53390 E-mail: jbag@uoguelph.ca Received 12 June 2006, revised 1 October 2006, accepted 25 October 2006 doi:10.1111/j.1742-4658.2006.05556.x Repression of polyA-binding protein PABP mRNA
Trang 1the autoregulatory translational control element of
PABP-mRNA through the KH III-IV domain
Gopal P Patel and Jnanankur Bag
Department of Molecular and Cellular Biology, University of Guelph, Ontario, Canada
Regulation of gene expression is fundamental to
almost all biological activities Multiple layers of
regu-latory mechanisms control essentially every step of
gene expression in eukaryotes It was thought that
regulation of transcription is the master switch of gene
expression in eukaryotes [1]; however, it is becoming
increasingly evident that the majority of regulatory
mechanisms are employed at the post-transcriptional
and translational levels [2,3] In order to be functional,
cellular mRNA associates with a wide array of
RNA-binding proteins to form a messenger
ribonucleopro-tein particle (mRNP) The constituent of the mRNP
dictates the fate of mRNA [4] It is therefore not
sur-prising that functionally related eukaryotic genes may
represent ‘post-transcriptional operons’ because they are regulated coordinately at post-transcriptional levels
by unique combinations of mRNA-binding proteins that recognize common cis-elements among the mRNAs [5]
The poly(A)-tail is one of the most common cis-acting sequence elements found in the 3¢ UTR of eukaryotic mRNAs, which predominantly binds to poly(A)-binding protein (PABP) The 3¢ poly(A)-tail and PABP, together, influence almost every aspect of mRNA metabolism including maturation, transporta-tion, localizatransporta-tion, translation and stability [6–8] Given the significant function of PABP in mRNA biology, its cellular level is tightly regulated at the translational level
Keywords
autoregulation; IMP1; PABP; poly(A)-binding
protein; translational control
Correspondence
J Bag, Department of Molecular and
Cellular Biology, University of Guelph,
Guelph, Ontario, N1G 2W1, Canada
Fax: +1 519 837 2075
Tel: +1 519 824 4120 Ext 53390
E-mail: jbag@uoguelph.ca
(Received 12 June 2006, revised 1 October
2006, accepted 25 October 2006)
doi:10.1111/j.1742-4658.2006.05556.x
Repression of poly(A)-binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding
of PABP, insulin-like growth factor II mRNA binding protein-1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine-rich autoregu-latory sequence (ARS) located at the 5¢ untranslated region of the PABP-mRNA In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level The dissoci-ation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nm and 5.9 nm, respectively Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C-terminal PABP-C and K-homology (KH) III-IV domains, respectively Interaction of PABP with the ARS requires at least three out
of its four RNA-binding domains, whereas KH III-IV domain of IMP1 is necessary and sufficient for binding to the ARS In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to
be within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAA sequence located at the 3¢ end of the ARS Results of our analysis suggest that both proteinÆprotein and proteinÆRNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA
Abbreviations
ARC, autoregulatory ribonucleoprotein complex; ARS, autoregulatory sequence; IMP1, insulin-like growth factor II mRNA binding protein-1KH, K-homology; mRNP, messenger ribonucleoprotein particle; PABP, poly(A)-binding protein; RBD, RNA-binding domain; REMSA, RNA electrophoretic mobility shift assay; RRM, RNA-recognition motif; TOP, terminal oligopyrimidine tract; UNR, unr gene encoded polypeptide.
