Báo cáo khoa học: The Runx3 distal transcript encodes an additional transcriptional activation domain doc

The longer N-terminal region of Runx3, expressed from the distal promoter, is highly conserved among family members and across species.. We show that transcripts from the distal Runx3 pr

transcriptional activation domain

David D Chung1, Kazuho Honda2,*, Lorraine Cafuir2, Marcia McDuffie2,3and David Wotton1

1 Center for Cell Signaling and Department of Biochemistry, and Molecular Genetics, University of Virginia School of Medicine,

Charlottesville, VA, USA

2 Department of Microbiology, University of Virginia School of Medicine, Charlottesville, VA, USA

3 Department of Medicine, University of Virginia School of Medicine, Charlottesville, VA, USA

The transcriptional regulator Runx3 is expressed in

several hematopoietic cell lineages at different stages of

development, including CD8+ thymocytes and

periph-eral CD8+ T cells Two independent lines of Runx3

mutant mice, in which Runx3 targets different

molecu-lar domains, have been established via induced

muta-tions [1,2] Hematopoietic precursors from both lines

produce decreased numbers of peripheral CD8+

T cells that aberrantly coexpress CD4 [3,4] These cells fail to expand into functional cytotoxic CD8+ T-cell populations in vivo or in vitro Mutational analysis of the CD4 silencer has shown that transcriptional repres-sion in CD8+ T cells requires binding of Runx3 to runt-specific binding sites in the first intron of Cd4

Keywords

cell differentiation; runt domain; Runx3;

transcription

Correspondence

M McDuffie, University of Virginia School

of Medicine, Aurbach Medical Research

Building, Box 801390 (FedEx: room 1253),

Charlottesville, VA 22908, USA

Fax: +1 434 243 9143,

Tel: +1 434 924 1707

E-mail: mjm7e@virginia.edu

D Wotton, Center for Cell Signaling,

University of Virginia, Room 7008,

Hospital West, Hsc 800577, Charlottesville,

VA 22908, USA

Fax: +1 434 924 1236,

Tel: +1 434 243 6752

E-mail: dw2p@virginia.edu

*Present address

Department of Pathology, Tokyo Women’s

Medical University, Tokyo, Japan

(Received 5 February 2007, revised 5 April

2007, accepted 9 May 2007)

doi:10.1111/j.1742-4658.2007.05875.x

The runt family transcriptional regulator, Runx3, is upregulated during the differentiation of CD8 single-positive thymocytes and is expressed in peri-pheral CD8+ T cells Mice carrying targeted deletions in Runx3 have severe defects in the development and activation of CD8+T cells, resulting

in decreased CD8+ T-cell numbers, aberrant coexpression of CD4, and failure to expand CD8+ effector cells after activation in vivo or in vitro Expression of each of the three vertebrate runt family members, including Runx3, is controlled by two promoters that generate proteins with alter-native N-terminal sequences The longer N-terminal region of Runx3, expressed from the distal promoter, is highly conserved among family members and across species We show that transcripts from the distal Runx3 promoter are selectively expressed in mature CD8+T cells and are upregulated upon activation We show that the N-terminal region encoded

by these transcripts carries an independent transcriptional activation domain This domain can activate transcription in isolation, and contri-butes to the increased transcriptional activity observed with this isoform as compared to those expressed from the ancestral, proximal promoter Together, these data suggest an important role for the additional N-ter-minal Runx3 activation domain in CD8+T-cell function

Abbreviations

eYFP, enhanced yellow fluorescent protein; GBD, Gal4 DNA-binding domain; HDAC5, class II histone deacetylase; Ig-Ca, IgG a-chain constant region; TGF, transforming growth factor; YFP, yellow fluorescent protein.

However, the mechanism(s) by which Runx3 selectively

promotes CD8 single-positive development in the

thy-mus and the expansion of CD8+ effector cells in the

periphery is not yet clear

Runx3 is one of a large family of transcriptional

reg-ulators, closely related in both structure and function

to the Drosophila runt protein [5] Found in all animals

from worms to humans, this gene family was originally

defined by the presence of the DNA-binding runt

domain, which is essentially invariant among all family

members throughout evolution and results in similar

target-binding motifs for all family members [6] In

addition to DNA-binding affinity, nuclear import or

retention and protein half-life are also regulated

through this domain [7–11] Vertebrates have three

runt family genes, Runx1–3 (also referred to as

CBFa1–3 or PEBP2aA–C [12]) Runx3 has been

shown to recruit other transcription factors to sites of

transcriptional regulation, integrating signaling

path-ways critical for hematopoietic cell development and

activation Documented interactions include those with

transforming growth factor (TGF)-b-activated Smads

and several Ets family members, as well as repressor

complexes from the mSin3a and Groucho⁄ TLE

famil-ies [13–17] Recruitment of TLE repressor complexes

has been shown to be essential for silencing of Cd4 by

Runx3 in CD8+T cells [13]

In vertebrates, all runt family genes contain two

highly conserved alternative promoters, proximal (P)

and distal (D) The 5¢-coding sequence of invertebrate

runt family members is homologous to the sequence

controlled by the vertebrate proximal promoter,

sug-gesting that acquisition of the distal promoter was

associated with the evolution of more complex

require-ments for control of this essential developmental

regu-lator early in vertebrate evolution [6] To date, the

activity of runt family members has been characterized

primarily using transcripts generated from the

prox-imal (ancestral) promoter, with attention focused on

C-terminal functional domains Previous reports have

suggested that transcripts from the two alternative

pro-moters are differentially expressed [18,19] However,

no studies specifically testing for functional differences

between Runx3 isoforms have been published, and the

function of the longer N-terminal domain in Runx3

has not been extensively analyzed

Here we show that Runx3 transcripts from the distal

promoter are largely restricted to CD8+T cells in the

periphery, clearly distinguishing them from CD4+

T cells Additionally, splenocytes from C57BL⁄ 6 (B6)

mice selectively upregulate the transcript from the

distal promoter after culture with activating antibody

to CD3 In contrast, differences in expression of total

Runx3 transcripts in CD4+ and CD8+ T cells are small, suggesting that transcripts from the proximal promoter are unlikely to explain the marked differ-ences in dependence on Runx3 activity in the two sub-sets Analysis of the function of the longer Runx3 isoform, expressed from the distal promoter, demon-strates that the N-terminal region contains an independent transcriptional activation domain that contributes to increased transcriptional activity by this Runx3 isoform We suggest that the N-terminal activa-tion domain, encoded by transcripts from the Runx3 distal promoter, is required for normal function of per-ipheral T cells, particularly those of the CD8+subset

Results

Differential expression of Runx3 transcripts The highly homologous mouse and human RUNX3 genes are transcribed from two alternative promoters (human homolog shown in Fig 1A) Transcripts encode distinct five amino acid or 19 amino acid N-terminal sequences from the proximal (P) and distal (D) promoters, respectively (Fig 1B) A high level of sequence conservation is present within the N-termini

of proteins generated from each of the two promoters across vertebrate species, suggesting a critical func-tional distinction between the two isoforms (Fig 1C) Data from two independent targeted mutant mouse strains show that normal Runx3 activity is absolutely required for the normal development and clonal expansion of CD8+ T cells but has no detectable impact on CD4+ T-cell development or proliferation Although no disruption of CD4+ T-cell development

or activation was noted in mice carrying deletion mutations of Runx3, a recent report [20] showed that Runx3 is upregulated by the transcription factor T-bet during the functional maturation of TH1 cells, and subsequently cooperates with T-bet in the repression of interleukin-4 expression and, to a lesser degree, in the upregulation of interferon-c characteristic of this subset

Using primers binding to a sequence in the runt domain conserved among all runt family members (exon 4) and a Runx3-specific sequence in the C-termi-nus (exon 6), we compared expression levels for all full-length Runx3 transcripts in positively selected CD4+ and CD8+ splenocytes Both quantitative den-sitometry (data not shown) and real-time quantitative PCR (Fig 2A) revealed only a modest overall differ-ence in expression of Runx3 between the CD4+ and CD8+ subsets (< 1.6-fold), which seemed unlikely to explain a selective effect of Runx3 deficiency on CD8+

survival and activation We were therefore interested

to test whether there were differences in expression

from the two promoters between the CD4+ and

CD8+T-cell subsets

No primers suitable for real-time quantitative PCR

specific for transcripts from either the proximal or

distal promoter were identified, probably because of

the extremely high G⁄ C content of these exons

How-ever, we were able to amplify a 433 bp fragment from

the 5¢-UTR of the distal transcript that could be used

for quantitation through densitometry of PCR

prod-ucts on serial dilutions of template Using this method,

we found that distal transcripts are more highly

expressed in the CD8+subset, suggesting that

differen-tial effects of Runx3 deletion on CD4+ and CD8+

T cells may result selectively from loss of the Runx3

isoform generated from this promoter (Fig 2A)

With culture conditions that produced optimal B6

splenocyte proliferation at 72 h in response to

plate-bound anti-CD3, CD8+T cells reproducibly expanded

more efficiently than CD4+ T cells (Fig 2B) Forty hours after initiation of the cultures, when viable CD4+and CD8+T-cell numbers had not changed sig-nificantly from the input numbers (data not shown),

we detected only small increases in total Runx3 tran-scripts, which seemed unlikely to explain the require-ment for Runx3 in the clonal expansion or functional maturation of CD8+ T cells (Fig 2C) However, quantification of distal transcripts alone again showed

a dramatic increase in expression levels after anti-CD3 stimulation Thus, it appears that Runx3 distal tran-scripts are more highly expressed in CD8+ T cells and are specifically further upregulated on T-cell stimulation

