Báo cáo khoa học: Transgenic Cdx2 induces endogenous Cdx1 in intestinal metaplasia of Cdx2-transgenic mouse stomach pot

In conclusion, transgenic Cdx2 induced endogenous Cdx1 through the binding of Cdx2 to the unmethylated Cdx1 promoter region in the intestinal metaplasia of the Cdx2-transgenic mouse stom

metaplasia of Cdx2-transgenic mouse stomach

Hiroyuki Mutoh, Hiroko Hayakawa, Hirotsugu Sakamoto, Miho Sashikawa and Kentaro Sugano Department of Medicine, Division of Gastroenterology, Jichi Medical University, Tochigi, Japan

Introduction

In intestinal metaplasia of the human stomach, normal

gastric mucosa is replaced by an intestinalized

epithe-lium, and is mainly induced together with the

progres-sion of Helicobacter pylori-infected chronic gastritis

Intestinal metaplasia of the human stomach has been extensively studied as a premalignant condition of gastric carcinoma [1] The intestine-specific homeo-box genes Cdx1 and Cdx2 have been shown to be

Keywords

chromatin immunoprecipitation; luciferase

reporter assay; methylation; RT-PCR; siRNA

Correspondence

H Mutoh, Department of Medicine, Division

of Gastroenterology, Jichi Medical

University, Yakushiji 3311-1, Shimotsuke,

Tochigi 329-0498, Japan

Fax: +81 285 44 8297

Tel: +81 285 58 7348

E-mail: muto@jichi.ac.jp

(Received 12 April 2009, revised 1 August

2009, accepted 6 August 2009)

doi:10.1111/j.1742-4658.2009.07263.x

Cdx1 and Cdx2, which are transcription factors regulating normal intesti-nal development, have been studied as potential key molecules in the pathogenesis of the precancerous intestinal metaplasia of the human stomach However, the regulation of Cdx1 expression in the intestinal metaplasia is poorly understood expressing gastric mucosa of Cdx2-transgenic mouse stomach was replaced by intestinal metaplastic mucosa The aim of this study was to investigate the following: (a) Cdx1 expres-sion in the intestinal metaplastic mucosa of the Cdx2-transgenic mouse stomach; and (b) the relationship between Cdx1 and Cdx2 A mouse model of intestinal metaplasia, the Cdx2-transgenic mouse, was used to investigate Cdx1 gene expression by RT-PCR DNA methylation profile analysis was performed by bisulfite sequencing, and the interaction of Cdx2 with the Cdx1 promoter was examined by chromatin immunoprecip-itation assay, electrophoretic mobility shift assay, and luciferase reporter assays Cdx2 mRNA was expressed in the Cdx2-transgenic mouse stom-ach However, endogenous Cdx2 mRNA was not expressed in the intesti-nal metaplasia of the Cdx2-transgenic mouse stomach On the other hand, endogenous Cdx1 mRNA and protein were expressed in the intestinal metaplasia of the Cdx2-transgenic mouse stomach The Cdx1 promoter was unmethylated in the intestinal metaplasia of the Cdx2-transgenic mouse stomach Chromatin immunoprecipitation assay and electrophoretic mobility shift assay showed that Cdx2 was bound to the Cdx1 promoter region in the intestinal metaplasia and the normal intestine Cdx2 upregu-lated and siRNA-Cdx2 downreguupregu-lated the transcriptional activity of the Cdx1 gene in the human gastric carcinoma cell lines AGS, MKN45, and MKN74 In conclusion, transgenic Cdx2 induced endogenous Cdx1 through the binding of Cdx2 to the unmethylated Cdx1 promoter region

in the intestinal metaplasia of the Cdx2-transgenic mouse stomach

Abbreviations

ChIP, chromatin immunoprecipitation; EMSA, electrophoretic mobility shift assay; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RA, retinoic acid; si, small interfering.

aberrantly expressed in human intestinal metaplasia.

Cdx1 and Cdx2 are mammalian members of the

cau-dal-related homeobox gene family In adult mice and

humans, expression is strictly confined to the gut, from

the duodenum to the rectum Normal stomach does

not express the transcription factors Cdx1 and Cdx2

We and others have reported the presence of Cdx1

and Cdx2 in the intestinal metaplasia of the H

pylori-infected human stomach [2–4]

We have previously generated Cdx2-transgenic mice

as model mice for intestinal metaplasia [5,6]

Cdx2-transgenic mice specifically express Cdx2 in the gastric

mucosa, and develop intestinal metaplasia in the

stom-ach [5,6] Gastric carcinoma spontaneously developed

from intestinal metaplasia in all stomachs of

Cdx2-transgenic mice examined [7]

In Barrett’s esophagus, normal squamous

esopha-geal mucosa is also replaced by an intestinalized

columnar epithelium in which Cdx2 is expressed [8]

Exposure to acid and⁄ or bile acids has been reported

to activate Cdx2 expression in human esophageal

epi-thelial cells through promoter demethylation [9–11]

However, it is still unclear how Cdx1 is induced in

intestinal metaplasia Furthermore, the relationship

between Cdx1 and Cdx2 in intestinal metaplasia has

not been clarified as yet To investigate these

ques-tions, we focused on the induction of endogenous

Cdx1 in Cdx2-induced intestinal metaplasia using

Cdx2-transgenic mice

Results

Expression of Cdx1 and Cdx2 in the intestinal

metaplasia of the Cdx2-transgenic mouse

stomach

Cdx2-transgenic mice we generated showed intestinal

metaplasia in the stomach [5,6] First, Cdx2 expression

in the intestinal metaplasia of Cdx2-transgenic mouse

stomachs was examined, using RT-PCR Cdx2 mRNA

was detected in normal intestine and in all of the

intes-tinal metaplasia of the Cdx2-transgenic mouse

stom-ach, but not in the normal mouse stomach (Fig 1B)

Cdx2 expression was detected using a primer pair for

the Cdx2 coding region (Cdx2 coding-fw and Cdx2

coding-rv; Fig 1A and Table 1) When

Cdx2-trans-genic mice were generated, only the Cdx2 coding

region, without the noncoding region, was used To

investigate whether endogenous Cdx2 was expressed in

Cdx2-induced intestinal metaplasia, endogenous Cdx2

expression was detected using a primer pair for the

coding region and the 3¢-noncoding region (Cdx2

cod-ing-fw and Cdx2 non-coding-rv; Fig 1A and Table 1)

Endogenous Cdx2 was expressed in the normal intes-tine, but in none of the intestinal metaplasia of the Cx2-transgenic mouse stomachs (Fig 1C) Transgenic Cdx2 did not induce endogenous Cdx2 expression, indicating that Cdx2 is not autoregulated in intestinal metaplasia

Next, whether endogenous Cdx1 was expressed in Cdx2-induced intestinal metaplasia was investigated Endogenous Cdx1 was detected in the normal intestine and in all of the Cdx2-induced intestinal metaplasia, but not in the normal stomach (Fig 2A)

Cdx1 gene expression was characterized by quantita-tive real-time RT-PCR (Fig 2B) The Cdx1 mRNA level in the Cdx2-transgenic mouse stomach was almost same as that in the normal mouse small intes-tine (Fig 2B)

Cdx1 expression in the intestinal metaplasia of the Cdx2-transgenic mouse stomach was also investigated, using immunohistochemistry Cdx1 was expressed in the intestinal metaplasia of the Cdx2-transgenic mouse stomach (Fig 2E) and normal intestine (Fig 2D), but not in the normal stomach (Fig 2C) The expression

of Cdx1 mRNA and protein in the intestinal meta-plasia of the Cdx2-transgenic mouse stomach indicates that Cdx1 might be induced by Cdx2 in intestinal metaplasia

Cdx1 promoter methylation status

We focused on epigenetic regulation of Cdx1 gene expression as a possible cause of Cdx1 activation in the intestinal metaplasia of the Cdx2-transgenic mouse stomach To investigate whether the differences in Cdx1 expression were under promoter methylation control, bisulfite sequencing was performed on DNA extracted from five normal stomachs, five normal intes-tines, and five intestinal metaplasias of Cdx2-transgenic mouse stomachs All of the CpGs including the CpGs (located around the TATA box and indicated by the box in Fig 3A) that appear to be critical for the con-trol of Cdx1 expression in colorectal carcinoma [12] were unmethylated in the Cdx1 promoter sequences from the five intestinal metaplasias, the five normal intestines and the five normal stomachs (Fig 3A) These results made it clear that Cdx1 promoter meth-ylation status does not determine the expression of Cdx1 in the normal intestine and in the intestinal metaplasia of the Cdx2-transgenic mouse stomach Next, the methylation status of the Cdx2 promoter region was examined All of the CpGs (shown in red

in Fig 3B) in the Cdx2 promoter sequences from five intestinal metaplasias, five normal intestines and five normal stomachs were unmethylated, except for one

CpG, indicated by the box in Fig 3B, that was

methy-lated in five normal intestines and five intestinal

meta-plasias These results indicate that Cdx2 promoter

methylation status does not determine the expression

of endogenous Cdx2 in the normal intestine and in the

intestinal metaplasia of the Cdx2-transgenic mouse

stomach

Cdx2 binds directly to the Cdx1 promoter region

in vivo

The putative TATA-box (TATAAA) sequence at

posi-tions )51 to )46 (relating to the transcription start

site; GenBank number NM_009880) exhibits obvious

sequence similarity with the consensus Cdx-binding site

(C⁄ TATAAAG ⁄ T) (Fig 4A), whereas no additional putative Cdx-binding site could be found elsewhere in the Cdx1 promoter (at position )2000 from the tran-scription start site) To examine whether the expression

of Cdx1 mRNA in the intestinal metaplasia of the Cdx2-transgenic mouse stomach is associated with the binding of Cdx2 to this TATAAA region, we per-formed chromatin immunoprecipitation (ChIP) assays, using an antibody against Cdx2 We cross-linked the protein and DNA in the intestinal metaplasia of Cdx2-transgenic mouse stomach as well as in the stomach and intestine of normal mice The Cdx1 promoter region encompassing the TATAAA sequence at)51 to )46 was amplified by PCR with two sets of primers (Fig 4B, Cdx1 promoter fw1 and Cdx1 promoter rv1;

A

Terminal codon Intron

B

C

1

2

Intestine Cdx2 stomach

β-actin

Stomach Intestine Cdx2 stomach

β-actin

Fig 1 RT-PCR analysis of Cdx2 expression.

(A) Scheme of a part of the mouse Cdx2

mRNA, including the stop codon ‘tga’,

which is shown in red The primers used for

detecting Cdx2 transcript are indicated by

underlining and yellow shading The

exo-n 2–exoexo-n 3 bouexo-ndary site is iexo-ndicated by aexo-n

arrow (B) RT-PCR analysis of Cdx2 mRNA

transcripts (primer pair; Cdx2 coding-fw and

Cdx2 coding-rv) in normal mouse stomach

(lane 1), normal mouse small intestine

(lane 2), and Cdx2-transgenic mouse

stom-ach (lanes 3–8) (C) RT-PCR analyses of

endogenous Cdx2 mRNA transcripts (primer

pair; Cdx2 coding-fw and Cdx2

non-coding-rv) in normal mouse stomach (lane 1),

normal mouse small intestine (lane 2), and

Cdx2-transgenic mouse stomach

(lanes 3–7) The lower panels in (B) and (C)

show standard RT-PCR conducted with

primers designed to detect b-actin mRNA.

Fig 4C, Cdx1 promoter fw2 and Cdx1 promoter rv1).

Binding of Cdx2 to the promoter region of the Cdx1

gene, including the TATAAA sequence, was detected

in the intestinal metaplasia of the Cdx2-transgenic

mouse stomach and the normal intestine, but not in

the normal stomach (Fig 4B,C)

Cdx2 binds to the TATAAA sequence

We investigated Cdx2 binding to the TATAAA sequence, using the nuclear fractions extracted from Cdx2-expressing AGS cells (Fig 4D) We found that nuclear extracts from AGS cells formed the Cdx2– DNA complex (Fig 4D) The presence of Cdx2 in DNA–protein complexes was eliminated by using monoclonal antibody specific to Cdx2 (Fig 4D, lane 3) With the use of a mutant probe, DNA–protein complexes were not formed (Fig 4D, lane 1) These results indicate that Cdx2 binds to the TATAAA sequence

The Cdx1 promoter was activated in Cdx2-expressing human gastric carcinoma AGS, MKN45 and MKN74 cells

The expression of Cdx1 in the intestinal metaplasia of the Cdx2-transgenic mouse stomach supports the hypothesis that Cdx2 could regulate Cdx1 transcrip-tion Supporting this, the ChIP assay indicated that Cdx2 is bound to the region between )191 and +112 (relating to the transcription start site) The region between )191 and +112 contains the Cdx consensus sequence TATAAA ()51 to )46) (Fig 4A) Further-more, electrophoretic mobility shift assay (EMSA) indicated that Cdx2 binds to the TATAAA sequence

We examined the Cdx1 transcriptional activity in Cdx2-expressing AGS, MKN45 and MKN74 cells (Fig 5A), using pGL4.10[luc2]–Cdx1 deletion and mutation constructs These cell lines (AGS, MKN45, and MKN74) also expressed Cdx1, which was detected

by RT-PCR (Fig 5A) The Cdx1 promoter reporter gene containing the region between)365 and +12 was activated, whereas the Cdx1 promoter reporter gene containing the region between )365 and )78 was not activated, in Cdx2-expressing AGS, MKN45 and MKN74 cells (Fig 5B) This result suggests that the element between )77 and +12 in the Cdx1 promoter may be critical for Cdx1 gene transcriptional activity

in Cdx2-expressing AGS, MKN45 and MKN74 cells The sequence between )77 and +12 contains a poten-tial Cdx2-binding site (TATAAA,)51 and )46) Anal-ysis of a reporter construct with mutation of the Cdx2 consensus-binding element at )51 and )46 revealed that the element was critical for transcriptional activity

of the Cdx1 reporter gene construct in AGS, MKN45 and MKN74 cells (Fig 5B)

Furthermore, we examined the effects of the transfec-tion of the Cdx2 expression plasmid or small interfering RNA targeting Cdx2 (siRNA-Cdx2) on the trans-criptional activities of the Cdx1 promoter luciferase

Table 1 The sequences of oligonucleotide primers used in this

study.

Primers used for mouse Cdx2 detection

Cdx2 coding-rv GACAGTGGAGTTTAAAACCC

Cdx2 noncoding-rv GCCTGGGATTGCTGTGCCG

Primers used for mouse Cdx1 detection

Primers used for mouse b-actin detection

Primers used for human Cdx2 detection

Primers used for human Cdx1 detection

Primers used for human GAPDH detection

Primers used for Cdx1 methylation

CpG-Cdx1-fw1

[ )331 ⁄ )305]

GAGTTAGTTTTTTTATTTGT AATTTAG

CpG-Cdx1-fw2

[ )312 ⁄ )293]

TAATTTAGGGGTGGGTGGTG CpG-Cdx1-rv

[+114 ⁄ +89]

AAAAAATCCTTATCCAACAC ATAACC

Primers used for Cdx2 methylation

CpG-Cdx2-fw1

[ )234 ⁄ )212]

AGTGTATTTAGGTTGGAAGGAG CpG-Cdx2-fw2

[ )206 ⁄ )185]

GTAGTTAGTAAGAAGGGTTTGA CpG-Cdx2-rv

[+194 ⁄ +173]

TAACTAACTACACCTCAACCCA Primers used for ChIP assay

Cdx1 promoter-fw1 CTAGGGTCATGCCACCACTC

Cdx1 promoter-fw2 ATCCACCTCCCGCTTAGG

Cdx1 promoter-rv2 GGAGTCCTTGTCCAGCACAT

Primers used for Cdx1 promoter

Cdx1 promoter-fw1-XhoI

[ )365 ⁄ )345]

CTCGAGCTAGGGTCATGCCACCACTC Cdx1 promoter-rv1-HindIII

[+12 ⁄ )7]

AAGCTTACCAGCGACTGCTCACCT Cdx1 promoter-rv2-HindIII

[ )78 ⁄ )95]

AAGCTTAAGCTTGGGCGGCTTTGC ATTTCA

Cdx1-Csp45I-fw TTCGAAAGGCCGGGGTGGGGC

Cdx1-Csp45I-rv TTCGAAGCCGCGGGCCGTCCGC

construct containing the region between)365 and +12

or the mutant Cdx1 reporter luciferase construct

Cotransfection with the Cdx2 expression plasmid

increased the transcriptional activities of the intact Cdx1

reporter gene, but did not affect the transcriptional

activities of the mutant Cdx1 reporter gene, in AGS,

MKN45 and MKN74 cells (Fig 5B) Cotransfection

with siRNA-Cdx2 decreased the transcriptional

activi-ties of the intact Cdx1 reporter gene, but did not affect

the transcriptional activities of the mutant Cdx1

repor-ter gene, in AGS, MKN45 and MKN74 cells (Fig 5B)

Next, after transfection of Cdx2 expression plasmid

or siRNA-Cdx2 into AGS, MKN45 and MKN74

cells, Cdx1 mRNA levels were measured using

quanti-tative real-time RT-PCR As compared with the

transfection of a negative control, the transfection of

the Cdx2 expression plasmid resulted in an increase

in Cdx1 mRNA (Fig 5C) As compared with the

transfection of a negative control, the transfection of

siRNA-Cdx2 resulted in a decrease in Cdx1 mRNA (Fig 5C)

Discussion

Intestinal metaplasia has been extensively studied as a putative preneoplastic lesion in the human stomach [1]

In the present study, endogenous Cdx1, but not Cdx2, was induced by transgenic Cdx2 in the intestinal meta-plasia of the Cdx2-transgenic mouse stomach

Cdx1 is essential for anterior–posterior vertebral patterning of the body axis in the early embryonic per-iod [13], and its expression persists selectively in the intestinal epithelium from the later embryonic period

to the adult [14] In addition to its physiological expression, Cdx1 is ectopically expressed in the precan-cerous intestinal metaplasia of the stomach and Barrett’s esophagus The regulatory mechanisms that modulate Cdx1 gene expression during development

1 stomach 2

β-actin

B

1

0.6 0.8

0.2 0.4

Normal intestine Normal stomach

Cdx2 stomach 0

Fig 2 RT-PCR and immunohistochemical

analysis of Cdx1 expression (A) RT-PCR

analysis of Cdx1 expression RT-PCR

analy-ses of Cdx1 mRNA transcripts in normal

mouse stomach (lanes 1 and 2), normal

mouse intestine (lanes 3 and 4) and

Cdx2-transgenic mouse stomach (lanes 5–9) are

shown The lower panel in (A) shows

standard RT-PCR conducted with primers

designed to detect b-actin mRNA (B) