of shRNA against the

TPD52 transcript (data not shown) Transfection of

pSUPER.neo-gfp vector expressing shRNA in

EGFP-TPD52 positive cells confirmed the downregulation of

TPD52 by up to 40% at the transcriptional level after

24 h (Fig 2C,D) A significant downregulation was

observed at the protein level, as confirmed by western

blotting (Fig 2E) with anti-EGFP serum and

densito-metric quantification Corresponding bands revealed a

reduced expression of EGFP-TPD52 down to 40% of

the control level (Fig 2F) No significant difference

was observed between nontransfected and mock

trans-fected cells

Dysregulation of TPD52 affects the proliferation

rate of LNCaP cells

First, we studied whether overexpression or

downregu-lation of TPD52 influences the proliferation rate of

LNCaP cells To determine the effect of TPD52

expression on cell proliferation,

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assays were performed after overexpression or downregula-tion of TPD52 in LNCaP cells MTT assays showed a significantly increased proliferation of the PCA cell line LNCaP after transient overexpression of EGFP-TPD52 (Fig 3A) The proliferation of these cells was 20% higher than the proliferation of EGFP-transfected control cells 48 h after transfection Dihydroxytestos-terone (DHT) was used as a control in MTT assays

On the other hand, downregulation of TPD52 leads to decreased cell proliferation, an effect that could be suppressed to a certain extent when growth medium was supplemented with 1 mm DHT (Fig 3B)

Silencing of TPD52 by shRNA leads to apoptosis

in LNCaP cells Considering that proliferation and migration has been affected by overexpressed TPD52, we next studied whether downregulation of TPD52 by RNA interfer-ence leads to apoptosis through the activation of cas-pase cascade in LNCaP cells Cell death was analysed

by flow cytometry Propidium iodide (PI) was applied

to LNCaP cells depleted for TPD52 expression to mea-sure cell death Based on the results of flow cytometry,

we observed approximately 36% cell death in TPD52

Mock C 12 h 24 h 36 h 48 h 72 h 96 h

0.0

0.5

1.0

1.5

Time (h)

Lane 1 Lane 2 Lane 3 0

50 100 150

M

EGFP TPD52

EGFP

24 h 48 h 72 h 96 h 120 h

Mock C

TPD52

RPLP0

EGFP-TPD52

GAPDH

+

+ + + – –

– – pSuper

pSuper-shRNA

Fig 2 Dysregulation of TPD52 expression in androgen dependant prostate cancer cells (LNCaP) (A) LNCaP cells transfected with either EGFP (left panel) or EGFP-TPD52 (right panel) fusion protein producing recombinant vector and, 24 h posttransfection, cells were observed under a microscope for expression of fusion protein (B) Confirmation of expression of EGFP-TPD52 by western blotting with anti-EGFP serum (C) Downregulation of TPD52 by shRNA For the kinetics of TPD52 knockdown, mRNA expression was assessed by semiquantitative RT-PCR and (D) quantitative real-time PCR after LNCaP cells were transfected with either specific shRNA producing or mock vector and incubated for the indicated times; the results are the mean ± SD of two experiments (E) Western blotting for EGFP-TPD52 knockdown EGFP-TPD52 positive LNCaP cells were transfected with shRNA or control vector and incubated for 24 h Total protein (30 lg) was separated by 12% SDS ⁄ PAGE and detected with anti-EGFP serum Lane 1, EGFP-TPD52 positive cells; lane 2, EGFP-TPD52 positive cells transfected with control; lane 3, EGFP-TPD52 positive cells transfected with specific shRNA Only a representative blot is shown here (F) Quantification of western blot signals showing 40% of downregulation; the results are the mean ± SD of three experiments.

depleted LNCaP cells after 48 h of post-transfection of

shRNA compared to mock transfected cells showing

approximately 7% cell death (Fig 4A–D) To obtain

further insight into the mechanisms by which TPD52

downregulation induces cell death, we determined the

involvement of caspase activation and mitochondria

membrane depolarization In many cell types,

activa-tion of procaspase-3 is a distinguishing feature of

apoptotic cell death Thus, we first examined whether

caspase-3 is activated after downregulation of TPD52

(Fig 4E) We observed a 3.5-fold activation of

cas-pase-3 in TPD52 knockdown LNCaP cells compared

to mock transfected cells (P£ 0.0008) To obtain

fur-ther information on the apoptosis signaling triggered

by TPD52 downregulation, we next examined

caspase-9 activation in TPD52 depleted LNCaP cells (Fig 4F) After shRNA mediated knockdown of TPD52 in LNCaP cells, caspase-9 is activated by 1.6-fold com-pared to control cells (P£ 0.0213) Additionally, we examined the effect of TPD52 depletion on mitochon-drial membrane depolarization by determining mito-chondrial transmembrane potential (Dwm) 48 h after TPD52 downregulation in LNCaP cells (Fig 4G) In 30% of the TPD52 knockdown cells, a significant decrease of Dwm (P£ 0.0013) could be observed, whereas nontransfected or mock transfected cells were less than 10% of the total cells, suggesting that the depolarization of the mitochondrial membrane leads to cytochrome c release, which in turn activates caspase-9

to initiate apoptosis The activation of caspases-3 and -9 taken together with the loss of mitochondrial membrane potential suggests that downregulation of TPD52 leads to activation of the intrinsic pathway to initiate apoptosis in LNCaP cells