Increased transcriptional activity from protein expressed from the distal promoter

As little was known about functional differences between the two isoforms of Runx3, we compared

A

B

C

Fig 1 Structure of the RUNX3 gene (A) The RUNX3 gene consists of seven exons Expression of alternative transcripts is regulated by TATA-less promoters upstream of exons 1 and 3 (arrows; P, proximal promoter; D, distal promoter) The two transcripts are produced from translational start sites in exon 3 (transcript 1) and exon 2 (transcript 2), resulting in protein-coding sequences (marked in gray) differing only

at the N-terminus (B) The DNA and corresponding amino acid sequences of the N-termini of the two alternative transcripts are shown The splice site between exons 2 and 3 in transcript 2 is underlined (C) An alignment of vertebrate P2-RUNX3 N-terminal sequences is shown Amino acids that are identical or similar in at least two sequences are shaded black and gray, respectively The start of the runt domain is indicated The region unique to P2-RUNX3, and the C-terminal ends of the two GBD fusions (encoding amino acids 1–31 or 1–66 of P2-RUNX3) are shown.

their ability to activate transcription of known runt

family target promoters Using clones for both

tran-scripts from the highly homologous human RUNX3

gene (Fig 1C [19]), we first tested the ability of

full-length P-RUNX3 and D-RUNX3 to activate the

p6OSE2 reporter construct This synthetic promoter,

consisting of a tandem array of six runt

domain-bind-ing sites derived from the osteocalcin gene promoter, is

a sensitive reporter for all runt family members The

activity of p6OSE2 in the presence of Flag–D-Runx3

was consistently two-fold higher than with

Flag–P-Runx3 (Fig 3A) Higher transcriptional activity of

D-RUNX3 was also observed using both Myc

epitope-tagged and unepitope-tagged expression constructs (Fig 3B,C),

ruling out possible differential effects of the N-terminal

epitope tags Both isoforms were expressed at similar

levels [a P-RUNX3⁄ D-RUNX3 ratio of 1.09 : 1 (Myc)

and 1.12 : 1 (Flag)], suggesting that this difference in

transcriptional activity was not due to differences in expression levels (Fig 3F)

Although DNA binding by all runt family members

is similar in vitro, the osteocalcin promoter is a natural target for the runt family member Runx2 in vivo To analyze transcriptional activation by P-RUNX3 and D-RUNX3 using a known RUNX3 target, we used a reporter driving luciferase expression by the IgG a-chain constant region (Ig-Ca) promoter This pro-moter is regulated by Runx3 together with TGF-b-activated Smad complexes in vivo [21,22] Although both RUNX3 isoforms enhanced the response to increasing levels of added TGF-b, D-RUNX3 increased activation of the Ig-Ca-luciferase reporter more effectively than P-RUNX3 (Fig 3D), confirming

a general increase in the activity of D-RUNX3 as com-pared to P-RUNX3 With this reporter, the difference between P-RUNX3 and D-RUNX3 was less dramatic than with p6OSE2, possibly because p6OSE2 is entirely dependent on RUNX3 for activation

Interactions between p300⁄ CBP and a C-terminal domain in RUNX3 have been shown to regulate nuclear localization and transcriptional activity of RUNX3 via acetylation of residues in and flanking the runt domain [10] Overexpression of the adenovirus E1a protein blocks numerous transcriptional responses through its dose-dependent inhibition of p300⁄ CBP activity [22] We used this titratable inhibition to deter-mine whether the two RUNX3 isoforms differed in

A

B

C

Fig 2 Selective expression of distal transcripts of Runx3 in mature, peripheral CD8+ T cells and activated splenocytes Real-time quantitative PCR (all transcripts) or densitometry of PCR prod-ucts (distal transcripts) was performed on RNA isolated from the relevant tissues in order to determine the relative representation of transcripts from the two promoters (A) RNA from bead-purified splenic CD4 + and CD8 + T cells was compared in two separate experiments on RNA from two mice (Expt 1) or RNA from a single mouse (Expt 2) A representative gel used for densitometry is shown below For each test sample: lane 1 shows a control tem-plate with no reverse transcriptase; lanes 2–4 show the results of RT-PCR on decreasing concentrations of template (B) B6 spleno-cytes from three individual 4-month-old female mice were cultured for 72 h, with or without anti-CD3 Cells were counted and ana-lyzed by flow cytometry Absolute numbers were calculated from viable total cell counts using the frequency of cells in each subset after exclusion of dead cells via 7-amino-actinomycin D staining (SD

in parentheses) (C) Runx3 expression was quantitated in RNA pooled from the splenocytes of two individual mice in each of two experiments after 40 h of culture, with or without anti-CD3 Expression was normalized by levels of 18S RNA to ensure comparisons based on equal amounts of input total RNA and is shown relative to that in CD4 + T cells (A) or unstimulated, cultured splenocytes (C).

