Antibiotic resistant enterococci and staphylococci isolated from flies collected near confined poultry feeding operations potx

We assessed the prevalence of antibiotic resistant enterococci and staphylococci in stored poultry litter and flies collected near broiler chicken houses.. Resistance genes ermB, ermA, m

Antibiotic resistant enterococci and staphylococci isolated from flies collected near confined poultry feeding operations

Jay P Graham⁎, Lance B Price, Sean L Evans, Thaddeus K Graczyk, Ellen K Silbergeld Johns Hopkins Bloomberg School of Public Health, Department of Environmental Health Sciences, Division of Environmental Health Engineering, Baltimore, MD 21205, USA

Article history:

Received 29 July 2008

Received in revised form

17 November 2008

Accepted 25 November 2008

Use of antibiotics as feed additives in poultry production has been linked to the presence of antibiotic resistant bacteria in farm workers, consumer poultry products and the environs of confined poultry operations There are concerns that these resistant bacteria may be transferred to communities near these operations; however, environmental pathways of exposure are not well documented We assessed the prevalence of antibiotic resistant enterococci and staphylococci in stored poultry litter and flies collected near broiler chicken houses Drug resistant enterococci and staphylococci were isolated from flies caught near confined poultry feeding operations in the summer of 2006 Susceptibility testing was conducted on isolates using antibiotics selected on the basis of their importance to human medicine and use in poultry production Resistant isolates were then screened for genetic determinants of antibiotic resistance A total of 142 enterococcal isolates and 144 staphylococcal isolates from both fly and poultry litter samples were identified Resistance genes erm(B), erm(A), msr(C), msr(A/B) and mobile genetic elements associated with the conjugative transposon Tn916, were found in isolates recovered from both poultry litter and flies Erm(B) was the most common resistance gene in enterococci, while erm(A) was the most common in staphylococci We report that flies collected near broiler poultry operations may be involved in the spread of drug resistant bacteria from these operations and may increase the potential for human exposure to drug resistant bacteria

© 2008 Elsevier B.V All rights reserved

Keywords:

Antibiotic resistance

Enterococci

Flies

Poultry litter

Staphylococci

1 Introduction

There is growing public health concern over the contribution of

agricultural antibiotic use to the global rise of drug resistant

bacteria (Erb et al., 2007; Levy and Marshall, 2004) The U.S raises

approximately 8.7 billion broiler chickens annually, resulting in

an estimated 13–26 million metric tons of poultry litter (i.e.,

excreta, feathers, spilled feed, bedding material, soil and dead

birds) (Moore et al., 1995; Paudel et al., 2004) Antibiotics are

permitted as additives to feed or water in the U.S (NRC, 1999) and

it is estimated that nearly 80% of poultry units in the U.S use antibiotics in feed (Silbergeld et al., 2008) Poultry litter has been found to contain large amounts of antibiotic resistant bacteria and resistance genes associated with the use of antibiotics in poultry production (Nandi et al., 2004) This has raised concern for environmental dispersal of antibiotic resistance In this study, we report for the first time that houseflies may also participate in the dispersion of antibiotic resistance from poultry houses into the environment Houseflies have practically unconstrained access to this litter, both through entrance into

Abbreviations: ATCCAmerican Type Culture Collection; CLSIClinical and Laboratory Standards Institute; E.Enterococcus; MICminimum inhibitory concentration; PCRpolymerase chain reaction; ORFopen reading frame; rRNAribosomal ribonucleic acid; S.Staphylococcus

⁎ Corresponding author Johns Hopkins Bloomberg School of Public Health, Department of Environmental Health Sciences, Division of Environmental Health Engineering, 615 N Wolfe St., Room E6642, Baltimore, MD 21205, USA Tel.: +1 443 286 8335; fax: +1 410 955 9334 E-mail address:jgraham@jhsph.edu(J.P Graham)

0048-9697/$– see front matter © 2008 Elsevier B.V All rights reserved

doi:10.1016/j.scitotenv.2008.11.056

a va i l a b l e a t w w w s c i e n c e d i r e c t c o m

w w w e l s e v i e r c o m / l o c a t e / s c i t o t e n v

poultry houses as well as access to poultry waste stored onsite in

open sheds Prior to land application, poultry litter is generally

piled between 1 and 4 m deep and stored in open sheds until it is

applied to land as a soil amendment Populations of houseflies

are known to be significantly increased within distances of up to

7 km away from poultry operations (Winpisinger et al., 2005)

Synanthropic flies have evolved to live in proximity to

humans and have been found to carry a number of different

pathogenic microorganisms, including viruses and bacteria, and

can play an important role in the epidemiology of infections in

humans (Likirdopulos et al., 2005; Macovei and Zurek, 2006;

Nichols, 2005) Flies have been implicated in the spread of a

number of bacterial infections, such as: enteric fever, cholera,

shigellosis, salmonellosis, and campylobacteriosis (Fotedar

et al., 1992; Nichols, 2005) There is recent concern that flies

may also contribute to the spread of avian influenza A study in

Denmark found that as many as 30,000 flies may enter a broiler

facility during a single flock rotation in the summer months

(Hald et al., 2004) In Japan, researchers reported that flies

captured in proximity to broiler facilities during an outbreak of

highly pathogenic avian influenza in Kyoto, Japan in 2004, were

found to carry the same strains of H5N1 influenza virus as found

in the chickens of the infected poultry farm (Sawabe et al., 2006)