Influence of TPD52 overexpression on LNCaP cell migration

Furthermore, we analyzed whether overexpression of EGFP-TPD52 fusion protein affects LNCaP cell migration Haptotactic cell migration assays with vitronectin and collagen type I demonstrated that overexpression of EGFP-TPD52 stimulates specifically avb3-mediated LNCaP cell migration on vitronectin (P£ 0.0029; Fig 5A) but not integrin b1-mediated cell migration on collagen type I (Fig 5B) The observed effects could not be confirmed in EGFP-TPD52 expressing MCF-7 cells (data not shown) To investi-gate whether the activation of PKB⁄ Akt pathway is involved, EGFP-TPD52 or EGFP expressing LNCaP cells were allowed to attach to vitronectin coated plates After intervals of 2 and 4 h, the amount of phosphorylated PKB⁄ Akt (Ser473) was analyzed We observed a significantly increased phosphorylation of PKB⁄ Akt in EGFP-TPD52 expressing cells compared

to EGFP expressing cells after 4 h of incubation on vitronectin (Fig 5C) To confirm the involvement of the Akt pathway in TPD52 induced cell migration towards vitronectin, a cell migration assay in the presence of inhibitor for PI3-kinase, which acts upstream of Akt phosphorylation, revealed no signifi-cant increase in migration (Fig 5D)

Discussion Subsequent to the latest advances for early diagnosis and new therapeutics for efficient treatment options,

0.00

0.25

0.50

0.75

*

*

pEGFP

pEGFP-TPD52

DHT

0.0

0.1

0.2

0.3

0.4

*

*

Mock

shRNA(204)

DHT

A

B

Fig 3 Influence of TPD52 overexpression on the proliferation of

the PCA cell line LNCaP (A) Cell proliferation after overexpression

of TPD52 and (B) cell proliferation after downregulation of TPD52.

Viability of cells was measured in a colorimetric MTT assay by the

detection of formazan formation The proliferation of control cells

transfected with EGFP was set at 100% The results are the

mean ± SD of four independent experiments; DHT was used as a

control for the proliferation of LNCaP cells.

Mock +

–

–

+ – +

– + –

– – –

– – + Taxol

shRNA(204)

– – +

**

*

0

1

2

3

4

5

– –

+ – +

– + –

– – –

– – + Taxol

shRNA(204) 0 1 2 3

– –

+ – +

– + –

– – – Taxol

shRNA(204)

0 20 40 60

6.93% cells M1

PI

PI

M1

26% cells

PI

M1

36% cells

PI

M1

Fig 4 Downregulation of TPD52 induces cell death in LNCaP cells Cells were transfected with specific shRNA or control using Lipofecta-mine 2000 and cell death was measured by PI staining using fluorescence activated cell sorting analysis at the indicated time points (A) Mock transfected cells (B) Cells transfected with specific shRNA after (C) 24 h and (D) 48 h (D) Overlay of (A) and (C) TPD52 downre-gulation activates caspase activity and increases the loss of mitochondrial membrane potential (E, F) Showing the relative caspase-3 and -9 activities, respectively, as the ratio of mock transfected cells to shRNA transfected cells after 48 h Taxol was used as a control for activa-tion of caspases (G) Effect of TPD52 downregulaactiva-tion on mitochondrial membrane potential dissipaactiva-tion assessed by cytofluorimetric analysis

of DIOC6; columns indicate the mean ± SD of three independent experiments performed in triplicate.

Akt pAkt

EGFP-TPD52

Vitronectin

**

0 250 500 750 1000 1250

EGFP

TPD52

0 250 500 750 1000

Vitronectin

**

TPD52

EGFP

TPD52 +

LY, 294,002

Collagen-1

0 50 100 150

Fig 5 Overexpression of TPD52 stimulates cell migration LNCaP cells transiently transfected with EGFP-TPD52 or EGFP as a control were analysed by haptotactic cell migration toward vitronectin (A) and collagen type I (B) The data represent the results obtained from three inde-pendent experiments performed in triplicate and are given as the mean ± SD (C) Adhesion of EGFP-TPD52-LNCaP cells to vitronectin increases PKB⁄ AKT (Ser473) phosphorylation EGFP or EGFP-TPD52 positive LNCaP cells starved in serum free medium for 24 h were har-vested and seeded on vitronectin coated dishes at 37 C for the indicated time intervals The total protein of harvested cells (20 lg per lane) was separated by 12% SDS ⁄ PAGE Phosphorylation of PKB ⁄ AKT was detected by polyclonal phospho-AKT (Ser473) antibodies and loading control PKB ⁄ AKT was detected by polyclonal AKT antibodies (D) The influence of TPD52 on LNCaP cell migration analysed in the presence

of PI3 kinase inhibitor LY, 294,002 The results indicate that there is no significant increase in the migration of EGFP-TPD52 overexpressing cells in the presence of inhibitor.