their dependence on p300 by coexpressing P-RUNX3

or D-RUNX3 with increasing amounts of E1a As

shown in Fig 3E, transcriptional activation by both

P-RUNX3 and D-RUNX3 was inhibited equally well

by coexpressed E1a, suggesting that both depend on

p300⁄ CBP for their ability to activate transcription

To rule out a general alteration in RUNX3 activity caused by the presence of alternative N-terminal regions, we tested a selection of known RUNX3 func-tions As shown in Fig 4A, when expressed as fusions

to enhanced yellow fluorescent protein (eYFP), both RUNX3 isoforms were localized predominantly to the

Fig 3 Transcriptional activation by P-RUNX3 and D-RUNX3 HepG2 cells were transfected with the p6OSE2 luciferase reporter, together with Flag epitope-tagged P-RUNX3 and D-RUNX3 (A), Myc epitope-tagged P-RUNX3 and D-RUNX3 (B), or untagged expression vectors enco-ding P-RUNX3 and D-RUNX3 (C) (D) HepG2 cells were transfected with the Ig-Ca luciferase reporter, and either P-RUNX3 or D-RUNX3, as indicated; 18 h before analysis, cells were treated with the indicated concentration of TGF-b (E) HepG2 cells were transfected with the p6OSE2 luciferase reporter and untagged P-RUNX3 and D-RUNX3 with increasing amounts of an E1a expression plasmid Luciferase activity

in all panels is shown in arbitrary units, as the mean ± SD of duplicate transfections (F) Relative expression of transfected Myc- or Flag-tagged P-RUNX3 and D-RUNX3 was assayed by western blotting with an antibody against the Myc or Flag epitopes.

nucleus, with no apparent differences in subnuclear

localization Next, we analyzed the interaction of

RUNX3 with two known partners by

coimmunoprecip-itation from transfected cells COS1 cells were

trans-fected with expression plasmids encoding Smad3 and

Flag-tagged RUNX3, and immunocomplexes were

iso-lated on anti-Flag agarose Despite the difference in the

activation of the Ig-Ca reporter, we found no significant

differences in the ability of the two isoforms to interact

with the TGF-b-responsive Smad3, which interacts with

both p300 and RUNX3 to initiate class switching to

IgA production in B lymphocytes (Fig 4B) Activation

and stabilization of Runx3 by p300⁄ CBP can be

reversed through Runx-dependent recruitment of the

class II histone deacetylase, HDAC5, to transcriptional

complexes containing runt family proteins [10]

There-fore, we tested for interaction of HDAC5 with Runx3

using COS1 cells transfected with Myc-tagged

P-RUNX3 or D-RUNX3, with or without Flag-tagged

HDAC5 Flag immunocomplexes were analyzed for

coprecipitating RUNX3 As with the Smad3

interac-tion, we observed no significant difference in the ability

of the RUNX3 isoforms to interact with HDAC5,

sug-gesting that the potential for destabilization of RUNX3

binding through deacetylation, and the potential for

transcriptional repression through HDAC5-mediated

histone deacetylation, is similar for both isoforms

(Fig 4C) Taken together, these results imply that the

enhanced transcriptional activation by D-RUNX3 does

not simply result from altered interactions with known

binding partners or protein localization, and suggest the

possibility that the longer N-terminal region present

in D-RUNX3 contributes directly to transcriptional

activation

A novel activation domain in D-RUNX3

To analyze the transcriptional activation potential of the RUNX3 isoforms, independent of the runt domain binding to DNA, we created a series of RUNX3 fusions to the Gal4 DNA-binding domain (GBD), and tested them using a heterologous promoter Full-length P-RUNX3 and D-RUNX3 constructs, fused to the GBD, were cotransfected into HepG2 cells together with the (Gal)5-TATA-luc reporter, which contains five Gal4 operators upstream of a minimal TATA element

As seen with the Runx binding site reporters, D-RUNX3 was significantly more active than P-RUNX3, particularly at low levels of the transfected GBD fusion construct (Fig 5A) Thus, at the lowest level of transfected plasmid, GBD–D-RUNX3 increased activation more than two-fold, whereas GBD–P-RUNX3 increased activity by only 30% This suggests that transcripts from the distal promoter encode a transcriptional activation function independ-ent of DNA binding by the runt domain, or recruit-ment of additional transcriptional activators by the rest of the protein In confirmation of this, GBD fusion constructs that excluded the runt domain and everything C-terminal to it showed similar differences

in reporter activation (Fig 5B) The N-terminal region

of D-RUNX3 encompassing amino acids 1–66 activa-ted expression of the (Gal)5-TATA-luc reporter up to eight-fold, whereas the comparable P construct (amino acids 1–52; Figs 1C and 5D) performed little better than the GBD alone Further analysis of the D-RUNX3 N-terminal domain demonstrated that either the N-terminal 19 or 31 amino acids were suffi-cient to activate transcription when targeted via the

