Báo cáo khoa học: Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference pptx

Double-stranded RNA, corresponding to the mature Pem-GIH sequence, can trigger a decrease in Pem-GIH transcript levels both in eyestalk ganglia and abdominal nerve cord explant culture a

of Penaeus monodon and elucidation of its inhibitory role

in vitellogenin expression by RNA interference

Supattra Treerattrakool1, Sakol Panyim1,2, Siu-Ming Chan3, Boonsirm Withyachumnarnkul4,5and Apinunt Udomkit1

1 Institute of Molecular Biology and Genetics, Mahidol University, Nakhon Pathom, Thailand

2 Department of Biochemistry, Mahidol University, Bangkok, Thailand

3 School of Biological Sciences, The University of Hong Kong, China

4 Department of Anatomy, Mahidol University, Bangkok, Thailand

5 Centex Shrimp, Mahidol University, Bangkok, Thailand

Female reproduction in crustaceans is controlled by an

elaborate endocrine system The prominent cellular

activity that occurs during ovarian development is

known as vitellogenesis, which is the process whereby

vitellogenin (Vg), a yolk protein precursor, is

accumu-lated in the developing oocyte [1] Vitellogenesis is an

essential step in ovarian maturation Vg can be

synthe-sized in the ovary and⁄ or other nonovarian sites such

as the hepatopancreas [2–5] Vg synthesis and ovarian

maturation are regulated by an eyestalk endocrine

factor referred to as vitellogenesis-inhibiting hormone (VIH) or gonad-inhibiting hormone (GIH) [6,7] Gonad-inhibiting hormone is a member of the neu-ropeptide family that is synthesized in neuroendocrine cells located in the eyestalk medulla terminalis gangli-onic X-organ Once produced, these neuropeptides are transported to the axon terminals that form a neuro-haemal organ called the sinus gland, from where they are secreted [8] This hormone family is known as the CHH family Mature peptides of CHH family

Keywords

black tiger shrimp; ovarian maturation;

reproduction; RNA interference;

vitellogenesis

Correspondence

A Udomkit, Institute of Molecular Biology

and Genetics, Mahidol University, Salaya

Campus, Nakhon Pathom 73170, Thailand

Fax: +66 2 441 9906

Tel: +66 2 800 3624, ext 1236

E-mail: staud@mahidol.ac.th

(Received 16 November 2007, revised 18

December 2007, accepted 25 December

2007)

doi:10.1111/j.1742-4658.2008.06266.x

One of the important peptide hormones that control reproduction in crus-taceans is gonad-inhibiting hormone (GIH) GIH is known to modulate gonad maturation by inhibiting synthesis of vitellogenin (Vg), the precursor

of yolk proteins In this study, a cDNA encoding a GIH (Pem-GIH) from the eyestalk of Penaeus monodon was cloned using RT-PCR and RACE techniques Pem-GIH cDNA is 861 bp in size with a single ORF of 288 bp The deduced Pem-GIH consists of a 17-residue signal peptide and a mature peptide region of 79 amino acids with features typical of type II peptide hormones from the CHH family Pem-GIH transcript was detected in eye-stalk, brain, thoracic and abdominal nerve cords of adult P monodon The gonad-inhibiting activity of Pem-GIH was investigated using the RNA interference technique Double-stranded RNA, corresponding to the mature Pem-GIH sequence, can trigger a decrease in Pem-GIH transcript levels both in eyestalk ganglia and abdominal nerve cord explant culture and in female P monodon broodstock The conspicuous increase in Vg transcript level in the ovary of GIH-knockdown shrimp suggests a negative influence for Pem-GIH on Vg gene expression, and thus implies its role as

a gonad-inhibiting hormone This is the first report to demonstrate the use

of double-stranded RNA to elucidate the function of GIH in P monodon

Abbreviations

CHH, crustacean hyperglycemic hormone; GIH, gonad-inhibiting hormone; MIH, molt-inhibiting hormone; RT, reverse transcription;

Vg, vitellogenin; VIH, vitellogenesis-inhibiting hormone.

members generally have 78–83 amino acid residues

with a molecular mass of 8–9 kDa These hormones

contain six cysteine residues that are aligned in

con-served positions [9,10] The CHH family can be

divided into two types, type I and type II, as reflected

by their primary structure [11–13] The most abundant

hormone in this family, crustacean hyperglycemic

hor-mone (CHH), belongs to type I, whereas the other two

hormones, molt-inhibiting hormone (MIH) and GIH,

are categorized in type II CHH or type I contains in

its precursor sequence a short peptide called

CHH-pre-cursor-related peptide followed by a dibasic

residue-processing site By contrast, type II hormones are

preceded directly by the signal peptides In addition,

alignment of the amino acid sequence reveals deletion

of the amino acid glycine at the fifth position after the

first cysteine residue in type I peptides

Compared with CHH and MIH, only a limited

number of GIH have been characterized to date The

first peptide with in vivo GIH activity was isolated

from the American lobster Homarus americanus [14]

Another peptide that has been shown to depress Vg

mRNA expression in the ovary fragment is the

Pej-SGP-III of Marsupenaeus japonicus [15] Likewise, a

similar approach was used to assay VIH activity in the

crayfish Procambarus bouvieri [16] MIH-B from the

shrimp Metapenaeus ensis, although capable of

extend-ing the moltextend-ing cycle, may be considered as another

candidate for GIH because the mRNA levels of this

peptide decrease sharply during the early phase of

gonad maturation and increase continuously as the

vitellogenic stages proceed [17] The cDNA encoding

GIH-like peptide is also found in a few other species

such as the Norway lobster Nephrops norvegicus [18]

and the prawn Macrobrachium rosenbergii [19] How-ever, whether the peptides encoded by these cDNAs function as GIH needs further verification

In this study, a cDNA encoding GIH from Penaeus monodonand its potential role in vitellogenesis were studied Functional knockdown of Pem-GIH by double-stranded (ds)RNA was applied to demonstrate the negative effect on Vg expression in the ovary of previtellogenic adult female and thus provides evidence for its role as a GIH

Results

Cloning and characterization of Pem-GIH cDNA

A partial 3¢ cDNA sequence encoding GIH from

P monodon (Pem-GIH) was amplified by several sets

of degenerate primers (Fig 1) designed from the con-served amino acid sequences of type II hormones in the CHH family Nucleotide sequence analysis revealed that 7 of 213 recombinant clones harbored GIH-like nucleotide sequences, as judged by a unique feature of the amino acid sequences at the C-terminus, which are longer than and different from that of MIHs To obtain the 5¢ region of this cDNA, a set of specific primers was designed from the 3¢ sequence of the cDNA as described in the Experimental procedures In addition, full-length cDNA was amplified with specific primers, as shown in Fig 1 The nucleotide sequences

of the full-length Pem-GIH cDNA of eight individual recombinant clones were sequenced, and confirmed as representing identical clones Fig 2 shows the nucleo-tide sequence of Pem-GIH cDNA (GenBank accession

no DQ643389) and its deduced amino acid sequence

10 0 bp

PR T

PM 1

5′RACE-GIH1.1

ma tGIH F / T7-mat GI HF

GI HR

ma tG IH R / T7 -m at GI HR

10 0 bp

PR T

PM 1

3′RACE-GIH1A

3′RACE-GIH1 B

PRT

PM1

5′RACE-GIH1

5′RACE-GIH2

5′RACE-GIH 3

GIHF

ma tGIH F / T7-mat GI HF

GI HR

ma tG IH R / T7 -m at GI HR

Fig 1 Schematic diagram showing the structure of Pem-GIH cDNA and locations of the primers used in this study The 5¢- and 3¢-UTRs are shown as a thin line The ORF is depicted by boxes: the unfilled box represents the signal peptide and the filled box represents the mature peptide.

The full-length cDNA encoding the putative GIH

of P monodon was composed of 861 nucleotides

containing a 5¢-UTR (93 bp), an ORF (288 bp), a stop

codon (TGA) and a 3¢-UTR (477 bp) with a potential

polyadenylation signal AATAAA located 7 bp

upstream of the poly(A) tail The ORF of Pem-GIH

codes for a protein of 96 amino acid residues The

sig-nal peptide, predicted using the sigsig-nalp 3.0 server

(http://www.cbs.dtu.dk/services/SignalP), consisted of

17 amino acids, whereas the remaining 79 amino acids

comprised the mature Pem-GIH peptide The deduced

amino acid sequence of putative Pem-GIH showed the

conservation of six cysteine residues in the mature

pep-tide with a glycine residue at the fifth position after

the first cysteine Mature Pem-GIH showed 68%

amino acid identity with the GIH of M ensis, but 45

and 48% amino acid identity with that of H

americ-anus(Hoa-GIH) and N norvegicus (Nen-GIH),

respec-tively (Fig 3)

Tissue-specific expression of Pem-GIH

Pem-GIHexpression in several P monodon tissues was

examined by RT-PCR using a pair of primers specific

for Pem-GIH cDNA GIH transcripts at the expected

size of 385 bp were detected in the eyestalk ganglia,

brain, thoracic nerve cord and abdominal nerve cord

of individual shrimp No GIH transcript was found in

other tissues examined This expression profile is

simi-lar to that of Mee-GIH expression in mature female

M ensis [17] Interestingly, expression of Pem-GIH in

these tissues was found in both male and female of adult and adolescent P monodon (Fig 4)

dsRNA-induced Pem-GIH knockdown in shrimp explant culture

The role of Pem-GIH was investigated by dsRNA-mediated gene silencing via RNAi, using dsRNA spe-cific to the Pem-GIH The coding sequence for mature Pem-GIH was used as template in the synthesis of specific dsRNA The efficacy of this GIH-dsRNA to knockdown GIH expression was first deter-mined in GIH-expressing tissues Briefly, eyestalk XOSG neurons and abdominal nerve cord explant were cultured in a medium that contained GIH-dsRNA RT-PCR results showed barely detectable levels of GIH transcript in the GIH-dsRNA-treated eyestalk XOSG culture from adult female shrimp after

3 h (Fig 5A) indicating that GIH expression could be efficiently inhibited by GIH-dsRNA Similar results were also seen when abdominal nerve cord from either adult or adolescent female shrimp was incubated with GIH-dsRNA for 3 and 6 h (Fig 5B,C) By contrast, the irrelevant dsRNA, GFP-dsRNA, failed to knock-down Pem-GIH mRNA expression as the abdominal nerve cord incubated with GFP-dsRNA expressed similar levels of Pem-GIH transcript to that of the control sample into which no dsRNA was added These results indicated that GIH-dsRNA was capable

of triggering sequence-specific knockdown of Pem-GIH expression in shrimp explant culture, and thus