The pathway of transfer is likely to occur as flies feed on excreta

and decomposing carcasses, which results in ingestion of the

bacteria or surface contamination of their feet, legs, proboscis,

and wings The flies can then mechanically transmit

micro-organisms through physical contact or may defecate or

regurgitate bacteria from the gut onto food or other fomites

(Nichols, 2005) The quantity and type of microorganisms flies

carry are inextricably linked to the presence of these same

organisms in the excreta and other wastes upon which flies

develop and feed (Nichols, 2005)

The design and operational requirements of large scale

broiler poultry production result in many obstacles to

biocon-tainment (i.e., efforts to limit the dissemination of microbes

from operations) (Graham et al., 2008) Ventilation rates from

these houses are very high, owing to the need to prevent

overheating for the 20–75,000 birds confined to a single house

Further, owing to methods of waste storage at farms, there is a

large amount of fresh and stored poultry litter available outside

the houses, which can serve also as a substrate for development

of fly populations and a readily available source of food

Because antibiotic resistant enterococci and staphylococci

have been isolated from poultry litter (Hayes et al., 2004; Lu

et al., 2003; Simjee et al., 2007), we tested the hypothesis that

flies may transfer these resistant pathogens, as well as

resistance determinants, into the environment of local

com-munities This mode of inter-ecosystem spread has not been

previously investigated

The current study is the first to assess resistance

pheno-types and resistance genes in Enterococcus spp and

Staphylo-coccus spp in both litter and flies collected near U.S confined

poultry feeding operations

Sampling was carried out on the Delmarva Peninsula of the

United States (region comprising parts of Delaware, Maryland,

and Virginia), one of the most heavily concentrated areas of U.S poultry production (Fig 1), producing nearly 600 million chick-ens each year (nearly 7% of U.S production) It is also an area experiencing rapid development and increased human popula-tion density Sussex County, Delaware, where nearly 300 million chickens were produced last year, experienced a 15% increase in its human population between 2000 and 2006 (Delaware Population Consortium, 2002)

2.1 Poultry litter collection

Poultry litter samples were collected from three conventional poultry farms that raised the birds under contract for two major producers Litter samples were collected from three conventional broiler chicken farms over a period of 120 days (collected at Days: 0, 10, 20, 30, 60, 90, 120) in the summer of

2006 The first sampling visit at each farm occurred after the chickens were removed for processing, at which time the houses were decrusted, that is, removing the top 25–50 cm of poultry litter from the poultry house floor This waste material was stored on-site in one large pile between 1 to 3 m high in a two-walled shed with a roof No additional litter was added during the study period, nor were any chemicals added A composite sample of four grab samples (~1 kg) from each litter pile was aseptically collected at each visit and placed in sealed plastic bags for transport in a cooler with ice to the laboratory Samples were analyzed within 24 h of collection All three farmers reported that no recognized disease outbreaks had occurred during the flock cycle such that no therapeutic drug use was applied, but no specific information on antibiotic feed additives was available as this is considered confidential business information by the producers (Graham et al., 2007) Each poultry litter sample was mixed in the sealed plastic bag by vigorously agitating the bag by hand for 1 min Five grams of litter were then placed in 45 ml of 0.1% peptone water

in a sterile 50 ml polypropylene conical tube, and vortexed for

1 min (Islam et al., 2004) The sample was allowed to settle for

15 min Three serial dilutions (1:10) were prepared from each sample using 0.1% peptone water, and 0.1 ml portions of each dilution were plated in triplicate onto standard BBL Enter-ococcosel agar (Becton Dickinson, Cockeysville, MD, USA) and Staphylococcus agar (US Biological, Swampscott, MA, USA) Samples were plated on agar supplemented with antibiotics at break point concentrations described below Samples were incubated for 24 h at 37 °C, and unique black enterococcal and yellow/white staphylococcal colonies were selected Isolates were purified twice on the same medium on which they were isolated All isolates were stored in a 20% glycerol tryptic soy broth at−80 °C until testing for antibiotic susceptibility

2.2 Fly collection and bacterial isolation

Flies were caught using Victor Fly Magnet®Traps at the same time period as when the last poultry litter samples were collected (i.e., day 120) A total of eight fly traps were set in accessible locations within 15–100 m of poultry farms, and placed approximately 2 m off the ground Although the fly traps were not set near the farms where litter samples were collected,

we hypothesized that similar resistance patterns among the fly and litter isolates would be observed The traps were collected

Fig.