Fig 4 RUNX3 interactions with Smad3 and HDAC5 (A) RUNX3 proteins are nuclear COS1 cells were transfected with YFP fused P-RUNX3 and D-RUNX3 expression constructs Hoechst and YFP images are shown (B) COS1 cells were transfected with SMAD3 together with Flag tagged P-RUNX3 or D-RUNX3 expression constructs Protein complexes were collected on anti-Flag agarose, and coprecipitating SMAD3 was visualized by western blot (C) COS1 cells were cotransfected with Flag-tagged HDAC5 Myc-tagged P-RUNX3 or D-RUNX3, as indica-ted, and the presence of RUNX3 proteins in Flag immunocomplexes detected by Myc western blot.

GBD (Fig 5B) These constructs contain only the

most highly conserved region of the D-RUNX3

N-ter-minus (Figs 1C and 5D) Importantly, all of the

trun-cated GBD fusion constructs were expressed at very

similar levels (Fig 5D) Thus, the extreme N-terminus,

contained within amino acids 1–19 of D-RUNX3,

constitutes an independent transcriptional activation

domain that contributes to overall transcriptional

acti-vation by this RUNX3 isoform

Discussion

We have shown that transcripts from the distal Runx3

promoter are clearly more highly expressed in the

CD8+ T-cell subset than in the CD4+ subset in mice

In contrast, little difference in total Runx3 transcripts

is observed between these two cell types As Runx3 has been shown to be absolutely required for the nor-mal phenotype and function of CD8+ T cells, our results suggest that this subset may specifically require the longer D-Runx3 isoform Transcripts from the distal promoter are also selectively upregulated in splenocytes stimulated with anti-CD3, further support-ing a critical role for this Runx3 isoform in T-cell activation

Functional comparison of the proteins encoded by each transcript demonstrates that both P and D iso-forms of highly homologous human RUNX3 isoiso-forms

A

B

Fig 5 The N-terminus of D-RUNX3 contains an activation domain HepG2 cells were transfected with the (Gal)5-TATA-luc reporter, together with the indicated fusions between the GBD and P-RUNX3 and D-RUNX3 Luciferase activity was assayed and is presented as in Fig 3 (A) Increasing amounts of GBD and GBD–P-RUNX3 or GBD–D-RUNX3 fusions, encoding full length P-RUNX3 or D-RUNX3, were transfected (B) GBD alone or fusions to the N-terminal 52 amino acids of P-RUNX3 or the N-terminal 66 amino acids of D-RUNX3, and two fusions to the N-terminal 31 or 19 amino acids of D-RUNX3, were assayed as in (A) (C) The relative expression of transfected GBD, GBD–P(1–52), GBD–D(1–66), GBD–D(1–31) and GBD–D(1–19) fusions was assayed by western blot with an antibody against GBD (D) The GBD fusions used in this figure are shown schematically.