Fig 2 Nucleotide and deduced amino acid sequences of Pem-GIH The amino acids are presented as one-letter symbols and shown below their codons in each line The highlighted amino acid sequence represents the putative mature peptide region An asterisk marks the stop codon The putative polyadenylation site is underlined The num-bers on the left and right of the sequences show the coordinate of nucleotides and amino acids in corresponding lines.

was a potent tool for functional study of Pem-GIH in

the shrimp

Biological assay for vitellogenesis-inhibiting

activity of Pem-GIH by dsRNA-mediated

functional knockdown

To test whether the knockdown of Pem-GIH

sion by dsRNA would interfere with Vg gene

expres-sion, previtellogenic adult female P monodon were injected with GIH-dsRNA and the level of Pem-GIH expression as well as the expression of Vg transcript in the shrimp was determined by RT-PCR

In order to determine the silencing effect of GIH-dsRNA in the shrimp, eyestalk ganglia were collected from previtellogenic adult P monodon on day 3, 5 and

7 subsequent to GIH-dsRNA injection The results (Fig 6A) show that 3 days after dsRNA injection,

Actin Pem-GIH

bp

500

400

A

Adult B

Adolescent Male

D

Actin Pem-GIH

500

400

M E S B T G N c H Hp M - v e M E S B T G N c H Hp M - v e

M E S B T G N c H Hp M - v e

M E S B T G N c H Hp M - v e

Female C

Fig 4 Expression of Pem-GIH in different tissues of P monodon RT-PCR products were amplified from the total RNA of eyestalk (ES), brain (B), thoracic nerve (TG), abdominal nerve cord (Nc), heart (H), hepatopancreas (Hp) and muscle (M) using the specific primers for the 5¢-region of Pem-GIH The negative PCR is indicated by )ve The actin transcript of P monodon was used as an internal control of the amount of RNA template Each panel shows tissue distribution of Pem-GIH in adult female (A), adult male (B), adolescent female (C) and adolescent male (D) The identity of RT-PCR products was confirmed by DNA sequencing.

Fig 3 Alignment of Pem-GIH with GIH and MIH from other species of crustacean The deduced amino acid sequence of GIH from

P monodon (Pem-GIH; this study) is aligned with GIHs of M ensis (Mee-GIH; AF294648), H americanus (Hoa-GIH; X87192), N norvegicus (Nen-GIH; AF163771) and MIHs of P monodon (Pem-MIH1; AAR89516 and Pem-MIH2; AAR89517), M japonicus (Pej-sgp-IV; BAA20432),

M ensis (Mee-MIH; AAC27452), L vannamei (Liv-MIH1; AAR04348) and F chinensis (Fec-MIH; AAL55258) Sequence identities are high-lighted in black color, and light gray depicts the conservative changes The percent identity of the pro- and mature sequences between Pem-GIH and other hormones was shown on the right to the C-terminus of the sequences.

shrimp administered with GIH-dsRNA showed

drasti-cally reduced Pem-GIH transcript levels in the eyestalk

ganglia when compared with control shrimp injected

with Tris⁄ NaCl only This comprehensive silencing

lasted until day 5 before the expression of Pem-GIH

began to recover to some extent on day 7 Moreover,

expression of two other related genes, Pem-CHH1 and

Pem-MIH1 of P monodon, did not change in

GIH-knockdown shrimp when compared with control shrimp (Fig 6B), suggesting the specificity of Pem-GIH silencing by GIH-dsRNA Subsequently, the consequence of the depletion in GIH transcript on Vg synthesis was investigated on day 5 after GIH-dsRNA injection Fig 7 shows that the Vg transcription level was increased more than ninefold in the ovary of GIH-knockdown previtellogenic adult shrimp when

3 h

dsGIH –ve

Pem-GIH Actin

A

– +

Pem-GIH Actin

C

0 h dsGIH

3 h

Shrimp #2

dsGFP dsGIH

6 h

– + + dsGFP dsGIH

3 h

dsGFP dsGIH

6 h

dsGFP –ve

Shrimp #1

Pem-GIH

Actin

dsGIH dsGFP

3 h

dsGIH dsGFP – + + – + +

Fig 5 Expression of Pem-GIH in shrimp explant culture after incubating with GIH-dsRNA The eyestalk ganglia and abdominal nerve cord were dissected from live shrimp and incubated in modified M199 culture medium with or without the specified dsRNA The Pem-GIH and actin transcripts were detected by RT-PCR at the indicated time points (A) Expression of Pem-GIH in the eyestalk ganglia of adult female shrimp at 3 h after incubating without ( )) or with (+) GIH-dsRNA (B) Expression of Pem-GIH in the abdominal nerve cord of adult female shrimp at 3 and 6 h after incubating without ( )) or with (+) GIH-dsRNA or GFP-dsRNA as indicated (C) Expression of Pem-GIH in the abdom-inal nerve cord of two adolescent female shrimp at 3 and 6 h after incubating without ( )) or with (+) GIH-dsRNA or GFP-dsRNA as indicated )ve in (A–C) depicts the negative PCR.

B dsGIH M

Pem-GIH

Actin

700

500

bp B M dsGIH

Pem-CHH1

Actin

500

bp

B M dsGIH

Pem-MIH1 Actin

800

500

bp

Pem-GIH Actin

800 bp

500 bp

1 2 3 4 5 Buffer M 1 2 3 4 5 6 GIH-dsRNA

Day 3

Pem-GIH Actin

800 bp

500 bp

1 2 3 4 5 1 2 3 4 5 6

Day 5

800 bp

500 bp

Day 7

Pem-GIH Actin

1 2 3 4 5

1 2 3

A

B

Fig 6 Time-course and specificity of Pem-GIH silencing by dsRNA in shrimp (A) Previtellogenic adult female P monodon were injected with Tris ⁄ NaCl or 3 lg GIH-dsRNA ⁄ g body weight of shrimp Eyestalk ganglia were collected from both groups of shrimp at day 3, 5 and 7, and Pem-GIH transcripts were detected by RT-PCR Numbers represent individual shrimp in each group (B) Representative of agarose gel showing levels of Pem-GIH, Pem-CHH1 and Pem-MIH1 transcript in previtellogenic adult female shrimp detected by RT-PCR The expression

of Pem-GIH, Pem-CHH1 and Pem-MIH1 was examined in shrimp injected with Tris ⁄ NaCl (B) and GIH-dsRNA (dsGIH) on day 5 following GIH-dsRNA injection For (A) and (B), actin transcript was amplified as internal control and M represent 100 bp ladder DNA marker.

compared with that in control shrimp The increase in

the ratio of Vg to actin transcripts in the GIH-depleted

background suggested that functional knockdown of

Pem-GIH led to the induced expression of Vg in the

ovary

Discussion

Because of the lack of information on the GIH in

pen-aeid shrimp, the attempt to clone GIH cDNA from

P monodon in this study was carried out using a

RACE approach with degenerate primers designed

from the conserved amino acid sequences among

MIH⁄ GIH from other species of crustaceans To

increase the possibility of obtaining the GIH cDNA of

P monodon, codons preferably used for CHH

(GenBank accession nos AF233295, AY346379 and

AY346380) and MIH (GenBank accession nos

AY496454 and AY496455) genes of this species were

also taken into consideration for primer design In

addition, mRNA from eyestalk neurons of adult female

P monodon at different vitellogenic stages as

deter-mined by gonadal somatic index were used as the

tem-plate for cDNA cloning in this study This is based on

a previous study which showed high levels of GIH

mRNA in the sinus gland during previtellogenesis

and vitellogenesis [20] A putative GIH cDNA of

P monodon (Pem-GIH) was successfully cloned using

the aforementioned strategy The deduced amino acid sequence of putative GIH from P monodon possesses all the characteristics in agreement with a type II hormone from the CHH family [11–13] Moreover, the C-terminus of Pem-GIH had an extension of two amino acid residues when compared with that of MIH This is consistent with previously identified GIHs from other crustacean species (Fig 3) Pem-GIH cDNA was thus subsequently examined for its gonad-inhibiting function by using a RNA interference (RNAi) technique

RNAi, a post-transcription gene-silencing process in which dsRNA triggers sequence-specific suppression of its cognate mRNA [21], is a powerful tool for studying gene function [22–24] In P monodon, a dsRNA-induced gene-silencing phenomenon has been recently demonstrated [25], therefore it was selected as a tool for studying the functional knockdown of Pem-GIH cDNA

in this study GIH-specific dsRNA was synthesized from

a 240 bp coding region of the mature Pem-GIH The use of long dsRNA provides the possibility of generating more varieties of effective siRNA (21–23 nucleotides) molecules Nevertheless, the nonspecific silencing, known as off-target phenomenon, may also occur from these diverse siRNA products of the long dsRNA [26,27] To minimize this off-target silencing, the GIH-dsRNA sequence was used to search for a pos-sible region of 21–23 consecutively identical nucleotides

in the sequences of all P monodon CHH and MIH A nucleotide sequence comparison revealed no such region (data not shown) in either CHHs or MIHs, suggesting that the GIH-dsRNA should direct sequence-specific silencing of Pem-GIH with a minimal off-target effect

on other related genes Indeed, this was clearly showed

by the result in Fig 6B in which the shrimp adminis-tered with GIH-dsRNA still expressed CHH and MIH

at the level comparable with that of the control shrimp The efficacy of GIH-dsRNA to silence Pem-GIH expression was manifested by the dramatic depletion in Pem-GIH mRNA level in shrimp eyestalk ganglia and abdominal nerve cords as early as 3 h after incubating with GIH-dsRNA This silencing was not affected by irrelevant dsRNA, thus indicating that Pem-GIH knockdown occurred in a sequence-specific fashion Similar specific silencing of Pem-GIH by GIH-dsRNA was also demonstrated in adolescent female P monodon (Fig S1) Accordingly, any biological changes observed following GIH-dsRNA injection may be considered the consequence of Pem-GIH knockdown

To date, no conclusive evidence about the mode of action of GIH on vitellogenesis has been established Recently, the recombinant vitellogeneis-inhibiting hormone (VIH or GIH) of H americanus has been

GIH/actin

Buffer

GIH dsRNA

GIH/actin

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

1.8

Vg/actin

Vg/actin

Fig 7 Influence of GIH-dsRNA on Pem-GIH and Vg expression in

previtellogenic adult female shrimp Shrimp were injected with

Tris ⁄ NaCl or GIH-dsRNA Eyestalk ganglia and ovaries were

col-lected at 5 days after injection to examine for Pem-GIH and Vg

mRNA levels, respectively, by RT-PCR The graph represents

rela-tive expression levels of Pem-GIH compared with actin levels that

were quantified using the SCION IMAGE program Values are shown

as mean ± SEM (n = 5) Relative amounts of Pem-GIH⁄ actin

tran-script in both the control (Tris ⁄ NaCl-injected) and

GIH-dsRNA-injected shrimp are represented by gray bars (P < 0.01), whereas

those of Vg ⁄ actin transcript in both groups of shrimp are shown by

white bars (P < 0.05).

reported for its biological activity to inhibit Vg mRNA

synthesis in the ovary of heterologous species, M

japo-nicus[28] In addition to the ovary, hepatopancreas has

been revealed as another site for Vg synthesis in shrimp

[29,30] Although the function of Vg originating from

the hepatopancreas has not been clearly evidenced, it

has been shown that Vg expression in the

hepatopan-creas is correlated with ovarian maturation [31] After

synthesis in the hepatopancreas, Vg undergoes

post-translational processing into smaller subunits by a

sub-tilisin-like endoprotease, these subunits are then

released into the hemolymph These hemolymph Vg

subunits are further processed by an unidentified

enzyme before being sequestered by the ovary, and

form yolk protein (vitellin) subunits [32] The induced

ovarian Vg expression of GIH-knockdown

previtello-genic adult P monodon evidently indicates the

inhibi-tory function of Pem-GIH on Vg gene expression in the

ovary Our results are in concurrence with an increase

in Vg expression after eyestalk ablation in M japonicus

[33,34] and L vannamei [35] In addition, the level of

Vg expression in hepatopancreas was not appreciably

affected following dsRNA-mediated knockdown of

Pem-GIH (data not shown) This is not unanticipated

because Vg synthesis was not induced in

hepatopan-creas of eyestalk-ablated shrimp either, especially

within the first 7 days following eyestalk ablation [33]

In addition, Okumura et al showed that the Vg mRNA

level increased slowly in hepatopancreas at the start of

vitellogenesis in naturally mature female of M

japoni-cus, compared with that in the ovary [36] Empirically,

our results support the postulation that ovarian Vg is

required for early maturation of the ovary in

crusta-ceans [5] and conform well to the precocious ovarian

development after the main source of GIH synthesis

was removed by eyestalk extirpation [37]

Although a similar strategy was used to analyze the

function of CHH cDNA from L schmitti [38], the

effect of CHH silencing on glucose level was

deter-mined at 24 h after dsRNA injection Our study

clearly demonstrates that the effect of dsRNA silencing

is effective for at least 5 days in shrimp, which

pro-vides further benefit to the use of dsRNA for analysis

of genes whose function has long-term physiological

influence

Although the function of GIH has been studied

mainly in female crustaceans, expression of Pem-GIH

in male P monodon, which is similar to previous

reports [17,39], implies that GIH may play a more

ver-satile role in the male as well Eyestalk ablation in the

crayfish Cherax quadricarinatus resulted in an

overex-pression of androgenic gland polypeptides, which had

a direct effect on male reproductive system [40]

Whether Pem-GIH is involved in reproduction in male

P monodonneeds further investigation

In summary, this study identified and characterized Pem-GIHcDNA of P monodon in both molecular and biological aspects The system of a functional–knock-down study was exploited using GIH-specific dsRNA, and revealed, for the first time, the influence of Pem-GIH on vitellogenin transcript levels in the ovary, which directly linked GIH to expression of Vg mRNA Finally, our results demonstrated that dsRNA-medi-ated gene silencing has a potential as a powerful tool for functional study of other genes in crustaceans

Experimental procedures

Animals

Wild adult female P monodon, at different vitellogenic stages, were caught from the Gulf of Thailand, Chonburi Province, Thailand They were used in cDNA cloning experiments Previtellogenic adult female P monodon used for the GIH functional assay were domesticated shrimp

Thailand)

Experiments involving animals were carried out in accor-dance with animal care and use protocol of the Mahidol University Animal Care and Use Committee (MUACUC)

Total RNA preparation and first-strand cDNA synthesis

Eyestalk neurons were dissected from individual eyestalks

of adult female shrimp at various stages of reproductive

Research Center, Cincinnati, OH, USA) Total RNA of eyestalks was extracted by using TRI-REAGENT accord-ing to instructions of the manufacturer’s protocol

The reverse transcription (RT) step was performed with ImProm-II reverse transcriptase (Promega, Madison, WI, USA) according to the manufacturer’s protocol using

500 nm of oligo(dT)16 or PRT primer (5¢-CCGGAATTC AAGCTTCTAGAGGATCCTTTTTTTTTTTTTTTT-3¢) to prime cDNA synthesis at 42C for 60 min

RACE

The degenerate primers used in 3¢-RACE of Pem-GIH cDNA were designed from the conserved amino acid sequences of MIH⁄ GIH from several species of crustacean

In the first round of PCR, a 1 lL aliquot of cDNA was amplified with 3¢-RACE-GIH1A [5¢-TG(TC)(AC)CIGGIG TIATGGG(TC)AAC(AC)GIGA-3¢] and PM1 (5¢-CCGG AATTCAAGCTTCTAGAGGATCC-3¢) primers in 25 lL

of a reaction mixture containing 10 mm Tris⁄ HCl pH 9.0,

50 mm KCl, 0.1% Triton X-100, 1.5 mm MgCl2, 200 nm of

each primer, 200 lm each of dATP, dCTP, dGTP, dTTP

and 1.25 units of Taq DNA Polymerase in storage buffer B

(Promega) Amplification was performed in a DNA thermal

cycler (GeneAmp System 2400; PE Applied Biosystems,

Foster City, CA, USA) with 35 cycles of 94C for 30 s,

50C for 30 s and 74 C for 1 min followed by 7 min

incu-bation at 74C as a final extension Subsequently, nested

amplification was performed with 200 nm of

(TC)(GA)AIAA(AG)GT-3¢] and PM1 primers to obtain the

specific product

For 5¢-RACE, first-strand cDNA synthesis was

per-formed in a reaction as described above, except that 1 lm

of 5¢-RACE-GIH1 primer (5¢-CCACGGCCGGCCGGC

ATTGAG-3¢) was substituted for PRT primer The reaction

was carried out using two-step RT The first RT step was

denatured again at 83C for 3 min and then immediately

on ice for 5 min For the second RT step, 1 lL of

ImProm-II reverse transcriptase was added to the reaction The

reaction was incubated at 50C for 60 min and then

degraded with RNaseH before proceeding with cDNA

purification by QIAquick PCR Purification Kit (Qiagen,

Hilden, Germany) A 20 lL aliquot of purified cDNA was

tailed with dATP in 30 lL of 100 mm cacodylate buffer

(pH 6.8), 1 mm CoCl2, 0.1 mm dithiothreitol, 200 lm dATP

and 20 units of terminal deoxynucleotidyl transferase (TdT)

(Promega) The reaction was incubated at 37C for 20 min

and TdT was heat-inactivated at 65C for 10 min The first

round PCR with 3 lL of the dA-tailed cDNA template was

carried out as described for 3¢-RACE using 200 nm of

5¢-RACE-GIH2 (5¢-GGCCTCGCGCTTGGCCGAGTG-3¢)

and PRT primers, except that annealing was performed at

200 nm of 5¢-RACE-GIH3 (5¢-TCGATTTCTGCACAAGC

CATCCAGCTG-3¢) and PM1 primers to obtain specific

amplified product

Amplification of full-length Pem-GIH cDNA

Total RNA extracted from one pair of eyestalks from an

adult female shrimp in stage IV of vitellogenesis, as

described above, was used to synthesize a cDNA template

for the cloning of full-length cDNA of Pem-GIH A 1 lL

aliquot of cDNA was amplified with GIHF (5¢-GAACGTC

TCGTATAAAAGGTCTGCG-3¢) and GIHR (5¢-GGTCG

ACTTTATTTTAACGGAAAATTAAT-3¢) primers in a

25 lL reaction containing 1· Phusion HF buffer including

1.5 mm MgCl2, 500 nm of each primer, 200 lm each of

dATP, dCTP, dGTP, dTTP and 0.25 units of Phusion

DNA Polymerase (Finnzymes, Espoo, Finland)

Amplifica-tion was performed in a DNA thermal cycler (GeneAmp

System 2400; PE Applied Biosystems) with 35 cycles of

98C for 10 s, 50 C for 30 s and 72 C for 1 min followed

by 7 min incubation at 72C as a final extension

RT-PCR

To detect tissue-specific expression of Pem-GIH, total RNA extracted from several P monodon tissues, including eye-stalks, brain, thoracic nerve cord, abdominal nerve cord, heart, hepatopancreas, ovary and muscle, was used as a template for RT with PRT primer as described above The specific transcript of Pem-GIH was amplified with GIHF and 5¢-RACE-GIH1 primers to detect Pem-GIH transcript level in all experiments The reaction was amplified with

35 cycles of 94C for 30 s, 50 C for 30 s and 74 C for

1 min followed by 7 min incubation at 74C as a final extension To detect Vg transcript in the ovary, Vg-F

(5¢-AAGCTTGGCAATGTATTCCTTTT-3¢) primers desig-ned from the EST clone containing Vg sequence from

P monodonovary (GenBank accession no EE332453) were used in a reaction with 32 cycles of 94C for 30 s, 50 C for 30 s and 74C for 1 min followed by 7 min incubation

at 74C The actin transcript was amplified with PmActin-F (5¢-GACTCGTACGTCGGGCGACGAGG-3¢) and

primers in a reaction with 21 cycles of 94C for 30 s,

55C for 30 s and 74 C for 1 min followed by further incubation at 74C for 7 min The expected sizes of Pem-GIH, Vg and actin transcripts are 385, 354 and

539 bp, respectively

Preparation of GIH-dsRNA Production of GIH-dsRNA by in vitro transcription

Two DNA templates for dsRNA of GIH that span the coding sequence of the mature Pem-GIH, each containing T7 promoter sequence at the 5¢-end on different strands were synthesized by PCR from full-length Pem-GIH cDNA Two separate PCR reactions were set up, one with T7-containing forward primer (5¢-TAATACGACTCACTA TAGGGAGAAACATCCTGGACAGCAAATGCAGGG-3¢) and reverse primer (5¢-CCGGCATTGAGGATGCTGAT-3¢) for the sense-strand template, the other with forward primer matGIHF (5¢-AACATCCTGGACAGCAAATGCA GGG-3¢) and T7-containing reverse primer (5¢-TAATACG ACTCACTATAGGGAGACCGGCATTGAGGATGCTG AT-3¢) for the antisense-strand template The reaction consisted of denaturation at 94C for 30 s, annealing at

9 cycles with a 1C decrease in annealing temperature per cycle; the annealing temperature then remained at

extension at 74C for 7 min The expected PCR product were excised and purified with a gel extraction kit

(Qiagen), as described in the manufacturer’s protocol A

mixture of 1 lg of each template was used in an in vitro

(Ambion, Austin, TX, USA) according to the

manufac-turer’s protocol with some modifications Briefly, sense- and

antisense-strand templates were amplified in separate PCR

as described above The two templates were mixed in equal

amounts and added to a single transcription reaction to

syn-thesize dsRNA with T7 RNA polymerase at 37C for 6 h

To increase the duplex yield, the transcription reaction was

incubated at 75C for 5 min, and allowed to cool to room

temperature The remaining DNA template and

single-stranded RNA in solution were digested with DNaseI and

RNaseA at 37C for 1 h The proteins, free nucleotides and

degraded nucleic acid residues were removed from

double-stranded RNA by the filter cartridge as described in

manu-facturer’s instructions Finally, dsRNA was eluted with

100 lL of 95C pre-heated 10 mm Tris ⁄ HCl pH 7, and

1 mm EDTA

Production of GIH-dsRNA by in vivo expression in

Escherichia coli

In order to obtain large quantity of dsRNA for the in vivo

functional assay, GIH-dsRNA was produced as

hairpin-RNA precursor in E coli following a previously described

method [25] with some modifications A 340 bp DNA

template for the sense strand of dsRNA connecting with a

loop region was amplified with primers sense-GIHF1-XbaI

(5¢-GCTCTAGAAACATCCTGGACAGCA-3¢) and

GA-3¢) Another DNA template for the antisense strand of

dsRNA, 240 bp, was amplified with primers as-GIHF-SalI

CCGGC-3¢) The antisense template was first cloned into

pET17b vector at BamHI and XhoI sites, following by the

sense template at XbaI and BamHI The resulting

recombi-nant plasmid was constructed and propagated in E coli

DH5a and its nucleotide sequence was verified by

auto-mated DNA sequencing

The recombinant plasmid of hairpin-RNA of Pem-GIH

was subsequently transformed into an RNaseIII-deficient

induced with 0.4 mm isopropyl thio-b-d-galactoside for

2 h in 2· YT medium Cells were harvested by

centrifu-gation and resuspended in 500 lL NaCl⁄ Pi containing

0.1% SDS The sample was boiled for 2 min and then

snapped cool on ice To eliminate endogenous RNA from

bacterial cell and single-stranded RNA in the loop region

of GIH hairpin-RNA, the cell lysate was treated with

extracted by using TRI-REAGENT (Molecular Research

Center) and resuspended in Tris⁄ NaCl (10 mm Tris ⁄ HCl

pH 7, 10 mm NaCl)

The quantity of dsRNA was determined by the UV spec-trophotometry at an absorbancy of A260

dsRNA-mediated Pem-GIH knockdown in shrimp explant culture

Eyestalk ganglia or abdominal nerve cords of P monodon were dissected from individual shrimp The eyestalk from

a single shrimp was used in each experiment The XOSG neuron from the left eyestalk was used as a negative control whereas that from the right eyestalk was treated with dsRNA as described below Nerve cord from the same shrimp was cut into 0.8–1 cm pieces and used in one set

of the experiment The explant samples were incubated in a well of 24-well plate filled with 1.5 mL of modified M199 culture medium consisting of M199 powder in crab saline (440 mm NaCl, 11 mm KCl, 13.3 mm CaCl2, 26 mm MgCl2, 26 mm Na2SO4 and 10 mm Hepes pH 7.2) supple-mented with 100 lgÆmL)1 penicillin–streptomycin anti-fungus and 40 lgÆmL)1 gentamicin sulfate The samples were added to 3 lg of GIH-dsRNA and cultured with shaking at 20–24C for the appropriate length of time Samples were then washed with modified M199 medium plus antibiotic before collected for RNA extraction The level of Pem-GIH transcript was detected by RT-PCR with GIHF and 5¢-RACE-GIH1 primers as described earlier

Functional knockdown assay for Pem-GIH activity

Previtellogenic adult female P monodon at the intermolt and early premolt stages (C–D2) ( 85–120 g each) were cultured in tanks filled with artificial seawater ( 30 p.p.t salinity) Shrimp were divided into two groups, each con-taining five shrimp The control group was injected through the arthrodial membrane of the second walking leg with Tris⁄ NaCl ( 3 lLÆg)1 body weight) and the experimental group was injected with GIH-dsRNA ( 3 lgÆlL)1) at

3 lgÆg)1body weight The level of GIH and Vg transcripts

in eyestalk ganglia and ovary, respectively were detected by RT-PCR 5 days after being administered with dsRNA

Statistical analysis

Results are presented as mean ± SEM Statistical signifi-cance between values was determined by Levene’s test of independent sample t-test from spss for Windows 11.5

Acknowledgements

We acknowledge Hiu Kwan Tiu (School of Biological Sciences, The University of Hong Kong) for her kind advice on the shrimp explant culture technique We thank Ms Junpim Wannarungsi at Bangkok Aquacul-ture Farm Company (BAFCO) for supplying adult

female P monodon This study was supported by The

Royal Golden Jubilee PhD program to ST, the RD&E

Funding from BIOTEC, Thailand and Mahidol

Uni-versity research grant SMC was supported by a grant

(HKU#7482⁄ 05M) from the Research Grant Council

of the Hong Kong SAR Government

References

1 Tsukimura B (2001) Crustacean vitellogenesis: its role

in oocyte development Am Zool 41, 465–476

2 Tsutsui N, Kawazoe I, Ohira T, Jasmani S, Yang W-J,

Wilder MN & Aida K (2000) Molecular

characteriza-tion of a cDNA encoding vitellogenin and its expression

in the hepatopancreas and ovary during vitellogenesis in

the Kuruma prawn, Penaeus japonicus Zool Sci 17,

651–660

3 Avarre J-C, Michelis R, Tietz A & Lubzens E (2003)

Relationship between vitellogenin and vitellin in a

mar-ine shrimp (Penaeus semisulcatus) and molecular

charac-terization of vitellogenin complementary DNAs Biol

Reprod 69, 355–364

4 Tsang W-S, Quackenbush LS, Chow BKC, Tiu SHK,

He JG & Chan S-M (2003) Organization of the shrimp

vitellogenin gene: evidence of multiple genes and tissue

specific expression by the ovary and hepatopancreas

Gene 303, 99–109

5 Yang F, Xu HT, Dai ZM & Yang WJ (2005) Molecular

characterization and expression analysis of vitellogenin

in the marine crab Portunus trituberculatus Comp

Biochem Physiol B 142, 456–464

6 Charmantier G, Charmantier-Daures M & Van Herp F

(1997) Hormonal regulation of growth and

reproduc-tion in crustaceans In Endocrinology and Reproducreproduc-tion,

Recent Advances in Marine Biotechnology, Vol 1

(Fingerman M, Nagabhushanam R & Thompson M-F,

eds), pp 109–161 Science Publishers, Enfield, NH

7 Huberman A (2000) Shrimp endocrinology A review

Aquaculture 191, 191–208

8 Skinner DM (1985) Molting and regeneration In The

Biology of Crustacea, Integuments, Pigments and

Hormonal Processes, Vol 9 (Bliss DE & Mantel LH

eds), pp 43–146 Academic Press, Orlando, FL

9 Keller R (1992) Crustacean neuropeptides: structures,

functions and comparative aspects Experientia 48, 439–

448

10 Ohira T, Katayama H, Tominaga S, Takasuka T,

Nakatsuji T, Sonobe T, Aida K & Nagasawa H (2005)

Cloning and characterization of a molt-inhibiting

hormone-like peptide from the prawn Marsupenaeus

japonicus Peptide 26, 259–268

11 Lacombe C, Greve P & Martin G (1999) Overview

on the sub-grouping of the crustacean hyperglycemic

hormone family Neuropeptides 33, 71–80

12 Chen SH, Lin CY & Kuo CM (2005) In silico analysis

of crustacean hyperglycemic hormone family Mar Biotechnol 7, 193–206

13 Chan SM, Gu PL, Chu KH & Tobe SS (2003) Crusta-cean neuropeptide genes of the CHH⁄ MIH ⁄ GIH family: implications from molecular studies Gen Comp Endocrinol 134, 214–219

14 Soyez D, Van Deijnen JE & Martin M (1987) Isolation and characterization of a vitellogenesis-inhibiting factor from the sinus gland of the lobster, Homarus americ-anus J Exp Zool 244, 479–484

15 Tsutsui N, Katayama H, Ohira T, Nagasawa H, Wilder

MN & Aida K (2005) The effects of crustacean hyper-glycemic hormone-family peptides on vitellogenin gene expression in the kuruma prawn, Marsupenaeus japonicus Gen Comp Endocrinol 144, 232–239

16 Aguilar MB, Quackenbush LS, Hunt DT, Shabanowitz

J & Huberman A (2002) Identification, purification and initial characterization of the vitellogenesis-inhibiting hormone from the Mexican crayfish Procambarus bouvieri(Ortmann) Comp Biochem Physiol B 102, 491–498

17 Gu P-L, Tobe SS, Chow BKC, Chu KH, He J-G & Chan S-M (2002) Characterization of an additional molt inhibiting hormone-like neuropeptide from the shrimp Metapenaeus ensis Peptide 23, 1875–1883

18 Edomi P, Azzoni E, Mettulio R, Pandolfelli N, Ferrero

EA & Giulianini PG (2002) Gonad-inhibiting hormone

of the Norway lobster (Nephrops norvegicus): cDNA cloning, expression, recombinant protein production, and immunolocalization Gene 284, 93–102

19 Yang W-J & Rao KR (2001) Cloning of precursors for two MIH⁄ VIH-related peptides in the prawn, Macrob-rachium rosenbergii Biochem Biophys Res Commun 289, 407–413

20 De Kleijn DPV, Janssen KPC, Waddy SL & Hegeman R (1998) Expression of the crustacean hyperglycemic hor-mones and the gonad-inhibiting hormone during the reproductive cycle of the female American lobster Homarus americanus J Endrocrinol 156, 291–298

21 Hannon GL (2002) RNA interference Nature 418, 244–251

22 Tsuzuki S, Sekiguchi S & Hayakawa Y (2005) Regula-tion of growth-blocking peptide expression during embryogenesis of the cabbage armyworm Biochem Biophys Res Commun 335, 1078–1084

23 Volz J, Osta MA, Kafatos FC & Muller HM (2005) The roles of two clip domain serine proteases in innate immune responses of the malaria vextor Anopheles gambiae J Biol Chem 280, 40161–40168

24 Martin D, Maestro O, Cruz J, Mane-Padros D & Belles X (2006) RNAi studies reveal a conserved role for RXR in molting in the cockroach Blattella germa-nica J Insect Physiol 52, 410–416