Trang 2by two repressible cis-acting sequence elements, the
ter-minal oligopyrimidine tract (TOP) [9] and an
adenine-rich autoregulatory sequence (ARS) [10] The TOP
element encompasses the first 31 nucleotides, whereas
the ARS spans nucleotides 71–131 in the 5¢ UTR of the
PABP mRNA The TOP element regulates PABP
trans-lation in growth-dependent and tissue-specific manners
[11,12], whereas the ARS functions constitutively in all
types of cells [9,10] It has been generally accepted that
at elevated cellular levels, PABP binds to the ARS
region of its own mRNA and represses translation by
stalling the movement of the 40S ribosomal subunit
along the 5¢ UTR [13,14] Recent studies in our
laborat-ory have shown that, besides PABP, the ARS binds to
insulin-like growth factor II mRNA binding protein-1
(IMP1) and the unr gene encoded polypeptide (UNR) to
form a heterotrimeric autoregulatory ribonucleoprotein
complex (ARC) [15] Mutational analyses of the ARS
have shown a strong correlation between the formation
of the heterotrimeric complex and repression of a
repor-ter gene expression UNR showed lesser affinity for the
ARS, and its presence in the ARC required association
with PABP However, IMP1 is capable of binding to the
ARS with high affinity independently, and can also
interact with PABP [15]
There are several functional similarities between
PABP and IMP1 Both polypeptides have been
impli-cated in mRNA localization, turnover, and
transla-tional control No enzymatic activity has been
associated with either PABP or IMP1, and it seems
that their functions are attributed to their ability to
bind to specific RNA sequences and to act as a
scaf-fold for protein–protein interactions PABP contains
four RNA-binding domains (RBD I to IV) arranged
in tandem at its N-terminus and a protein-binding
aux-iliary domain at its C-terminus Concurrently, PABP
exhibits preferential affinity for poly(A) stretches and
also interacts with several cytosolic polypeptides such
as Paip1 [16,17], Paip2 [18,19], eIF4B [20],
poly(C)-binding proteins [21], UNR [22], eIF4G [23], Rna15
[24], eRF3 [25], and TcUBP-1 [26]
IMP1 belongs to the conserved
valine-isoleucine-cystine-lysine-glutamine containing (VICKZ) family of
mRNA-binding proteins consisting of two
RNA-recog-nition motifs (RRM I and II) at its N-terminus and
four K-homology (KH) domains arranged in tandem
at its C-terminus [27] Interestingly, associations of
IMP1 with both RNAs and proteins are primarily
mediated by the KH-domains [28] The full repertoire
of RNA-sequence targets and polypeptide partners of
IMP1 has not yet been defined The RNA targets of
IMP1 include Igf-II [27], c-myc [29], tau [30], FMR1
[31], and PABP [15] mRNAs; whereas its known
polypeptide partners consist of G3 BP, HuD [30], FMRP [31], and PABP [15]
In the present study, we have further characterized the interaction between PABP and IMP1 on the ARS RNA for a better understanding of their role in trans-lational regulation of PABP expression The results of our studies show that both PABP and IMP1 bind strongly to nucleotides between 110 and 131 of the ARS RNA Binding of PABP to the ARS requires a minimum of three RBDs (RBD I to III or RBD II to IV), whereas binding of IMP1 to the ARS is predom-inantly mediated by the KH III–IV domains In addi-tion, protein interaction analyses confirmed that PABP-C and KH III–IV domains are essential and sufficient for both homo- and hetrodimerization between PABP and IMP1 Taken together, these results indicate that IMP1 and PABP may form a plat-form for the plat-formation of a large ARC on the ARS through further protein–protein interactions
Results
The minimal RBD requirement for the interaction between PABP and the ARS
As the A-rich autoregulatory translational control ele-ment of PABP mRNA is not a perfect poly(A) tract, and binds less efficiently to PABP than a comparable size poly(A) tract [15], we set out to examine whether there is a difference in how the ARS and a poly(A) RNA binds PABP We investigated the relative import-ance of individual RBDs of PABP in binding the ARS, and compared it to that of a poly(A) RNA Various [35S]methionine labeled PABP peptides containing one
or more RBDs were synthesized in vitro (Fig 1), and allowed to bind to the ARS RNA coupled agarose beads as described previously [15] Analyses of the
elut-ed bound proteins from these beads were performelut-ed by SDS⁄ PAGE The results (Fig 2) show that PABP pep-tides containing a single RBD domain failed to bind the ARS RNA (Fig 2A: lanes 1, 5, 8 and 10) Although RBD I-II peptide showed a weak binding to the ARS (Figs 2.A: lane 2), other combinations of two RBDs did not show any detectable binding to the ARS RNA (Fig 2A: lanes 6 and 9) The presence of at least three of the four RBD domains was required in the PABP peptide for efficient binding to the ARS RNA (Fig 2A: lanes 3 and 7) PABP peptides containing either RBDs I-II-III or II-III-IV were almost equally effective as the full length PABP (Fig 2A: lane 12) or a PABP peptide containing all four RBDs (Fig 2A: lane 4) In addition, as expected the PABP-C domain showed no RNA binding activity (Fig 2A: lane 11)
Trang 3Similar studies were performed to examine how PABP
peptides bind to a 50 nucleotide long poly(A) RNA In
contrast to the ARS RNA, the poly(A)50only required