36 h after set up, and transported to the laboratory and stored at

4 °C Flies caught in each trap were treated as one composite

sample because of likely contact and mixing, and were analyzed

within 24 h of collection An external wash of the flies was

carried out as follows: flies were placed into a plastic tube with

50 ml of eluting buffer, consisting of 0.1% Tween 80, 0.1% sodium

dodecyl sulfate, 0.001% anti-foam, and phosphate-buffered

saline, and then gently vortexed for 1 min (Graczyk et al.,

1999) One ml of the eluant was then aseptically transferred in a

15 ml plastic tube with 10 ml of tryptic soy broth for a 24 h

enrichment Following this exterior wash, a homogenized

sample of the flies (i.e., internalized bacteria) was made as

follows: flies from each trap were placed together in an

Eppendorf tube (BWR, Piscataway, NJ) with 50 ml of phos-phate-buffered saline and were macerated with a glass rod for 1 min One ml of the homogenate was then enriched

as described above Following the enrichment, 0.1 ml portions of the enriched samples were plated onto standard BBL Enter-ococcosel agar (Becton Dickinson, Cockeysville, MD, USA) and Staphylococcus agar (US Biological, Swampscott, MA, USA)

2.3 Isolation of antibiotic resistant bacteria

Samples of the enrichment media were plated on agar supple-mented with selected antibiotics in order to increase the like-lihood of detecting resistant enterococci and staphylococci

Table 1– List of positive controls and DNA oligonucleotides used as primers in PCR reactions

Genus/species (single/

multiplex PCR)

Positive control

temp (°C)

Product size (bp)

Reference

(2000)

R ATTACTAGCGATTCCGG

E faecalisa ATCC

29212

F TCAAGTACAGTTAGTCTTTATTAG 54 941 Dutka-Malen

et al (1995)

R ACGATTCAAAGCTAACTGAATCAGT

E faeciuma ATCC

19434

F TTGAGGCAGACCAGATTGACG 54 658 Dutka-Malen

et al (1995)

R TATGACAGCGACTCCGATTCC

E casseliflavusa ATCC

49605

et al (2000)

R CGCAGGGACGGTGATTTT

E gallinaruma ATCC

700425

et al (2000)

R CTTCCGCCATCATAGCT Staphylococci F GGCCGTGTTGAACGTGGTCAAATCA 55 370 Morot-Bizot

et al (2004)

R TIACCATTTCAGTACCTTCTGGTAA

S aureus ATCC

43300

F AATCTTTGTCGGTACACGATATTCTTCACG 55 108 Morot-Bizot

et al (2004)

R CGTAATGAGATTTCAGTAGATAATACAACA

S xylosus ATCC

29971

F AACGCGCAACGTGATAAAATTAATG 55 539 Morot-Bizot

et al (2004)

R AACGCGCAACAGCAATTACG

S epidermidis ATCC

49461

F ATCAAAAAGTTGGCGAACCTTTTCA 55 124 Morot-Bizot

et al (2004)

R CAAAAGAGCGTGGAGAAAAGTATCA

S saprophyticus ATCC

49453

F TCAAAAAGTTTTCTAAAAAATTTAC 55 221 Morot-Bizot

et al (2004)

R ACGGGCGTCCACAAAATCAATAGGA

a Multiplex PCR was used for all of the Enterococci primers

Table 2– List of PCR primers used in the amplification of resistance genes in isolates of enterococci and staphylococci

Resistance gene/

determinant

GenBank access no

Direction Primer sequence (5′–3′) Annealing

temp (°C)

Product size (bp)

Reference

erm(A) K02987 F TCAAAGCCTGTCGGAATTGG 52 441 Jensen et al

(2002)

R AAGCGGTAAACCCCTCTGAG erm(B) AF406971 F GAAAAGGTACTCAACCAAATA 52 639 Sutcliffe et al

(1996)

R AGTAACGGTACTTAAATTGTTTAC erm(C) J01755 F ATCTTTGAAATCGGCTCAGG 52 294 Sutcliffe et al

(1996)

R CAAACCCGTATTCCACGATT vat(D) L12033 F GCTCAATAGGACCAGGTGTA 52 271 Soltani et al

(2000)

R TCCAGCTAACATGTATGGCG vat(E) AF139725 F ACTATACCTGACGCAAATGC 52 511 Soltani et al

(2000)

R GGTTCAAATCTTGGTCCG msr(C) AF13494 F TAT AAC AAA CCT GCA AGT TC 55 1,040 McDermott et al

(2005)

R CTT CAA TTA GTC GAT CCA TA msr(A/B) AJ243209 F GCAAATGGTGTAGGTAAGACAACT 55 350 Wondrack et al

(1996)

R ATCATGTGATGTAAACAAAAT int (Tn916/Tn1545) NC006372 F GCGTGATTGTATCTCACT 50 1,046 Macovei and

Zurek (2006)

R GACGCTCCTGTTGCTTCT ORF13 (Tn916) NC006372 F GGCTGTCGCTGTAGGATAGAG 50 589 Macovei and

Zurek (2006)

R GGGTACTTTTAGGGCTTAGT

strains among an expected mix of resistant and susceptible

strains within the litter sample All but one of the following

antibiotics (i.e vancomycin) or similar analogs were selected

based on their reported use in poultry production and added to

agar (concentrations added to enterococcosel and staphylococcus

agar are indicated respectively): ciprofloxacin (2μg/ml, 2 μg/ml),

clindamycin (1μg/ml, 2 μg/ml), tetracycline (8 μg/ml, 8 μg/ml),

vancomycin (16μg/ml, 16 μg/ml), erythromycin (4 μg/ml, 4 μg/ml),

quinupristin-dalfopristin (2μg/ml, 2 μg/ml), penicillin (8 μg/ml, 0.125μg/ml), and gentamicin (500 μg/ml in enterococcosel only) Samples were incubated for 24 h at 37 °C, and representative unique colonies based on colony morphology were selected Isolates were purified and stored as described previously The antibiotic quinupristin-dalfopristin is an analog of virginiamycin,

an antibiotic used in poultry production Both quinupristin-dalfopristin and virginiamycin are in the same class of antibiotics