the mortality rate of prostate cancer has been

decreased significantly In spite of all new treatment

strategies to increase survival, PCA is the most

com-mon type of cancer found in men in Western countries

and is the leading cancer death, next to lung and

colo-rectal cancer In the present study, we demonstrate the

physiological consequences of TPD52 expression in the

androgen responsive prostate cancer cell line LNCaP

It is an oncogene overexpressed in prostate, breast and

ovarian cancer, as demonstrated by DNA microarray

analysis and high density tissue microarrays Its

over-expression due to gene amplification was confirmed by

array comparative genomic hybridization, single

nucle-otide polymorphism arrays and fluoresecemce in situ

hybridization analysis to measure gene copy number

on clinically localized prostate cancer specimens

[4,9,10,23] Expression of recombinant TPD52 in acini

of rat pancreas stimulates amylase secretion [24] As

reported previously, the results from our proteomic

analysis aiming to define the protein signature of

pros-tate cancer biopsies revealed the overexpression of

TPD52 in cancer patient material [22] To date, the

main physiological role of TPD52 in prostate cancer

progression remains under investigation In a recent

study, Wang et al [20] found that TPD52 expression

increases with age and undergoes translocation during

development from early to adult tissues

The expression of TPD52 proteins is linked with cell

proliferation in different cancer cell types This is

high-lighted by reports that the expression of TPD52 in

neuroepithelial cells by retroviral transduction

indi-cated its role in cell proliferation [5,25] The presence

of androgen response elements in the promoter region

of TPD52 gene indicates that the expression of TPD52

is controlled by androgens [14] Testosterone as the

major circulating androgen can trigger an androgen

receptor response, which in turn activates various

genes for transcription in the nucleus [26] TPD52

expression at both the transcriptional and translational

levels is positively regulated by estradiol in breast

can-cer cells [5] and androgens in prostate cancan-cer cells

[9,10,14,27] From the present study, we noted that

dysregulation of TPD52 expression slightly altered the

proliferation of LNCaP cells

A common molecular strategy used by tumor cells

to evade apoptosis is the upregulation of

anti-apopto-tic proteins or the downregulation of pro-apoptoanti-apopto-tic

proteins Human D53L1, another member of the

TPD52 family, interacts with apoptosis signal

regulat-ing kinase 1 and promotes apoptosis [28] Gene

silenc-ing by antisense oligonucleotides or RNA interference

technology comprise useful tools to validate candidate

proteins [29,30] We found that TPD52 knockdown in

LNCaP cells is accompanied by enhanced cell death This was further confirmed by apoptosis using differ-ent methods, such as measuremdiffer-ent of caspase activity and loss of mitochondrial membrane potential In summary, it is suggested that TPD52 acts upstream of the mitochondria related apoptosis However, the exact mechanism by which TPD52 influences apoptosis needs to be investigated in detail

It has been proposed that cancer arises due to several molecular events leading to transformation of normal to tumor cells, with further progression to metastasis, including cell migration into the surround-ing tissue, survival and proliferation in the host tissue [31] The expression of several genes, such as CARD10 [32] and Vav3 [33], and integrins is important in deter-mining the formation of metastatic cells [34,35] The expression of murine TPD52 in NIH3T3 cells induces the expression of several genes involved in the promo-tion of metastasis and the genes responsible for pre-vention of metastasis were downregulated [19] From our cell migration assays, we found that overexpres-sion of TPD52 in LNCaP cells promotes cell migration towards vitronectin Integrins are transmembrane receptors composed of a and b subunits To date, 24 different integrins with different combinations of 8 a and 18 b subunits are known [36] Integrins bind to different extracellular matrix proteins and control functions such as adhesion, migration, differentiation, proliferation, survival and motility [37] Usually, inte-grins avb3 and avb5 are involved in cell migration and attachment to the extracellular matrix proteins: vitro-nectin, fibrovitro-nectin, fibrinogen, laminin, osteopontin, amongst others [38] Vitronectin can bind to avb5 and avb3 integrin receptors The expression of avb3 in LNCaP is controversial Zheng et al [39] noted that LNCaP cells did not express avb3 Witkowski et al [40] and Chatterjee et al [41] reported the expression