interact similarly with Smad3 and HDAC5, and that

transcriptional activation by both is dependent on the

CBP⁄ p300 complex However, we show that the D

iso-form, generated from transcripts of the distal RUNX3

promoter, is consistently more active in transcriptional

reporter assays This is true whether it is targeted to

DNA via its own runt domain or by fusion to the

heterologous Gal4 DNA-binding domain, suggesting

that differences in transcriptional activity are not due

to differences in DNA binding between the two

iso-forms Deletion analyses revealed that D-RUNX3

contains a previously uncharacterized transcriptional

activation domain within the first 19 amino acids This

domain can act in isolation, when targeted to a

pro-moter via a heterologous DNA-binding domain,

suggesting that it is a functionally independent

tran-scriptional activation domain This domain clearly

functions to enhance the activity of the more

C-terminal activation domain in Runx3 However, it is

also possible that it may have distinct functions at

specific target promoters

The N-terminal sequence encoded by distal Runx3

transcripts is highly conserved in runt family members

from vertebrate species, suggesting that the alternative

N-termini of vertebrate Runx proteins control critical

functions In support of this idea, the D isoform of the

family member Runx1 has been shown to bind with

higher affinity than the P isoform to runt

domain-binding elements from both myeloperoxidase and

T-cell receptor b-chain promoters [23] Moreover, the

two isoforms were shown to have differential effects

on precursor expansion and myeloid differentiation

during induced maturation of the promyelocytic

32Dcl.3 cell line Granulocyte colony-stimulating

factor-mediated maturation occured rapidly in 32Dcl.3

cells transfected with control vector or D-Runx1,

whereas P-Runx1 promoted ongoing expansion prior

to terminal differentiation and thus produced a

seven-fold increase in the final number of mature

granulo-cytes Interpretation of these results is complicated by

subsequent studies that showed an inverse relationship

between DNA-binding affinity and transcriptional

acti-vation for Runx1 [24] However, the clear functional

difference between isoforms of Runx1 supports the

hypothesis that selective expression of D-Runx3 in

CD8+T cells plays a critical role in the normal

func-tion of this subset

Interestingly, deletion analyses of Runx2

demonstra-ted that the 19 amino acid region in the longer isoform

of this runt family member was required for full

tran-scriptional activation in a reporter assay In contrast

to our results, however, the isolated N-terminus of the

longer Runx2, or the entire region N-terminal to the

runt domain, was only able to very weakly activate transcription of a heterologous DNA-binding element [25] Differential activation of Runx2 target genes by alternative Runx2 isoforms was also confirmed in two later studies, although the differences were promoter specific [26,27] Additionally, functional differences were seen in transgenic rescue models that tested the recovery of bone formation by each isoform in Runx2 null mice [28] More recently, the N-terminal region of the shorter Runx1 isoform has also been shown to contribute to transcriptional activation [24] Thus it appears that for all three vertebrate Runx proteins, the N-termini play a role in their ability to activate transcription

Taken together, the results of analysis of the func-tional differences between long and short isoforms of the vertebrate runt family members clearly suggest dif-ferences in overall transcriptional activity In addition, it

is likely that some specific target genes are more sensitive to these differences We hypothesize that increased expression of D-Runx3 in CD8+T cells may result simply in an overall increase in the expression of Runx3 target genes, with an increased sensitivity to signals such as TGF-b However, it is also possible that the control of CD8+T-cell development and activation may require the activation of a unique set of target genes controlled by the activation domain in D-Runx3 In either case, specific identification of D-Runx3-dependent transcriptional targets is likely to provide a productive strategy for uncovering the function of this isoform, which is specifically required for normal CD8+ T-cell development and activation

Experimental procedures

Mice C57BL⁄ 6 mice were bred and maintained in the vivarium

at the University of Virginia, using founders obtained from The Jackson Laboratory (Bar Harbor, ME) All protocols using mice were reviewed and approved by the Animal Care and Use Committee of the University of Virginia

Splenocyte culture and flow cytometry Splenocytes were processed for flow cytometry after culture for up to 72 h in modified Dulbecco’s medium containing 10% heat-inactivated fetal bovine serum, with or without with plate-bound purified anti-CD3 (145-2C11) Samples stained with allophycocyanin-labeled GK1.5 (CD4) and fluorescein isothiocyanate-labeled 53-6.72 (CD8) (BD Bio-sciences⁄ Pharmingen, San Jose, CA) were analyzed using a

FACScan cytometer equipped with cellquest software

(BD Biosciences⁄ Pharmingen)

Quantitation of RUNX3 transcripts

RNA was isolated from cells after 40 h in culture using

a QIAshredder Mini Spin Column and RNeasy Mini Kit

(Qiagen, Valencia, CA) cDNA was synthesized using the

First-Strand cDNA Synthesis Kit (GE Healthcare Life

Sciences, Piscataway, NJ) Real-time quantitative PCR for

total Runx3 transcript levels was performed in triplicate

using the QuantiTect SYBR Green RT-PCR Kit (Qiagen) in

an iCycler (Bio-Rad, Hercules, CA), with the following

prim-ers: CAGGTTCAACGACCTTCGAT (exon 4) and AGGC

CTTGGTCTGGTCTTCT (exon 6) Quantitative

determin-ation of mRNA levels from the distal promoter was

per-formed using the primers GGTGAGCCTCGTTCATTCAT

(sense) and GGTCAGACCCACTTGGTTGG (antisense) to

generate a single 433 bp product from the 5¢-UTR of the

distal promoter, followed by electrophoresis through 1%

agarose and visualization using ethidium bromide

Densito-metry of PCR products was performed using genesnap

software (SynGene, Frederick, MD) For both methods,

Runx3 transcript levels were standardized to expression of

ribosomal 18S RNA using TaqMan Ribosomal RNA

Control Reagents (Applied Biosystems, Foster City, CA)

Plasmids

An expressed sequence tag clone (IMAGE: 3615873) for

human D-Runx3 was obtained from the American Type

Culture Collection 6Myc-D-Runx3 was generated by PCR

from 6Myc-P-Runx3 (gift of Y Ito, Kyoto University,

Japan) Untagged human SMAD3 and P-Runx3 and

D-Runx3 were expressed from pCMV5 Flag-tagged P-D-Runx3

and D-Runx3 constructs were generated in a modified

pCMV5 GBD fusions were created within pM (Clontech,

Mountain View, CA) Yellow fluorescent protein (YFP)

fusions were created within a modified pCS2 vector,

containing an N-terminal enhanced eYFP tag (BD

Biosciences⁄ Pharmingen) p6OSE2-luc was a kind gift

from R Derynck (UCSF, CA) pBJ5-Flag-HDAC5 was a

gift from S Schreiber (Harvard, MA)

Luciferase assays

HepG2 cells were transfected with firefly luciferase

report-ers, a phCMVRLuc control (Promega, Madison, WI) and

Runx3 expression constructs using Exgen 500 (MBI

Fer-mentas, Hanover, MD) HepG2 cells were chosen

specific-ally because they express negligible levels of runt family

members After 48 h, promoter activity was assayed with a

luciferase assay kit (Promega), using a Berthold (Oak

Ridge, TN) LB953 luminometer Results were standardized

using renilla luciferase activity, assayed with 0.09 lm colen-terazine (Biosynth, Naperville, IL)

Immunoprecipitation and western blotting COS1 cells were maintained in DMEM with 10% bovine growth serum (Hyclone, Logan, UT) and were transfected using LipofectAmine (Invitrogen, Carlsbad, CA) Thirty-six hours after transfection, cells were lysed by sonication in

75 mm NaCl, 50 mm Hepes (pH 7.8), 20% glycerol, 0.1% Tween020, 0.5% Nonidet-P40 with protease and phospha-tase inhibitors Immunocomplexes were precipitated with Flag M2–agarose (Sigma, St Louis, MO) Following SDS⁄ PAGE, proteins were electroblotted to Immobilon-P (Millipore, Billerica, MA) and incubated with antisera spe-cific for Flag (Sigma), Smad2⁄ 3 (Chemicon, Temecula, CA), and Myc (9E10; University of Virginia, Lymphocyte Culture Center) RUNX3 levels were quantified using Alexa Fluor 680 (mouse IgG) (1 : 2000) as secondary anti-bodies Membranes were scanned and analyzed using odys-seysoftware (LI-COR)

Fluorescence microscopy COS1 cells were split onto four-well chamber slides (Nunc, Rochester, NY) and transfected with eYFP-tagged fusion proteins using Fugene 6 (Roche, Indianapolis, IN) After 22–26 h, cells were stained with Hoechst 33342 and imaged with a Zeiss (Thornwood, NY) Axiovert 135T inverted fluorescence microscope on a heated stage with YFP and 4’,6-diamidino-2-phenylindole filter sets (Omega Opticals, Brattleboro, VT) Images were visualized, captured, and converted to 8-bit.tif files with a Zeiss 32· ⁄ 0.40 objective and a Hamamatsu (Bridgewater, NJ) Orca II cooled charge-coupled device camera controlled by openlab soft-ware (Improvision, Lexington, MA)

Acknowledgements

This work was supported by the University of Virginia SCOR in Systemic Lupus Erythematosus (P50 AR45222) The authors would like to thank R Dery-nck, Y Ito and S Schreiber for generously providing plasmids

References

1 Li QL, Ito K, Sakakura C, Fukamachi H, Inoue K, Chi

XZ, Lee KY, Nomura S, Lee CW, Han SB et al (2002) Causal relationship between the loss of RUNX3 expres-sion and gastric cancer Cell 109, 113–124

2 Levanon D, Bettoun D, Harris-Cerruti C, Woolf E, Negreanu V, Eilam R, Bernstein Y, Goldenberg D,

Xiao C, Fliegauf M et al (2002) The Runx3

transcrip-tion factor regulates development and survival of

TrkC dorsal root ganglia neurons EMBO J 21,

3454–3463

3 Taniuchi I, Osato M, Egawa T, Sunshine MJ, Bae SC,

Komori T, Ito Y & Littman DR (2002) Differential

requirements for Runx proteins in CD4 repression and

epigenetic silencing during T lymphocyte development

Cell 111, 621–633

4 Woolf E, Xiao C, Fainaru O, Lotem J, Rosen D,

Negreanu V, Bernstein Y, Goldenberg D, Brenner O,

Berke G et al (2003) Runx3 and Runx1 are required

for CD8 T cell development during thymopoiesis Proc

Natl Acad Sci USA 100, 7731–7736

5 Kagoshima H, Shigesada K, Satake M, Ito Y,

Miyoshi H, Ohki M, Pepling M & Gergen P (1993)

The Runt domain identifies a new family of

hetero-meric transcriptional regulators Trends Genet 9,

338–341

6 Rennert J, Coffman JA, Mushegian AR & Robertson

AJ (2003) The evolution of Runx genes I A

comparat-ive study of sequences from phylogenetically dcomparat-iverse

model organisms BMC Evol Biol 3, 4

7 Tang YY, Shi J, Zhang L, Davis A, Bravo J,

Warren AJ, Speck NA & Bushweller JH (2000)