Table 3– Characteristics of samples of flies and stored poultry litter

Fly

samples

Number

of flies

Distance in meters/

direction from nearest poultry farm

Number of enterococcal isolates characterized

Number of staphylococcal isolates characterized

MDR enterococci

=2 drugs

≥3 drugs

MDR staphylococci

= 2 drugs

≥3 drugs

Poultry litter

samples

Number

of samples

Number of enterococcal isolates characterized

Number of staphylococcal isolates characterized

MDR enterococci

= 2 drugs

≥3 drugs

MDR staphylococci

= 2 drugs

≥3 drugs

Fig 2– Percent of recovered enterococcal isolates phenotypically resistant to antibiotics Multi-drug resistance (MDR) indicates resistance to two or more drugs (cip– ciprofloxacin; clin – clindamycin; ery – erythromycin; pen – penicillin; q-d – quinupristin-dalfopristin; tet– tetracycline; van – vancomycin; MDR – multi-drug resistant)

2.4 Species identification

PCR was used to confirm the identities of the isolates to the

genus level (Table 1) Single PCR and Multiplex PCR were used

to identify four common species of enterococci (E faecium,

E faecalis, E gallinarum, and E casseliflavus) and four common

species of staphylococci (S aureus, S xylosus, S saprophyticus,

and S epidermidis) ATCC strains used as positive controls and

primer sequences are provided inTable 1

2.5 Antibiotic resistance screening

Phenotypic antibiotic resistance was defined by minimal

inhibitory concentrations (MICs) which were determined using

the agar dilution method on Mueller–Hinton agar (Becton

Dickinson, Massachusetts) using Enterococcus faecalis ATCC

29212, Enterococcus faecium ATCC 19434, and Staphylococcus aureus

ATCC 43300 strains according to CLSI guidelines (CLSI, 2005)

The dilution ranges inμg/ml and resistance breakpoints were as

follows (note: breakpoints for enterococci and staphylococci are

the same unless otherwise stated): ciprofloxacin (0.12–8, 4),

clindamycin (0.5–8, 2 for enterococci and 4 for staphylococci),

tetracycline (1–32, 16), vancomycin (0.5–64, 32 for enterococci and

16 for staphylococci), erythromycin (0.13–16, 8),

quinupristin-dalfopristin (0.025–8, 4), penicillin (0.5–32, 16 for enterococci and

0.25 for staphylococci), and gentamicin (500–1000, 500 for

enterococci) For staphylococci, no CLSI breakpoints have been

established for a number of drugs (e.g clindamycin, penicillin or

vancomycin) and breakpoints as described byAarestrup et al

(2000)were used When strains of identical species from the same

farm having similar antibiograms (i.e within two dilutions) were

found, only one isolate was used for the analysis– this was done

to ensure that the same isolate was not counted more than once

2.6 Screening for resistance genes

For each isolate exhibiting phenotypic resistance to

eryth-romycin, quinupristin-dalfopristin, or tetracycline, the

bacteria were harvested and cell walls were digested with lysozyme and proteins were subsequently digested with proteinase k and sodium dodecyl sulfate DNA was isolated using a phenol-chloroform extraction and isopropyl alcohol precipitation method (Sutcliffe et al., 1996) and was quantified using a NanoDrop® ND-1000 UV–Vis Spectrophotometer (Wilmington, DE, USA) Each DNA sample was standardized

to a final concentration of 20 ng/μl Single PCR was used

to screen isolates that were phenotypically resistant to macrolides, lincosamides, tetracyclines, or streptogramins Detection of the rRNA methylase genes (erm(A), erm(B), erm(C)), the acetyl transferase genes (vat(D) and vat(E)), and the ABC porter genes (msr(A/B)and msr(C)) was carried out using primers and PCR conditions previously described (Table 2) The PCR assay mix (total volume of 12.5 μl) included 1 U Takara Taq HotStart DNA Polymerase and 10X PCR Buffer (Takara Bio Inc, Otsu, Shiga, Japan), 0.5μM of each primer, 200 μM of each dNTP and 40 ng of genomic DNA (i.e 2μl of sample) Most resistance genes were amplified with an initial denaturing cycle at 95 °C for 5 min followed by 25 cycles of 94 °C for 45 s, 52 °C for 45 s, and 72 °C for 1 min, with a final extension step at 72 °C for

10 min Genes, msr(C) and msr(A/B) were amplified under different conditions: an initial denaturing cycle at 95 °C for

5 min was followed by 25 cycles of 93 °C for 30 s, 55 °C for

2 min, and 72 °C for 1.5 min, with a final extension step at

72 °C for 10 min PCR products were run on a 2% agarose gel The class 1 integrase gene was used for detection of the Tn916/Tn1545 conjugative transposon family and the open reading frame gene (ORF13) was used for specific detection of Tn916 (Macovei and Zurek, 2006)

Trapped flies were identified as members of Muscidae (house-flies) and Calliphoridae (blow flies and bottle (house-flies) families The number of flies and number of bacterial isolates recovered varied across the traps shown inTable 3

Fig 3– Percent of recovered staphylococcal isolates phenotypically resistant to antibiotics Multi-drug resistance (MDR) indicates resistance to two more drugs Only antibiotics with CLSI established breakpoints are presented (cip– ciprofloxacin; ery– erythromycin; q-d – quinupristin-dalfopristin; tet – tetracycline; MDR – multi-drug resistant)

Resistant enterococci and staphylococci persisted in the

litter piles throughout the 120 day study period However,

resistant enterocococci were isolated at fewer farms at later

sampling events For example, resistance to four drugs was

not observed in enterococci after day 60 This was not the

case, however, for staphylococci, where drug resistance to

more than three drugs was observed from samples collected

at day 120 After removing duplicate isolates (described in

Methods), a total of 106 enterococcal and 115 staphylococcal

isolates were characterized from poultry litter samples,

while 36 enterococcal and 29 staphylococcal isolates were

characterized from fly samples In both the fly and poultry

litter samples, Enterococcus faecalis represented the majority

of the enterococcal species (70% in litter and 87% in flies) Most staphylococcal isolates did not correspond to the species primers in our study (Table 1) and were characterized

to the genus level only, with the exception of seven isolates

of S xylosus, five isolates of S epidermidis, and three isolates

of S aureus Approximately two-thirds of staphylococci and enterococci isolated from flies were obtained from the ho-mogenized samples (i.e., internalized bacteria), and approxi-mately one-third were obtained from exterior washes The results of resistance testing are shown inFigs 2 and 3 (note: isolates were recovered from both antibiotic-amended and non-amended plates) Resistance to clindamycin was the most common resistance phenotype in enterococcal isolates

Table 4– Characteristics of individual isolates positive for resistance genes and/or mobile genetic elements

Enterococcus faecium

Farm C clinr, eryr, q-dr, tetr Tn916 erm(B)

Farm C clinr, eryr, q-dr erm(B), vat(E), msr(C) Farm C clinr, eryr, penr, q-dr erm(A)

Farm C clinr, eryr, q-dr, tetr Tn916

Trap 2 clinr, eryr, q-dr Tn916 Trap 3 clinr, eryr, q-dr, tetr erm(B)

Trap 7 clinr, q-dr, tetr Tn916 msr(C) Enterococcus faecalis

Farm A clinr, eryr, q-dr, tetr Tn916 erm(B)

Farm B clinr, eryr, q-dr, tetr Tn916 erm(B)

Farm A clinr, eryr, q-dr, tetr Tn916 erm(B)

Farm C clinr, eryr, tetr Tn916 erm(B) Farm A clinr, eryr, q-dr, tetr Tn916 erm(B)

Trap 2 clinr, eryr, q-dr, tetr erm(B) Trap 2 clinr, eryr, q-dr, tetr Tn916 erm(B) Trap 3 clinr, eryr, q-dr, tetr erm(B) Trap 6 clinr, penr, tetr Tn916 erm(B) Trap 6 clinr, eryr, q-dr, tetr erm(B)

Trap 7 clinr, q-dr, tetr Tn916 Trap 7 clinr, eryr, q-dr, tetr Tn916 erm(B) Trap 7 clinr, eryr, q-dr, tetr Tn916 erm(B) Staphylococcus spp

Note: only isolates exhibiting phenotypic resistance to erythromycin, quinupristin-dalfopristin, or tetracycline were screened for resistance genes

a Phenotypic resistance: eryr– erythromycin resistant; q-dr– quinupristin-dalfopristin resistant; tetr– tetracycline resistant; clinr– clindamycin resistant; penr– penicillin resistant

from both fly and poultry litter samples Resistance to the

lincosamide class of antibiotics (which includes clindamycin)

has been reported to be an intrinsic trait that is relatively

common in E faecalis (Hayes et al., 2004) Among the

enterococcal isolates recovered from flies, resistance was

more common for quinupristin-dalfopristin (94%),

erythromy-cin (42%) and tetracycline (39%) than in isolates of poultry

litter origin (Fig 2) Very little resistance to penicillin and

ciprofloxacin was observed for enterococcal isolates from

either flies or litter (Fig 2) Further, no enterococcal isolates

were found to be resistant to vancomycin

In staphylococcal isolates, phenotypic resistance to

ery-thromycin was relatively more common in litter isolates (57%)

than in isolates from flies (19%) The percentage of

staphylo-coccal isolates resistant to quinupristin-dalfopristin and

tetracycline was also higher in litter (30%) as compared to

flies (10%) There are no established breakpoints for

clinda-mycin and penicillin; however, approximately 90% of isolates

from either flies or litter had an MIC value of less than 0.25μg/

ml One staphylococcal isolate from poultry litter exhibited

high level resistance to vancomycin (64μg/ml)

Erm(B) was the resistance gene most commonly found in

enterococci in both flies and poultry litter isolates (Table 4)

Isolates found to carry erm(B) were also likely to be resistant

to quinupristin-dalfopristin, erythromycin and clindamycin

This gene alters a site in 23S rRNA common to the binding of

macrolides, lincosamides and streptograminB antibiotics

(Sutcliffe et al., 1996) The enterococcal gene, msr(C) was

observed in two isolates from poultry litter and two isolates

from fly samples The nearly homologous staphylococcal

gene, msr(A/B), was observed in four isolates from poultry

litter and one isolate from fly samples The msr genes encode

an ABC porter for macrolide and streptograminBantibiotics

The ORF13 gene, which is associated with the conjugative

transposon Tn916, was found in nine enterococcal isolates

from poultry litter and eight from fly isolates; Tn916

repre-sents a family of transposons commonly found to transfer

antibiotic resistance genes The combination of ORF13 gene and int gene, associated with Tn1545/916, were recovered from four enterococcal isolates from poultry litter and six from fly isolates, all of which also contained the erm(B) gene (Table 4) Two fly isolates from traps 6 and 7 placed in proximity, also contained the msr(C) gene in combination with Tn916

The percentage of phenotypically resistant enterococcal isolates– resistant to erythromycin, quinupristin-dalfopristin,

or tetracycline – positive for resistance determinants was nearly identical among fly and poultry litter isolates (Fig 4)

This study strongly suggests that flies in intensive poultry production areas, such as the Delmarva Peninsula, can disperse antibiotic resistant bacteria in their digestive tracts and on their exterior surfaces Dispersion of resistant bacteria from poultry farms by flies could contribute to human exposures, although at present it is difficult to quantify the contribution of flies Flies may also transfer bacteria from fields amended with poultry waste Fly populations have been found to be higher near poultry farms as compared to nearby rural settings (Winpisinger et al., 2005) Although individual flies can travel as far as 20 miles, the majority of the species found in traps in this study generally do not travel more than 2 miles and their movement is oriented toward readily available food sources (Graczyk et al., 1999; Sawabe et al., 2006)

Six of the eight classes of antibiotics screened in this study [penicillin, tetracyclines, macrolides, lincosamides, aminogly-cosides, and streptogramins] are used in poultry production, while fluoroquinolones were used until 2005 (Florini et al., 2005; Price et al., 2007) All of these drugs are categorized by the U.S Food and Drug Administration as critically or highly important to human medicine (USFDA, 2003) Staphylococcal Fig 4– Percentage of enterococci isolates (phenotypically resistant to either erythromycin, quinupristin-dalfopristin, or tetracycline) positive for resistance determinants

infections are often treated with penicillins, macrolides,

lincosamide, aminoglycosides, and streptogramins, while

enterococcal infections are usually treated with penicillins,

aminoglycosides, tetracyclines and streptogramins (Bartlett

et al., 2005) Of concern, streptogramins, which have been used

in animal husbandry for nearly 30 years, were recently

approved for treating patients with vancomycin resistant E

faecium or methicillin-resistant Staphylococcus aureus (Jensen

et al., 2002; McDermott et al., 2005)

Enterococci resistance to streptogramins

(quinupristin-dalfopristin), were found in both litter and flies

Quinupristin-dalfopristin resistant enterococci in our study commonly haderm(A)

and erm(B) resistance genes StreptograminA(i.e dalfopristin)

resistance in E faecium, isolated from the poultry environment,

has been found to be highly associated with the vat(E) gene,

while StreptograminB (i.e quinupristin) resistance has been

linked to the erm(B) gene (Jensen et al., 2002) The emergence of

streptogramin-resistant E faecium, associated with the erm

genes conferring resistance to streptograminB, and vat genes

conferring high-level resistance to streptograminA, is a serious

public health concern, and is thought to be a consequence of

the use of virginiamycin for growth promotion over the past

30 years (Smith et al., 2003) The absence of vancomycin

resistant enterococci in our study was not a surprise, given

that vancomycin has never been approved for use in U.S

food animal production In contrast, vancomycin resistant

enterococci have been frequently reported in European studies,

where avoparcin (an analog of vancomycin) was used in animal

feeds until 1997 (Aarestrup et al., 2001) It was surprising,

however that we cultured one staphylococcal isolate from the

poultry litter that exhibited high-level resistance to vancomycin

(N64 μg/ml)

Most conjugative transposons of the Tn916 family encode

resistance to tetracycline or minocycline alone, and tetracycline

resistance is now relatively common Although increased

prevalence of resistance and the availability of a variety of other

broadly active antibiotics have reduced the importance of

tetracycline as a therapeutic alternative, it remains a first- and

second-line treatment for many urogenital infections (Rice, 1998)