of both avb3 integrins in LNCaP cells In addition to these reports, Putz et al [42] reported four prostate cancer cell lines that were derived from bone marrow expressing av and b3 integrin subunits The MCF-7 cells chosen lack avb3-integrin expression, making it possible to demonstrate that overexpression of TPD52

is involved in avb3-mediated cell attachment to vitro-nectin [43,44] Previously, it was been shown that avb3 mediated cell migration and adhesion of LNCaP cells

to vitronectin activates the Akt⁄ PI3 kinase pathway via phosphorylation of Akt at Ser473 [39] The results obtained in the present study show that TPD52 expres-sion activates the Akt⁄ PI3 kinase pathway This sup-ports the idea of the activation of the avb3 signalling pathway in TPD52 induced cell migration In the avb3 signalling pathway, ligation of avb3 with multiple

ligands activates FAK, which interacts and activates

PI3 kinase The PI3 kinase activates PKB⁄ Akt by

phosphorylation and activated PKB phosphorylates

several substrates to control various biological

pro-cesses, such as cell migration, adhesion, survival and

proliferation [21] A very recent study reported that

expression of PrLZ activates the PKB⁄ Akt signalling

pathway in prostate cancer cells [45] The C-terminal

domain of the PrLZ gene product shares homology

with TPD52 Therefore we speculate that TPD family

proteins may activate Akt via activation of integrins

Taken together, migration studies confirm the

involve-ment of avb3 integrin in TPD52 mediated migration

of LNCaP cells towards vitronectin Similar to breast

cancer cells, prostate cancer cells metastasize to the

bone, which consists of extracellular matrix proteins

specific to avb3 [21,46] TPD52 involvement in avb3

mediated cell migration may play a role bone

metas-tasis of prostate cancer patients

In conclusion, it appears that TPD52 is involved in

different molecular processes, such as the regulation of

apoptosis and proliferation Its association with cell

migration suggests a role in tumor dissemination

Because the PKB⁄ Akt pathway is the central pathway

involved in prostate cancer progression, activation of

PKB⁄ Akt by its phosphorylation is a possible

mech-nism of cell survival and migration that is controlled

by TPD52 Taken together, TPD52 may be a potential

and valid target to improve therapeutic strategies for

better treatment

Experimental procedures

Clinical samples collection

Tissue samples and patient data were obtained after

informed consent The study was approved by the local

eth-ics committee of the University of Greifswald and carried

out in accordance with the declaration of Helsinki

Ultra-sound guided biopsies were taken from each patient and

biopsies were investigated histopathologically by two

expe-rienced pathologists

Preparation of protein/RNA extracts

Approximately 6–10 mg of prostate biopsies was

homoge-nized in 0.5 mL of Trizol reagent (Invitrogen, Karlsruhe,

Germany) in a bead mill (Sartorius, Go¨ttingen, Germany)

Total protein and total RNA was isolated according to the

protocols recommended by the supplier (Invitrogen) for

Trizol reagent Protein pellets were vacuum dried,

resus-pended directly in lysis buffer [8 m urea (Sigma-Aldrich,

Munich, Germany); 2 m thiourea (Sigma-Aldrich, Munich,

Germany); 4% Chaps (Roth Chemicals, Karlsruhe, Ger-many); 40 mm Tris base (Roth Chemicals) containing

65 mm dithiothreitol (Roth Chemicals)] and stored at )80 C until use The protein concentration of the extracts was determined by a modified Bradford assay [47] Total RNA was stored at)20 C

2D gel electrophoresis (2DE), imaging, analysis and MS

2DE was performed as described previously by Ummanni

et al [22] Briefly, to prepare samples for analytical 2DE,

150 lg of protein sample of each patient were made up to

450 lL with rehydration buffer [8 m urea, 2 m thiourea, 2% Chaps, 50 mm dithiothreitol with 0.5% v⁄ v IPG buffer,

pH 4–7 (GE Healthcare, Uppsala, Sweden)] and used to passively rehydrate each IPG strip overnight For prepara-tive 2DE, 650 lg of protein sample pooled from equal amount of protein isolated from PCA biopsies were used The analytical gels were stained with SYPRORuby pro-tein gel stain (Bio-Rad, Mu¨nchen, Germany) Preparative gels were stained with colloidal coomassie brilliant blue stain (Roth Chemicals) SYPRORuby stained gel images were scanned at 100 lm resolution using a FS-700 molecu-lar dynamics laser densitometer (Bio-Rad) and pdquest software, version 7.3.3 Basic (Bio-Rad) Image analysis was carried out with the pdquest 2D analysis software package, version 7.4 (Bio-Rad) and changes in expression level were restricted to being greater than 1.5-fold Protein identifica-tion was performed as described previously [22,48]