the presence of just two of the four RBDs (Fig 2A:
lanes 2, 6, 9), or only the RBD II (Fig 2B: lane 5), for
efficient binding PABP peptides containing a
combina-tion of three (Fig 2B: lanes 3 and 7) or all four RBDs
(Fig 2B: lane 4) showed binding similar to the full
length PABP (Fig 2B: lane 12) These results are in
agreement with a previous report that the RBD II is
responsible for most of the poly(A) binding activity of
PABP [32] In these studies we used the radiolabelled
in vitro translated luciferase as a negative control,
which showed no binding to either the ARS or the
poly(A) RNA (Fig 2, lane 13) We also used the vector
derived unrelated pGEM-RNA as an additional
negat-ive control for the binding assays (Fig 2C) In our
assays using the RBD I-IV, RBD II-IV, and the full
length PABP, a number of lower kDa bands (than the
corresponding peptide) were found to bind both ARS
and the poly(A) RNAs These peptides are most likely
the premature translation termination products from
longer mRNAs, which is a common problem with the
rabbit reticulocytes lysate cell-free system used in our
studies to synthesize the PABP peptides
PABP and IMP1 binding region of the ARS
We have shown earlier that at least three polypeptides
PABP, IMP1, and UNR bind to the ARS element of
PABP mRNA, and among these polypeptides only PABP and IMP1 can bind to the ARS independently [15] Therefore, we wanted to examine whether PABP and IMP1 bind to distinct subregions of the ARS Dif-ferent ARS RNA fragments were used for RNA elec-trophoretic mobility shift assay (REMSA) and UV cross-linking studies with purified PABP and IMP1 In addition, we performed RNase footprinting studies to examine the IMP1 binding region of the ARS RNA The result of our REMSA studies show that the pres-ence of the two terminal short stretches of adenines at the 5¢ and the 3¢ ends of the ARS were not essential for binding to IMP1 (Fig 3B: lanes 2 and 3, and the sequence of ARS and DARS-4 in Fig 3A) The 20 nucleotide long region of the 5¢ end of the ARS (DARS-L; Fig 3B: lane 4) and the A and U rich region located at the middle segment of the ARS (DARS-C; Fig 3B: lane 5) were unable to form a sta-ble complex with the IMP1 We found that an A, U and C rich region located at the 3¢ end of ARS (DARS-R; Fig 3B: lane 6) was sufficient for binding
to IMP1 Because both DARS-4 and DARS-R binds to IMP1, we tested whether a 14 nucleotide long common sequence 5¢-CCCCAAAAAAAUUU-3¢ between the two constructs, is the minimal IMP1-binding sequence Results of REMSA (Fig 3C) show that the 14 nucleo-tide long RNA was able to bind both PABP and IMP1, albeit, less efficiently than the 22 nucleotide long DARS-R RNA Therefore, the presence of addi-tional nucleotides either at the 5¢ or the 3¢ (as in the
Fig 1 Architecture of PABP and IMP1 constructs used in the present study Protein expression constructs containing various portions of IMP1 and PABP open reading frames were created using primers given in Table 2 The constructs prepared using pQE primers were cloned into pQE80L plasmid vector for the expression of 6· His tag fusion protein in E coli The constructs prepared using pDU primers were cloned into pDUAL-GC plasmid vector for the in vitro expression of proteins in the rabbit reticulocytes lysate cell-free system.
Trang 4DARS-4) ends of the minimal RNA sequence has a
significant stimulatory effect on the binding of PABP
and IMP1
Experiments using UV cross-linking between
radio-labelled RNA and purified IMP1 (Fig 3D) yielded
results similar to those observed by REMSA (Fig 3B)
Interestingly, both IMP1 and PABP showed similar
preference for the 3¢ end of the ARS (Fig 3D: lane 6;
and Fig 3E: lane 6) Furthermore, to examine whether
the same region of the ARS is involved in binding
IMP1 when it is present in the sequence context of the
entire ARS, we performed RNase footprinting analyses
using the ARS RNA and purified 6· His-IMP1
(Fig 3F) The results show protection of the sequence
at the 3¢ end of the ARS in presence of IMP1 (Fig 3F:
compare lanes 4 and 5) Comparison of this region
(Fig 3F: lane 4) with the RNA ladder (Fig 3F: lane 1)
suggest that the IMP1 binding site of the ARS falls
within the nucleotide sequence shown in the DARS-R
We further investigated the ability of both
PABP and IMP1 to bind to the DARS-R RNA
simultaneously using REMSA The results (Fig 4) show that both PABP and IMP1 formed similar size complexes with the ARS when used separately in bind-ing assays Presence of equimolar concentration of both PABP and IMP1 in the binding reaction pro-duced a significant level of a slower migrating com-plex, which indicates the formation of a heterodimeric complex with the ARS
Comparison of binding affinity of the ARS
to PABP and IMP1
In the previous UV cross-linking assays, PABP showed
a slightly higher binding ability to the ARS than what was observed for the IMP1 (Fig 3D,E) Therefore, we compared the binding affinities of IMP1 and PABP for the ARS in detail (Fig 5) We measured the per-centage of bound RNA at various protein concentra-tions by REMSA [33] The results show that PABP binds to the ARS approximately two times more efficiently than the IMP1 (Fig 5C) The calculated
A
B
C
Fig 2 Binding of the different RBD of
PABP with the ARS and poly(A)50RNA.
[ 35 S]methionine labelled different
RBD-domains of PABP (Fig 1), prepared by
in vitro translation in a cell-free rabbit
reticu-locytes lysate, were incubated with the ARS
(A), poly(A) 50 (B) or pGEM (C) conjugated
agarose beads in the chromatography
buffer, washed extensively with the same
buffer, and the bound proteins were eluted
by boiling the beads in a protein sample
loading buffer The samples were analyzed
by 13% SDS⁄ PAGE, the gel was
impregna-ted in 1 M sodium salicylate, vacuum dried
and visualized by autofluorography.
Trang 5E
F
C
Fig 3 PABP and IMP1 binding region of the ARS (A) Different regions of the ARS RNA used in the gel-shift and UV cross-linking assays (B) RNA gel-shift analyses of the binding of IMP1 with the different regions of the ARS RNA REMSA was performed using 5 ng purified 6· His-IMP1 and 0.1 ng (10 000 c.p.m.) RNA Lane 1, radioactive DARS-R RNA only; lanes 2–6, purified 6· His-IMP1 was incubated with radiolabelled ARS, DARS-4, DARS-L, DARS-C, and DARS-R RNAs, respectively Samples were analyzed on a 5% polyacrylimide gel under nondenaturing conditions, vacuum dried, and visualized by autoradiography (C) RNA gel-shift analyses of the binding of IMP1 to DARS-R and DARS-S RNA was performed as described in (B) Lane 1, radioactive DARS-R RNA only; lanes 2 and 4, purified 6· His-PABP was incuba-ted with DARS-R and DARS-S RNA, respectively; lanes 3 and 5, purified 6· His-IMP1 was incubaincuba-ted with DARS-R and DARS-S RNA (D) and (E) RNA-protein UV cross-linking studies Purified, 5 ng 6· His-IMP1 (D) and 5 ng 6· His-PABP (E) were used for these studies One sample
in both panels containing protein and ARS RNA was analyzed without UV treatment (lane 1) Lanes 2–6, 6· His-IMP1 (D) and 6· His-PABP (E) were incubated with 1 ng radiolabelled (100 000 c.p.m.) ARS, DARS-4, DARS-L, DARS-C, and DARS-R RNAs After the UV treatment, the samples were treated with RNase A ⁄ RNase T1, fractionated on a 13% SDS ⁄ PAGE and visualized by autoradiography (F) RNase foot-printing analysis IMP1 interacting domain of the ARS RNA was analyzed by RNase footfoot-printing as described in the Experimental procedures Lane 1, RNA ladder was prepared by partially hydrolyzing the 5¢ end radiolabelled ARS RNA with 0.1 M NaOH Lane 2 and 3, 5¢ end radiola-belled ARS RNA with or without purified 6· His-IMP1, respectively Lanes 4 and 5, 5¢ end radiolaradiola-belled ARS RNA with or without purified 6· His-IMP1 was partially digested with RNase One (Promega) The samples were analyzed by 13% PAGE in presence of 8% urea as a denaturing agent and the bands were visualized by autoradiography.
Trang 6dissociation constants for PABP–ARS and IMP1–ARS
interactions were found to be approximately 2.3 nm
and 5.9 nm, respectively
The IMP1 domain responsible for binding to
the ARS
IMP1 is a modular protein with two RRM type and
four KH RNA binding domains To examine which of
the six RNA binding domains are necessary for the
ability of IMP1 to bind ARS, we expressed various
portions of IMP1 as His-tagged peptides, and purified
by affinity chromatography These peptides were
ana-lyzed for complex formation with the radiolabelled
ARS RNA by UV cross-linking assay The results
show that the RRM I-II domain binds to the ARS
very inefficiently (Fig 6, compare lanes 2 and 3),
whereas the KH I-II peptide did not show any
detect-able binding to the ARS (Fig 6, lane 4) The ability to
bind ARS was present within the KH III-IV region of
IMP1 The ability of the KH III-IV domain containing peptide to bind ARS was similar to what was observed for both the full length IMP1 and KH I-IV peptide
Interaction between PABP and IMP1
In a previous study, we reported that IMP1 is a novel PABP partner [15] Therefore, we further investigated how these two polypeptides interact with each other Different PABP and IMP1 domains were synthesized
in vitro as [35S]methionine labeled peptides, and their ability to bind matrix bound IMP1 or PABP was
A
B
C
Fig 5 Binding affinity of the ARS RNA to PABP and IMP1 (A) and (B) Gel-shift assays of binding of PABP and IMP1 to the ARS RNA Uniformly radiolabelled ARS RNA was incubated with an increasing amount of purified PABP or IMP1 for 5 min at room temperature
as described in the legend of Fig 3 The samples were fractionated
on a 5% PAGE under nondenaturing conditions, and visualized by autoradiography Lane 1, samples without protein; lanes 2–9, sam-ples with an increasing amount of protein (0.9 ng increment) (C) The radioactive bands corresponding to the bound and free ARS RNA in (A) and (B) were excised by superimposing the radiograph, and the level of radioactivity was measured by scintillation counter The average ratio of the RNP complex ⁄ free RNA in each lane from three separate experiments was plotted against the amount of the protein The binding constant was calculated by determining the protein molar concentration at 50% binding efficiency [33].