The clustering of resistance genes on the same transposable

elements can affect the persistence of antibiotic resistance, such

that eliminating only one antibiotic may not reduce the

pre-valence of the cluster The erm(B) gene, for example, is commonly

linked with Tn1545/Tn916, which encodes tetracycline resistance

and predominates in clinically important Gram-positive bacteria

(Clewell et al., 1995; Rice, 1998) The continued dissemination of

mobile genetic elements that have broad host-range, such as

Tn916 family, which includes Tn1545, in the microbial

environ-ment is a serious problem

One of the limitations of this study is that a small number of

sampling sites were used and fly and litter samples were not

collected from the same sites This may account for the

differences observed between the phenotypic resistance patterns

of isolates from flies and litter However, because flies can travel

as much as 20 miles, it is not possible to ascertain

associ-ations between a specific sample of flies and a specific farm

An additional limitation was the limited coagulase-negative

Staphylococcus species characterized in the analyses Other

species, such as S sciuri, S lentus, and S simulans would have

been likely candidates, as shown bySimjee et al (2007)in a study

of poultry litter in Georgia Additionally, no control sites were used A proper control site would have been difficult to define in this setting as poultry production occurs throughout the Delmarva Peninsula, as well as land amendment with poultry wastes, and flies can potentially travel long distances Another limitation was that we could not obtain data on antibiotic use at any of the farms sampled since this information is not publicly available in the U.S (Mellon et al., 2001) There is a lack of definitive information on the overall volume of antibiotics used as feed additives, and there are obstacles to this information since feed formulations are considered confidential business informa-tion under U.S law Nonetheless, our data are consistent with studies highlighting the prevalence of resistant enterococci and staphylococci in the poultry environment (Hayes et al., 2004;

Lu et al., 2003)

The results of this study illustrate the persistence of resistant bacteria in the environment, and highlight the reservoir of resistance associated with the use of antibiotics as a feed additive in poultry production Further, the carriage of antibiotic resistant enteric bacteria by flies in the poultry production environment increases the potential for human exposure to drug resistant bacteria

Acknowledgements Support for this research was received from the Center for a Livable Future at the Johns Hopkins Bloomberg School of Public Health We would also like to thank Dr Macovei, Dr Jensen, Dr McDermott, and Patti Cullen for providing control strains used in our analysis

R E F E R E N C E S

Aarestrup FM, Agerso Y, Ahrens P, Jogensen J, Madsen M, Jensen LB Antimicrobial susceptibility and presence of resistance genes

in staphylococci from poultry Vet Microbiol 2000;74:353–64 Aarestrup FM, Seyfarth A, Emborg HD, Pedersen K, Hendriksen R, Bager F Effect of abolishment of the use of antimicrobial agents for growth promotion on occurrence of antimicrobial resistance in fecal enterococci from food animals in Denmark Antimicrob Agents Chemother 2001;45:2054–9

Bartlett JG, Auwaerter PG, Pham PA The ABX guide diagnosis & treatment of infectious diseases Montvale, NJ: Thomson PDR; 2005 Clewell D, Flannagan S, Jaworski D Unconstrained bacterial promiscuity: the Tn916-Tn1545 family of conjugative transposons Trends in Microbiol 1995;3:229–36

CLSI Performance standards for antimicrobial susceptibility testing.15th informational supplement Wayne, PA: Clinical and Laboratory Standards Institute; 2005 M100-S15

Delaware Population Consortium Annual projections; 2002.http:// stateplanning.delaware.gov/information/dpc_projections.shtml [accessed 9 June 2008]

Deasy BM, Rea MC, Fitzgerald GF, Cogan TM, Beresford TP A rapid PCR based method to distinguish between Lactococcus and Enterococcus Syst Appl Microbiol 2000;23:510–22

Dutka-Malen S, Evers S, Courvalin P Detection of glycopeptide

resistance genotypes and identification to the species level of

clinically relevant enterococci by PCR J Clin Microbiol 1995;33:24–7

Erb A, Sturmer T, Marre R, Brenner H Prevalence of antibiotic

resistance in Escherichia coli: overview of geographical, temporal,

and methodological variations Eur J Clin Microbiol Infect Dis

2007;26:83–90

Florini K, Denison R, Stiffler T, Fitzgerald T, Goldburg R Resistant

bugs and antibiotic drugs Washington, DC: Environmental

Defense; 2005

Fotedar R, Banerjee U, Singeh S, Shriniwas SL, Verma AK The

housefly (Musca domestica) as a carrier of pathogenic

micro-organisms in a hospital environment J Hosp Infect

1992;20:209–15

Graczyk T, Cranfield M, Fayer R, Bixler H House flies (Musca domestica)