Measurements of TPD52 gene transcripts by quantitative real-time PCR

Quantitative real-time PCR for TPD52 expression was per-formed using the SYBR Green kit (Eppendorf, Hamburg, Germany) as described previously [22] Briefly, RNA was isolated from the same biopsies used for proteome analysis using Trizolreagent (Invitrogen) according to the manu-facturers’ protocol and RNA quality was assessed by 1.0% agarose formaldehyde gel electrophoresis cDNA was pre-pared by reverse transcription of 1 lg of total RNA using oligo dT primer (15mer) and M-MLV reverse transcriptase (Promega Corp., Madison, WI, USA) Primer pairs were designed using the oligo direct programme (Invitrogen) and synthesized by Invitrogen The sequences for TPD52 and RPLP0 (house keeping gene) are: TPD52 sense: 5¢-GAGG AAGGAGAAGATGTTGC-3¢, TPD52 antisense: 5¢-GCC GAATTCAAGACTTCTCC-3¢, RPLP0 sense: 5¢-TTGTGT TCACCAAGGAGGAC-3¢, RPLP0 antisense: 5¢-GACTC TTCCTTGGCTTCAAC-3¢

Primer sets were used to generate a single amplicon of the desired size evaluated by agarose gel electrophoresis Quantitative real-time PCR was performed in the

Master-cycler ep realplex (Eppendorf) with optimized thermal

cycles using the SYBR Green kit (Eppendorf) At the end

of the PCR, samples were subjected to a melting analysis to

confirm the specificity of the amplicon To obtain statistical

significance, the data obtained were analysed by a

nonpara-metric two-tailed Mann–Whitney U-test performed at 95%

confidence interval

Cell culture

The PCA cell line LNCaP was purchased from DSMZ

(Braunschweig, Germany) and maintained in RPMI1640

(Invitrogen) supplemented with 10% fetal bovine serum,

100 unitsÆmL)1penicillin and streptomycin, glucose, sodium

pyruvate, sodium bicarbonate and Hepes Cells were grown

in an incubator at 37C with a constant supply of 5% CO2

and split after reaching 85–90% confluence Cells were

regularly tested for mycoplasma contamination using the

MycoAlert Mycoplasma Detection Kit (Cambrex Bio

Science Rockland, Inc., Rockland, ME, USA)

Overexpression of EGFP-TPD52 fusion protein

An EGFP-TPD52 fusion protein expressing recombinant

vector was generated by cloning the coding region of the

human TPD52 (Accession number NM 001001875) cDNA

derived from LNCaP cells into the vector pEGFP-N3

(Clon-tech, Palo Alto, CA, USA) The cDNA was prepared by

reverse transcription of 1 lg of total RNA from LNCaP

cells using oligo dT primer (15mer) and M-MLV reverse

transcriptase (Promega Corp.) A specific primer pair was

designed using oligo direct programme (Invitrogen) and

syn-thesized by Invitrogen TPD52 cDNA was generated by PCR

using Pwo DNA Polymerase (Peqlab, Erlangen, Germany)

The sense primer (5¢-GCTACTCGAGCCATGGACCG

CGGCGAGCAAGGT-3¢) contains a recognition site

(underlined) for the restriction enzyme XhoI The antisense

primer (5¢-CACTTGGTACCCAGGCTCTCCTGTGTCTT

TTC-3¢) contains a site for KpnI (underlined) Insertion of

the XhoI⁄ KpnI digested PCR product into the XhoI ⁄ KpnI

restriction sites of the vector resulted in a C-terminal fusion

of TPD52 to EGFP The sequence of the cloned PCR

fragment was confirmed by DNA sequencing (Seqlab,

Go¨ttingen, Germany)

Downregulation of TPD52

To downregulate TPD52 in LNCaP cells, we designed

dif-ferent shRNA pairs directed against three splice variants of

TPD52 using oligoengine programme and synthesized by

Invitrogen shRNA oligos were annealed in annealing

buffer by heating the mixture at 95C for 5 min followed

by slowly cooling down to room temperature Annealed

oli-gos were phosphorylated by T4 polynucleotide kinase in the

presence of ATP and cloned into pSUPER.neo-gfp vector

(Oligoengine RNA interference) between the BglII and Hin-dIII restriction sites The shRNA expressing vectors were screened for their antisense activity using recombinant psi-CHECK2-TPD52 vector Co-transfection of two vectors into LNCaP cells and luciferase assay after 24 h revealed that the following sequence is more specific for antisense activity than the others: forward, 5¢-GATCCCCGCGGAA ACTTGGAATCAATTTCAAGAGAATTGATTCCAAGT TTCCGCTTTTTA-3¢ and reverse, 5¢-AGCTTAAAAA GCGGAAACTTGGAATCAATTC TCTTGAAATTGAT TCCAAGTTTCCGCGGG-3¢

MTT assay for cell proliferation

The effect of TPD52 overexpression on proliferation of the PCA cell line LNCaP was measured by the MTT (Sigma-Aldrich, St Louis, MO, USA) proliferation assay In brief,

4· 104cells were grown in 24 well plates at 37C ⁄ 5% CO2 for 20 h Cells were then transfected with or EGFP-TPD52 vector by the Lipofectamine 2000 method Twenty-four hours after transfection, MTT solution was added to the wells and cells were incubated for an addi-tional 4 h at 37C ⁄ 5% CO2 After solubilization buffer was added, formazan production was measured at 570 nm

in a spectrophotometer (Novaspec II, Pharmacia, Uppsala, Sweden) Cell proliferation assays were performed with and without DHT (Sigma-Aldrich, Munich, Germany) Cell proliferation values are the mean of three independent experiments, each carried out with triplicate samples For calculation of significance, a t-test was performed using graph pad prism, version 3.0 (GraphPad Software Inc., San Diego, CA, USA)

Cell migration assay

To study the influence of TPD52 on cell migration, a hapo-totactic cell migration test was performed after overexpres-sion of EGFP-TPD52 in LNCaP or MCF-7 cells Haptotactic cell migration assays were performed in Tran-swell chambers (#3422; Costar Inc., Cambridge, MA, USA) according to Zhang et al [45] Porous membranes were coated on the bottom surface with vitronectin (10 lgÆmL)1)

or collagen type I (10 lgÆmL)1) for 1 h at 37C LNCaP

or MCF-7 cells were transfected with EGFP or EGFP-TPD52 expressing vectors using Lipofectamine 2000 (Invitrogen) and grown at 37C ⁄ 5% CO2for 24 h Trans-fected cells were then trypsinized and washed in the pres-ence of soyabean trypsin inhibitor with migration buffer (RPMI 1640, 2 mm CaCl2, 1 mm MgCl2, 0.2 mm MnCl2, 0.5% BSA) Cells were resuspended in migration buffer with or with out PI3 kinase inhibitor LY, 294,002 (Alexis Biochemicals, San Diego, CA, USA) and 1· 105

cells were added onto the top of the membrane and allowed to move through it and bind vitronectin or collagen type I for 6 h at

37C in migration buffer in the lower chamber After

removal of the remaining cells in the upper chamber,

mem-branes were fixed in NaCl⁄ Pi with 4% formaldehyde and

cells were counted using an inverse fluorescence microscope

(IX-70; Olympus, Tokyo, Japan)

PI uptake for cell death

Cell death was analysed with PI uptake Cells were

har-vested, washed with NaCl⁄ Piand fixed in ethanol at)20 C

After centrifugation, cells were resuspended in NaCl⁄ Pi

con-taining glucose, RNase and PI (50 lgÆmL)1), and incubated

for 20 min in the dark at room temperature After washing

with NaCl⁄ Pibuffer, PI uptake was analysed by fluorescence

activated cell sorting (FACS Calibur System; BD

Bio-science, Erembodegem, Belgium) on an FL-2 fluorescence

detector (20 000 events were recorded for each condition)

Flow cytometry data were analysed using winmdi software

(The Scripps Research Institute, La Jolla, CA, USA)

Determination of caspase-3 and -9 activity

Caspase-3 and -9 activities were measured 48 h after

down-regulation of TPD52 using fluorogenic substrates

Ac-DEVD-AFC and LEHD-AFC, respectively Harvested

cells were lysed with caspase lysis buffer (10 mm Tris–HCl,

10 mm sodium phosphate buffer, pH 7.5, 130 mm NaCl,

1% Triton X-100 and 10 mm Na2P2O7) and then incubated

with the respective substrate (25 lgÆmL)1) in 20 mm Hepes

(pH 7.5), 10% glycerol and 2 mm dithiothreitol at 37C

for 2 h The release of AFC was analyzed by fluorimeter

using an excitation⁄ emission wavelength of 390 ⁄ 510 nm

Relative caspase activities were calculated as the ratio of

values between mock transfected and transfected cells

Paclitaxel was used as a positive control

Measurement of mitochondrial transmembrane

potential Dwm

Changes in the mitochondrial potential were detected with

the potential-sensitive probe dihexyloxacarbocyanine iodide

(DIOC6) uptake [49].Dwmwas determined 48 h after

down-regulation of TPD52 TPD52 depleted cells were incubated

with 50 nm DIOC6 (Molecular Probes, Carlsbad, CA,

USA) at 37C for 30 min After washing with NaCl ⁄ Pi,

20 000 cells were analysed by fluorescence activated cell

sorting (FL-1 detector of FACS Calibur System) The

results were analysed by cellquest software (Becton

Dick-inson, Franklin Lakes, NJ, USA)

Western blotting

Cells were lysed in 2DE lysis buffer and the protein

concen-tration was determined by modified Bradford assay Protein

extracts were separated by 12% SDS⁄ PAGE and

electro-phoretically transferred onto nitrocellulose membrane Blocking was carried out in 1· Rotiblock solution (Roth Chemicals) followed by incubating the membrane with pri-mary antibody [mouse anti-(human EGFP); 1 : 2000 (Roche Chemicals); rabbit anti-(human GAPDH) (Roche Chemicals) 1 : 2000 or rabbit anti-(human AKT) or Ser473 phospho AKT 1 : 1000 (Cell Signalling Technology, Frank-furt, Germany)] overnight at 4C Excess antibodies were removed by washing with NaCl–Tris–Tween 20 Incubation with secondary antibody conjugated to horseradish per-oxidase [anti-(mouse IgG) or anti-(rabbit IgG), diluted

1 : 5000 in 1· Rotiblock] was performed for 1 h at room temperature After three washes, the reaction was developed

by the addition of LumiGLO substrate (Cell Signalling Technology) The emitted light was captured on X-ray film

Acknowledgements Ramesh Ummanni was supported by the Alfried-Krupp von Bohlen und Halbach Stiftung, Graduierten-kolleg Tumorbiologie We thank Chithra devi Palani for technical support concerning the caspase activity measurements

References

1 Scardino PT (1989) Early detection of prostate cancer Urol Clin North Am 16, 635–655

2 Macoska JA, Trybus TM, Sakr WA, Wolf MC, Benson

PD, Powell IJ & Pontes JE (1994) Fluorescence in situ hybridization analysis of 8p allelic loss and chromosome

8 instability in human prostate cancer Cancer Res 54, 3824–3830

3 Macoska JA, Trybus TM, Benson PD, Sakr WA, Grignon DJ, Wojno KD, Pietruk T & Powell IJ (1995) Evidence for three tumor suppressor gene loci on chromosome 8p in human prostate cancer Cancer Res

55, 5390–5395

4 Byrne JA, Tomasetto C, Garnier JM, Rouyer N, Mattei

MG, Bellocq JP, Rio MC & Basset P (1995) A screen-ing method to identify genes commonly overexpressed

in carcinomas and the identification of a novel comple-mentary DNA sequence Cancer Res 55, 2896–2903

5 Byrne JA, Mattei MG & Basset P (1996) Definition of the tumor protein D52 (TPD52) gene family through cloning of D52 homologues in human (hD53) and mouse (mD52) Genomics 35, 523–532

6 Rhodes DR, Barrette TR, Rubin MA, Ghosh D & Chinnaiyan AM (2002) Meta-analysis of microarrays: interstudy validation of gene expression profiles reveals pathway dysregulation in prostate cancer Cancer Res

62, 4427–4433

7 Balleine RL, Fejzo MS, Sathasivam P, Basset P, Clarke

CL & Byrne JA (2000) The hD52 (TPD52) gene is a

candidate target gene for events resulting in increased

8q21 copy number in human breast carcinoma Genes

Chromosomes Cancer 29, 48–57

8 Pollack JR, Sorlie T, Perou CM, Rees CA, Jeffrey

SS, Lonning PE, Tibshirani R, Botstein D,

Borresen-Dale AL & Brown PO (2002) Microarray analysis

reveals a major direct role of DNA copy number

alteration in the transcriptional program of human

breast tumors Proc Natl Acad Sci USA 99, 12963–

12968

9 Rubin MA, Varambally S, Beroukhim R, Tomlins SA,

Rhodes DR, Paris PL, Hofer MD, Storz-Schweizer M,

Kuefer R, Fletcher JA et al (2004) Overexpression,

amplification, and androgen regulation of TPD52 in

prostate cancer Cancer Res 64, 3814–3822

10 Wang R, Xu J, Saramaki O, Visakorpi T, Sutherland

WM, Zhou J, Sen B, Lim SD, Mabjeesh N, Amin M

et al.(2004) PrLZ, a novel prostate-specific and

andro-gen-responsive gene of the TPD52 family, amplified in

chromosome 8q21.1 and overexpressed in human

pros-tate cancer Cancer Res 64, 1589–1594

11 Byrne JA, Balleine RL, Schoenberg FM, Mercieca J,

Chiew YE, Livnat Y, St HL, Peters GB, Byth K,

Kar-lan BY et al (2005) Tumor protein D52 (TPD52) is

overexpressed and a gene amplification target in ovarian

cancer Int J Cancer 117, 1049–1054

12 Scanlan MJ & Jager D (2001) Challenges to the

devel-opment of antigen-specific breast cancer vaccines

Breast Cancer Res 3, 95–98

13 Chen SL, Zhang XK, Halverson DO, Byeon MK,

Schweinfest CW, Ferris DK & Bhat NK (1997)

Charac-terization of human N8 protein Oncogene 15, 2577–

2588

14 Nelson PS, Clegg N, Arnold H, Ferguson C, Bonham

M, White J, Hood L & Lin B (2002) The program of

androgen-responsive genes in neoplastic prostate

epithe-lium Proc Natl Acad Sci USA 99, 11890–11895

15 Kaspar KM, Thomas DD, Taft WB, Takeshita E,

Weng N & Groblewski GE (2003) CaM kinase II

regu-lation of CRHSP-28 phosphoryregu-lation in cultured

muco-sal T84 cells Am J Physiol Gastrointest Liver Physiol

285, G1300–G1309

16 Tiacci E, Orvietani PL, Bigerna B, Pucciarini A,

Cor-thals GL, Pettirossi V, Martelli MP, Liso A, Benedetti

R, Pacini R et al (2005) Tumor protein D52 (TPD52):

a novel B-cell⁄ plasma-cell molecule with unique

expres-sion pattern and Ca(2+)-dependent association with

annexin VI Blood 105, 2812–2820

17 Wilson SH, Bailey AM, Nourse CR, Mattei MG &

Byrne JA (2001) Identification of MAL2, a novel

mem-ber of the mal proteolipid family, though interactions

with TPD52-like proteins in the yeast two-hybrid

sys-tem Genomics 76, 81–88

18 Parente JA, Goldenring JR, Petropoulos AC, Hellman

U & Chew CS (1996) Purification, cloning, and

expres-sion of a novel, endogenous, calcium-sensitive, 28-kDa phosphoprotein J Biol Chem 271, 20096–20101

19 Lewis JD, Payton LA, Whitford JG, Byrne JA, Smith

DI, Yang L & Bright RK (2007) Induction of tumori-genesis and metastasis by the murine orthologue of tumor protein D52 Mol Cancer Res 5, 133–144

20 Wang R, Xu J, Mabjeesh N, Zhu G, Zhou J, Amin M,

He D, Marshall FF, Zhau HE & Chung LW (2007) PrLZ is expressed in normal prostate development and

in human prostate cancer progression Clin Cancer Res

13, 6040–6048

21 Hullinger TG, McCauley LK, DeJoode ML & Somer-man MJ (1998) Effect of bone proteins on huSomer-man pros-tate cancer cell lines in vitro Prospros-tate 36, 14–22

22 Ummanni R, Junker H, Zimmermann U, Venz S, Teller

S, Giebel J, Scharf C, Woenckhaus C, Dombrowski F

& Walther R (2008) Prohibitin identified by proteomic analysis of prostate biopsies distinguishes hyperplasia and cancer Cancer Lett 266, 171–185

23 Chen SL, Maroulakou IG, Green JE, Romano-Spica V, Modi W, Lautenberger J & Bhat NK (1996) Isolation and characterization of a novel gene expressed in multi-ple cancers Oncogene 12, 741–751

24 Thomas DD, Taft WB, Kaspar KM & Groblewski GE (2001) CRHSP-28 regulates Ca(2+)-stimulated secre-tion in permeabilized acinar cells J Biol Chem 276, 28866–28872

25 Proux V, Provot S, Felder-Schmittbuhl MP, Laugier D, Calothy G & Marx M (1996) Characterization of a leu-cine zipper-containing protein identified by retroviral insertion in avian neuroretina cells J Biol Chem 271, 30790–30797

26 Ellis JA, Sinclair R & Harrap SB (2002) Androgenetic alopecia: pathogenesis and potential for therapy Expert Rev Mol Med 4, 1–11

27 DePrimo SE, Diehn M, Nelson JB, Reiter RE, Matese

J, Fero M, Tibshirani R, Brown PO & Brooks JD (2002) Transcriptional programs activated by exposure

of human prostate cancer cells to androgen Genome Biol 3, RESEARCH0032

28 Cho S, Ko HM, Kim JM, Lee JA, Park JE, Jang MS, Park SG, Lee DH, Ryu SE & Park BC (2004) Positive regulation of apoptosis signal-regulating kinase 1 by hD53L1 J Biol Chem 279, 16050–16056

29 Dias N & Stein CA (2002) Antisense oligonucleotides: basic concepts and mechanisms Mol Cancer Ther 1, 347–355

30 Brummelkamp TR, Bernards R & Agami R (2002) A system for stable expression of short interfering RNAs

in mammalian cells Science 296, 550–553

31 Hanahan D & Weinberg RA (2000) The hallmarks of cancer Cell 100, 57–70

32 Wang L, Guo Y, Huang WJ, Ke X, Poyet JL, Manji

GA, Merriam S, Glucksmann MA, DiStefano PS, Alnemri ES et al (2001) Card10 is a novel caspase