Fig 4 Simultaneous binding of PABP and IMP1 with the DARS-R
RNA Approximately 0.1 ng (10 000 c.p.m.) uniformly radiolabelled
DARS-R RNA was incubated with purified 6· PABP and 6·
His-IMP1, either individually or simultaneously, for 5 min at room
tem-perature The samples were analyzed by 5% PAGE Lane 1, RNA
only; lane 2, RNA + 5 ng 6· PABP; lane 3, RNA + 5 ng 6·
His-PABP and 4.5 ng 6· His-IMP1; lane 4, RNA + 4.5 ng 6· His-IMP1.
Trang 7examined The results of our studies show that the
PABP-C domain (Fig 7A: lane 5) alone was capable
of interacting with IMP1 as efficiently as the full
length PABP (Fig 7A: lane 1) None of the RBDs of
PABP showed any binding to IMP1 (Fig 7A: lanes
2–4) Similar studies using IMP1 peptides showed that
the ability of IMP1 to dimerize resides within the
KH III-IV domains (Fig 7A: lanes 6, 9 and 10), and
other domains of IMP1 did not contribute towards its
homodimerization (Fig 7A: lanes 7 and 8)
When we used the full length PABP-matrix as the
bait, only the PABP-C domain showed ability to
homodimerize PABP (Fig 7B: lanes 1 and 5) In
addi-tion, our results show that the ability of IMP1 to bind
PABP resides within its KH III-IV domains (Fig 7B:
lane 9) The IMP1 peptide containing the KH III-IV
domains was able to bind PABP as efficiently as the peptide containing all four KH domains or the full length IMP1 (Fig 7B: lanes 6 and 10) We also per-formed binding assays using matrix-bound PABP-C and IMP1 KH III-IV peptides (Fig 7D,E) to examine whether the short peptides could pull down the inter-acting peptide partners We show here that PABP-C alone can pull down the full length PABP and IMP1 (Fig 7D: lanes 1 and 3), and also the protein interact-ing domains of PABP and IMP1 (Fig 7D: lanes 2, 4, and 5) In similar studies using IMP1 KH III-IV pep-tide as bait, we found that it can pull down both the
Fig 6 The IMP1 domain responsible for binding to the ARS
Trun-cated IMP1 polypeptides were expressed and purified from E coli
for UV cross-linking analysis with the radiolabelled ARS RNA Full
length IMP1 (lane 2), RNA recognition motifs RRM I-II (lane 3), KH
domains KH I-II (lane 4), KH III-IV (lane 5), and KH I-IV (lane 6) were
used for these studies One sample containing IMP1 (lane 1) was
analyzed without UV treatment Samples were incubated at room
temperature for 5 min After the UV treatment, the samples
were treated with RNase A ⁄ RNase T1, fractionated on a 13%
SDS ⁄ PAGE and visualized by autoradiography.
A
B
C
D
Fig 7 Interaction between PABP and IMP1 [ 35 S]methionine labelled full length or truncated version of PABP and IMP polypep-tides were incubated with IMP1 (A), PABP (B), b-Gal (C), PABP-C (D: lanes 1–5), and KH III-IV (D: lanes 6–10) conjugated agarose beads in the chromatography buffer, washed extensively with the same buffer, and the bound proteins were eluted by boiling the beads in the chromatography buffer containing 300 m M imidizole The samples were analyzed by 13% SDS ⁄ PAGE, the gel was impregnated in 1 M sodium salicylate, vacuum dried and visualized
by autofluorography.
Trang 8full length PABP and the PABP-C peptide (Fig 7D:
lanes 6 and 7) Furthermore, the IMP1 KH III-IV
pep-tide was also able to pull down the full length IMP1,
and IMP1 peptides containing the KH III-IV domains
(Fig 7D: lanes 3–5) These results confirmed that the
interaction between PABP and IMP1 is mediated by
the PABP-C and KH III-IV domains of these
polypep-tides, respectively
Discussion
We have shown in these studies that the ARS, an
A-rich translational control element in the 5¢ UTR of
PABP mRNA, interacts with PABP differently than a
comparable size RNA consisting exclusively of the
adenine base [poly(A)50] While RBD II is the main
poly(A) interacting domain [32], at least three RBDs
of PABP are required for efficient binding to the ARS
The combinations of either the RBDs I-II-III or RBDs
II-III-IV have similar affinities for the ARS It is
known that RBDs I and II have specific affinity
towards the poly(A), and RBDs III and IV bind to the
nonpoly(A) sequences [32] As such, it is not
unex-pected that the presence of at least one nonspecific
RBD is necessary to bind to the ARS, which consists
of stretches of A, C and U bases
We have shown earlier that in addition to PABP,
the ARS binds to IMP1 In these studies we have
com-pared the binding of IMP1 and PABP, and
surpris-ingly we have found that both polypeptides bind
strongly to a 22 nucleotide long CCCAAAAAAA
UUUACAAAAAA sequence located at the 3¢ end
of the ARS Furthermore, CCCAAAAAAAUUU was
found to be the minimal sequence required for binding
to both PABP and IMP1 However, this short RNA
did not bind either protein as strongly as RNAs with
additional adenine nucleotides either at the 5¢ or 3¢
ends It is possible that the flanking sequences provide
a suitable landing place for PABP and IMP1 on the
RNA In vitro RNAÆprotein binding studies showed
that other regions of the ARS do not posses a strong
affinity for either PABP or the IMP1 It is possible
that the other short regions of the ARS on their own
could form a different secondary structure, than when
they are present as a part of the entire ARS
There-fore, these short RNAs on their own may not interact
with PABP and⁄ or IMP1 We however, consider this
possibility unlikely because the RNase footprinting
analyses using the full length ARS also showed
bind-ing of IMP1 to the 3¢ end of the ARS Whether the 22
nucleotide long region of the ARS could repress
trans-lation of a reporter mRNA in vivo has not been
stud-ied yet
The results of our studies suggest that both IMP1 and PABP bind to the same region of the ARS, which implies that they could compete with each other for binding to the ARS Our results showed that in the presence of both PABP and IMP1, a heterodimeric complex was formed on the DARS-R RNA As PABP binds to the ARS more tightly than what was observed for the IMP1, it is possible that PABP may first bind
to the ARS, and interact with IMP1 In future studies
it will be interesting to examine whether the PABP peptide lacking the C-terminal IMP1 interacting domain can form a heterodimeric complex with IMP1
on the ARS RNA
How IMP1 and PABP will bind to the PABP mRNA in vivo may depend on their relative abun-dance In HeLa cells, we found that both polypeptides are almost equally abundant (results not shown) Because a large amount of cellular PABP is already bound to the 3¢ poly(A) tract of mRNA, the free IMP1 could be more abundant than the free PABP In addition, PABP and IMP1 interact with each other; as such, it is also possible that binding of either PABP or IMP1 to the ARS could attract the other partner through protein–protein interaction to form a hetero-dimeric RNAÆprotein complex Another possibility that needs further investigation is whether dimerization between PABP and IMP1 prior to binding the RNA could alter their binding site on the ARS
To understand the molecular nature of the interac-tion of IMP1 with the ARS and PABP, we examined the IMP1 domain involved in binding to the ARS and PABP We have shown here that among the two RNA binding and four KH domains of IMP1 only the
KH III-IV domain is necessary to bind both ARS RNA and PABP Because the same domain of IMP1
is involved in binding to its polypeptide partner, and the ARS, it is likely that a dynamic conformational change occurs during the formation of the heterodi-meric ARS RNAÆprotein complex Earlier studies have shown that the KH III-IV domain of IMP1 is also involved in binding to the translational control element
of insulin like growth factor mRNA [28] to repress its translation Therefore, these two domains of IMP1 have the bonafide translational repressor activity In addition, the earlier studies by Nielsen et al [34] showed that the same IMP1 domains were involved in forming mRNA granules, and localizing the repressed insulin like growth factor mRNA to specific sub-cytoplasmic domains Whether IMP1 is involved in localizing the repressed PABP mRNA to a distinct subcytoplasmic region has not been studied yet Whether the ARS-bound IMP1 interacts with PABP through the ARS has not been directly tested
Trang 9Never-theless, indirect evidence suggests that IMP1 is capable
of binding directly to PABP We have shown here that
the RNA-binding domains of PABP cannot bind
IMP1, which would be expected should the ARS RNA
be involved in the interaction between PABP and
IMP1 Therefore, we suggest that both PABP and
IMP1 bind to the ARS independently, and then
mutu-ally stabilize the RNAÆprotein complex through
pro-tein–protein interaction Moreover, it is unlikely that
any contaminating ARS-like RNA derived from
Escherichia coli in our agarose-PABP beads during its
purification from the bacterial cell extract, could have
been indirectly involved in binding IMP1, as E coli
RNA did not show any competition with the ARS
RNA in gel shift assays (results not shown)
Additional studies to characterize the IMP1
inter-acting domain of PABP showed that it resides
exclu-sively within the PABP-C domain Although RBD II
of PABP could interact with several polypeptide
part-ners including eIF4G [23], PAIP1 [16,17], and PAIP2
[18,19], the PABP-C is the main protein–protein
inter-acting domain of PABP In a previous study PABP-C
domain was shown to be indispensable for the
auto-regulation of PABP mRNA translation [35] Our
results suggest that the main function of the PABP-C
domain in translational repression may be to interact
with IMP1 to form a heterodimeric RNAÆprotein
com-plex Whether IMP1 can bind to the 3¢ poly(A) track
of all mRNA by interacting with the PABP-C domain
and plays a role in all mRNA metabolism remains to
be examined
Both in vitro and in vivo studies in our lab [15] have
shown that the ARS forms a heterotrimeric complex
with three known RNA-binding proteins, PABP,
IMP1, and UNR However, in the studies reported
here we have focused on the interaction of ARS with
PABP and IMP1, because only the IMP1 and PABP
bind to the ARS independently As UNR is a known
PABP binding protein, its presence in the
heterotri-meric ARS RNAÆprotein complex is probably through
its binding to PABP The individual role of the
poly-peptides of the heterotrimeric complex is not known
It is possible that each polypeptide participates at a
distinct step of translational control There is more to
translational control than simply preventing the
ribo-some from binding to the mRNA For a foolproof
mechanism to prevent unwanted mRNA translation,
the decision to repress translation of a specific mRNA
may be made by tagging the mRNA while it is in the
nucleus IMP1 is a known shuttle protein; therefore, it
may bind to the ARS containing mRNA in the
nuc-leus, and tag the mRNA for repression PABP may
then bind to the tagged mRNA by binding to both
ARS and IMP1 UNR is a member of the cold-shock domain containing protein family These proteins can act as ‘RNA histone’, and protect the repressed mRNA from degradation [36] Finally, the ARS– IMP1–PABP–UNR complex could form even a larger multisubunit autoregulatory complex through a series
of protein–protein interactions This multimeric com-plex would provide a stronger roadblock to stall the scanning of the mRNA by 40S ribosomal subunits than a monomeric ARS–PABP complex It is conceiv-able that a multi subunit RNAÆprotein complex needs to be formed with the translational repressor cis-element to prevent the large molecular machine such
as the 40S ribosomal subunit to read-through the translational control element
Experimental procedures
Plasmid construction Double stranded oligodeoxynucleotides encoding either poly(A)50 or various regions of the ARS (nucleotides 71–
131 of the human PABP cDNA, GeneBank ID: Y00345) were generated by annealing complementary synthetic oligonucleotide sets (Table 1; only sense sequences are given) The annealed products were digested with respective restriction enzymes (MBI Fermentas; Amherst, NY, USA), purified from a 2.5% agarose gel using the QIAquick gel extraction kit (Qiagen; Mississauga, ON, Canada), and cloned into pEGFP-N3 (Clontech-BD Biosciences; Burling-ton, ON, Canada) plasmid vectors
Protein expression constructs containing various por-tions of IMP1 (GenBank ID: NM_006546) and PABP (GeneBank ID: Y00345) open reading frames were gener-ated by using appropriate primers (Table 2 and Fig 1) The PCR products were digested with appropriate restric-tion enzymes (MBI Fermentas), purified from a 1% ag-arose gel by QIAquick gel extraction kit (Qiagen), and cloned into pDUAL-GC (Stratagene, La Jolla, CA, USA)
or pQE80L (Qiagen) expression vectors All plasmids were
Table 1 Primers used to create various ARS constructs.
Primer Sense sequence ARS EcoRI-T7-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaa
ccccaaaaaaatttacaaaaaa-BamHI
A ¨ ARS-4 EcoRI-T7-tccaaaaaaaatctaaaaaaatcttttaaaaaa
ccccaaaaaaattt-BamHI
A ¨ ARS-L EcoRI-T 7 -aaaaaatccaaaaaaaatct-BamHI
A ¨ ARS-C EcoRI-T7-tctaaaaaaatcttttaaaaaacccc-BamHI
A ¨ ARS-R EcoRI-T7-ccccaaaaaaatttacaaaaaatc-BamHI
A ¨ ARS-S EcoRI-T 7 -ccccaaaaaaattt-BamHI Poly(A) 50 EcoRI-T 7 -aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaa-BamHI
Trang 10propagated in E coli DH5a (Invitrogen, Carlsbad, CA,
USA), isolated using GenElute plasmid maxi-prep kit
(Sig-ma, Oakville, ON, Canada) and confirmed to be correct
by DNA sequencing
In vitro synthesis and radiolabelling of RNA
pEGFP-N3 plasmids containing either oligo(A)50or various
ARS region under the control of the T7RNA polymerase
promoter were linearized with BamHI, and pGEM-T vector
(Promega, Madison, WI, USA) was linearized with SalI
restriction enzyme for in vitro run-off transcription
Tran-scription reactions were usually performed at 37C for 2 h
in a final volume of 100 lL containing 10 lg of a DNA
template, 2.5 mm of each NTP, and 100 units of T7 RNA
polymerase (Promega) Uniformly radiolabelled RNA was
synthesized under similar conditions in a final reaction
vol-ume of 25 lL containing 150 lCi [32P]ATP[aP] (MP
Bio-medicals, Irvine,CA, USA) and the final concentration of
cold ATP reduced to 25 lmol The 5¢ end radiolabelled
RNA was prepared by first dephosphorylating cold RNA
using calf intestine phosphatase, followed by
phosphoryla-tion using T4 polynucleotide kinase (T4-PNK) in presence
of [32P]ATP[cP] The contaminating nucleotides,
incom-pletely transcribed products and the DNA template were
removed by fractionating transcription reaction mixtures on
13% polyacrylamide gels under denaturing conditions [37]
The amount of RNA and its specific radioactivity were
determined using a spectrophotometer and scintillation
counter, respectively
Expression and purification of 6· His-tag fusion protein
Escherichia coliDH5a transformed with pQE80L expression vector (Qiagen) containing various portions of IMP1 or PABP open reading frames (Fig 1) were grown to an early log phase and induced for 4 h with isopropyl thio-b-d-galactoside The bacterial cells were harvested and lysed with 1 mgÆmL)1of lysozyme in a lysis buffer (50 mm NaH2PO4, 500 mm NaCl,
30 mm imidizole, 13 mm 2-mercaptoethanol, 2 mm MgCl2,
1 mm phenylmethanesulfonyl fluoride, 0.5% IgepalCA-630, and 5% glycerol [pH 8.0]) at 0C for 30 min The lysate was cleared by centrifugation at 12 000 g for 5 min and the supernatant was mixed with Ni-NTA agarose beads (Qiagen) After shaking at 4C for 30 min, the beads were washed extensively with a washing buffer (50 mm NaH2PO4,
500 mm NaCl, 50 mm imidizole, 13 mm 2-mercaptoethanol,
2 mm MgCl2, 1 mm phenylmethanesulfonyl fluoride, 0.5% IgepalCA-630, and 5% glycerol [pH 8.0]) and the bound pro-teins were eluted in the elution buffer (50 mm NaH2PO4,
500 mm NaCl, 300 mm imidizole, 13 mm 2-mercaptoethanol,
2 mm MgCl2, 1 mm phenylmethanesulfonyl fluoride, 0.5% IgepalCA-630, and 5% glycerol [pH 8.0])
The protein concentration of the eluted fraction was deter-mined by a protein assay kit (Bio-Rad, Burlington, ON, Canada), and equilibrated with a storage buffer (10 mm Hepes-KOH [pH 7.5], 3 mm MgCl2, 140 mm KCl, 5% glycerol, 1 mm dithiothreitol, 0.02% Igepal CA-630, 0.5 mm phenylmethanesulfonyl fluoride, 10 lgÆmL)1 leupeptin, and
2 lgÆmL)1aprotinin) using the Microcon YM-30 concentra-tion column (Millipore, Etobicoke, ON, Canada) and stored
at)80 C in small aliquots The integrity and purity of the affinity purified polypeptide was examined by SDS⁄ PAGE The desired polypeptide band was quantified by scanning the stained gel Preparations containing more than 80% unde-graded IMP1 and PABP were used for further studies
In vitro synthesis of radiolabelled protein pDUAL-GC vector (Stratagene) containing various portions of IMP1 or PABP open reading frames (Fig 1) was linearized with KpnI and transcribed using T7 RNA polymerase system as described The contaminating nucleotides were removed by centrifugation using the Microcon YM-30 concentration column (Millipore) Approximately 0.1 lg of RNA was translated using rabbit reticulocytes lysate (Promega) containing 0.02 mm amino acids mixture and 30 lCi [35S]methionine in a total reaction volume of 100 lL (70% retic lysate) for 90 min at 30C The specific radioactivity was determined using trichloroacetic acid precipitation and the quality of translated product was analyzed on 13% SDS⁄ PAGE followed by autoradiography
RNA electrophoretic mobility shift assay For REMSA, 1–10 ng of purified protein was incubated with 0.1 ng (1 · 104
c.p.m.) of radiolabelled RNA for
Table 2 Primers used to create truncated PABP and IMP1 protein
expression vectors.
7 pDU-RBDII(s) EarI-catggatgttataaagggc
8 pDU-RBDIII(s) EarI-catgggacgatttaagtct
10 pDU-PABPC(s) EarI-catggagcgccaggctcac
11 pDU-IMP1(s) EarI-catgaacaagctttacatcg
12 pDU-KH1(s) EarI-catggtggacatcccccttcgg
13 pDU-KH3(s) EarI-catggctgctccctatagctcc
16 RBDII(as) KpnI-ttaagcttctcgttctttacg
17 RBDIII(as) KpnI-ttagcgcttaagttccgtct