as transport hosts of Cryptosporidium parvum

Am J Trop Med Hyg 1999;61:500–4

Graham JP, Boland JJ, Silbergeld EK Growth promoting antibiotics

in food animal production: an economic analysis

Public Health Rep 2007;122:79–87

Graham JP, Tuchmann JL, Price LB, Otte JM, Pfeiffer DU, Tiensin T,

et al The animal-human interface and infectious disease in

industrial food animal production: rethinking biosecurity and

biocontainment Public Health Rep 2008;123:282–99

Hald B, Skovgard H, Bang D, Pedersen K, Dybdahl J, Jespersen J, et al

Flies and Campylobacter infection of broiler flocks

Emerg Infect Dis 2004;10:1490–2

Hayes JR, English L, Carr LE, Wagner DD, Joseph SW

Multiple-antibiotic resistance of Enterococcus spp isolated

from commercial poultry production environments

Appl Environ Microbiol 2004;70:6005–11

Islam M, Jennie M, Doyle MP, Sharad PC, Millner P, Jiang X

Persistence of Salmonella enterica serovar Typhimurium on

lettuce and parsley and in soils on which they were grown in

fields treated with contaminated manure composts or irrigation

water Foodborne Pathog Dis 2004;1:27–35

Jensen LB, Hammerum AM, Bager F, Aarestrup FM Streptogramin

resistance among Enterococcus faecium isolated from production

animals in Denmark in 1997 Microb Drug Resist 2002;8:369–74

Kariyama R, Mitsuhata R, Chow JW, Clewell DB, Kumon H Simple

and reliable multiplex PCR assay for surveillance isolates of

vancomycin-resistant enterococci J Clin Microbiol

2000;38:3092–5

Levy S, Marshall B Antibacterial resistance worldwide: causes,

challenges and responses Nature Med 2004;10:122–9

Likirdopulos CA, Simmons OD, Watson DW, Sobsey MD Collection

methods for evaluating microbial indicator concentrations of

houseflies (Musca domestica) on swine farms in Eastern North

Carolina Animal Waste Management Symposium; 2005

Lu J, Sanchez S, Hofacre C, Maurer JJ, Harmon BG, Lee MD

Evaluation of broiler litter with reference to the microbial

composition as assessed by using 16S rRNA and functional

gene markers Appl Environ Microbiol 2003;69:901–8

Macovei L, Zurek L Ecology of antibiotic resistance genes:

characterization of enterococci from houseflies collected in

food settings Appl Environ Microbiol 2006;72:4028–35

McDermott P, Cullen P, Hubert SK, McDermott SD, Bartholomew M,

Simjee S, et al Changes in antimicrobial susceptibility of

native Enterococcus faecium in chickens fed virginiamycin

Appl Environ Microbiol 2005;71:4986–91

Mellon M, Benbrook C, Benbrook KL Hogging it: estimates of

antimicrobial abuse in livestock Cambridge: UCS Publications; 2001

Moore PA, Daniel TC, Sharpley AN, Wood CW Poultry manure management: environmentally sound options J Soil Water Conserv 1995;50:321–7

Morot-Bizot S, Talon R, Leroy S Development of a multiplex PCR for the identification of Staphylococcus genus and four staphylococcal species isolated from food J Appl Microbiol 2004;97:1087–94 Nandi S, Maurer JJ, Hofacre C, Summers AO Gram-positive bacteria are a major reservoir of Class 1 antibiotic resistance integrons in poultry litter Proc Natl Acad Sci U S A

2004;101:7118–22

Nichols GL Fly transmission of Campylobacter Emerg Infect Dis 2005;11:361–4

NRC (National Research Council) The use of drugs in food animals: benefits and risks Washington DC: National Academy Press; 1999 Paudel KP, Adhikari M, Martin NR Evaluation of broiler litter transportation in northern Alabama, USA J Environ Manage 2004;73:15–23

Price LB, Roess A, Graham JP, Baqar S, Vailes R, Sheikh KA, et al Neurologic symptoms and neuropathologic antibodies in poultry workers exposed to Campylobacter jejuni

J Occup Environ Med 2007;49:748–55

Rice L Tn916 family conjugative transposons and dissemination

of antimicrobial resistance determinants Antimicrob Agents Chemother 1998;42:1871–7

Sawabe K, Hoshino K, Isawa H, Sasaki T, Hayashi T, Tsuda Y, et al Detection and isolation of highly pathogenic H5N1 Avian Influenza A viruses from blow flies collected in the vicinity of

an infected poultry farm in Kyoto, Japan, 2004 Am J Trop Med Hyg 2006;75:327–32

Silbergeld EK, Graham JP, Price LB Industrial food animal production, antimicrobial resistance, and human health Annu Rev Public Health 2008;29:151–69

Simjee S, McDermott PF, White DG, Hofacre C, Berghaus RD, Carter PH, et al Antimicrobial susceptibility and distribution

of antimicrobial-resistance genes among Enterococcus and coagulase-negative Staphylococcus isolates recovered from poultry litter Avian Dis 2007;51:884–92

Smith DL, Johnson JA, Harris AD, Furuno JP, Perencevich EN, Morris JG Assessing risks for a pre-emergent pathogen: virginiamycin use and the emergence of streptogramin resistance in Enterococcus faecium Lancet Infect Dis 2003;3:241–9

Soltani M, Beighton D, Philpott-Howard J, Woodford N

Mechanisms of resistance to quinupristin-dalfopristin among isolates of Enterococcus faecium from animals, raw meat, and hospital patients in Western Europe Antimicrob Agents Chemother 2000;44:433–6

Sutcliffe J, Grebe T, Tait-Kamradt A, Wondrack L Detection of erythromycin-resistant determinants by PCR Antimicrob Agents Chemother 1996;40:2562–6

USFDA (United States Food and Drug Administration) Guidance for Industry #152: Guidance on evaluating the safety of antimicrobial new animal drugs with regard to their microbiological effects on bacteria of human health concern Washington, D.C.: U.S Food and Drug Administration; 2003

Winpisinger KA, Ferketich AK, Berry RL, Moeschberger ML Spread

of Musca domestica (Diptera: muscidae), from two caged layer facilities to neighboring residences in rural Ohio

J Med Entomol 2005;42:732–8

Wondrack L, Massa S, Yang B, Sutcliffe J Clinical strain of Staphylococcus aureus inactivates and causes efflux of macrolides Antimicrob Agents Chemother 1996;40:992–8