Energetic and functional contribution of residues in

the core binding factor beta (CBFbeta) subunit to

heterodimerization with CBFalpha J Biol Chem 275,

39579–39588

8 Zhang L, Li Z, Yan J, Pradhan P, Corpora T, Cheney

MD, Bravo J, Warren AJ, Bushweller JH & Speck NA

(2003) Mutagenesis of the Runt domain defines two

energetic hot spots for heterodimerization with the core

binding factor beta subunit J Biol Chem 278, 33097–

33104

9 Huang G, Shigesada K, Ito K, Wee HJ, Yokomizo T &

Ito Y (2001) Dimerization with PEBP2beta protects

RUNX1⁄ AML1 from ubiquitin-proteasome-mediated

degradation EMBO J 20, 723–733

10 Jin YH, Jeon EJ, Li QL, Lee YH, Choi JK, Kim WJ,

Lee KY & Bae SC (2004) Transforming growth

factor-beta stimulates p300-dependent RUNX3 acetylation,

which inhibits ubiquitination-mediated degradation

J Biol Chem 279, 29409–29417

11 Chakraborty S, Sinha KK, Senyuk V & Nucifora G

(2003) SUV39H1 interacts with AML1 and abrogates

AML1 transactivity AML1 is methylated in vivo

Oncogene 22, 5229–5237

12 van Wijnen AJ, Stein GS, Gergen JP, Groner Y,

Hie-bert SW, Ito Y, Liu P, Neil JC, Ohki M & Speck N

(2004) Nomenclature for Runt-related (RUNX)

pro-teins Oncogene 23, 4209–4210

13 Yarmus M, Woolf E, Bernstein Y, Fainaru O,

Negrean-u V, Levanon D & Groner Y (2006) GroNegrean-ucho⁄

transduc-in-like Enhancer-of-split (TLE)-dependent and

-independent transcriptional regulation by Runx3 Proc Natl Acad Sci USA 103, 7384–7389

14 Erman B, Cortes M, Nikolajczyk BS, Speck NA & Sen

R (1998) ETS-core binding factor: a common composite motif in antigen receptor gene enhancers Mol Cell Biol

18, 1322–1330

15 Miyazono K, Maeda S & Imamura T (2004) Coordinate regulation of cell growth and differentiation by TGF-beta superfamily and Runx proteins Oncogene 23, 4232–4237

16 Lutterbach B, Westendorf JJ, Linggi B, Isaac S, Seto E

& Hiebert SW (2000) A mechanism of repression by acute myeloid leukemia-1, the target of multiple chro-mosomal translocations in acute leukemia J Biol Chem

275, 651–656

17 Javed A, Guo B, Hiebert S, Choi JY, Green J, Zhao

SC, Osborne MA, Stifani S, Stein JL, Lian JB et al (2000) Groucho⁄ TLE ⁄ R-esp proteins associate with the nuclear matrix and repress RUNX (CBF(alpha)⁄ AML ⁄ PEBP2(alpha) dependent activation

of tissue-specific gene transcription J Cell Sci 113(12), 2221–2231

18 Rini D & Calabi F (2001) Identification and comparat-ive analysis of a second runx3 promoter Gene 273, 13–22

19 Bangsow C, Rubins N, Glusman G, Bernstein Y, Negreanu V, Goldenberg D, Lotem J, Ben-Asher E, Lancet D, Levanon D et al (2001) The RUNX3 gene) sequence, structure and regulated expression Gene 279, 221–232

20 Djuretic IM, Levanon D, Negreanu V, Groner Y, Rao

A & Ansel KM (2007) Transcription factors T-bet and Runx3 cooperate to activate Ifng and silence Il4 in T helper type 1 cells Nat Immunol 8, 145–153

21 Hanai J, Chen LF, Kanno T, Ohtani-Fujita N, Kim

WY, Guo WH, Imamura T, Ishidou Y, Fukuchi M, Shi

MJ et al (1999) Interaction and functional cooperation

of PEBP2⁄ CBF with Smads Synergistic induction of the immunoglobulin germline Calpha promoter J Biol Chem 274, 31577–31582

22 Park SR, Seo GY, Choi AJ, Stavnezer J & Kim PH (2005) Analysis of transforming growth factor-beta1-induced Ig germ-line gamma2b transcription and its implication for IgA isotype switching Eur J Immunol

35, 946–956

23 Telfer JC & Rothenberg EV (2001) Expression and function of a stem cell promoter for the murine CBFalpha2 gene: distinct roles and regulation in natural killer and T cell development Dev Biol 229, 363–382

24 Liu H, Carlsson L & Grundstrom T (2006) Identi-fication of an N-terminal transactivation domain of Runx1 that separates molecular function from global differentiation function J Biol Chem 281, 25659– 25669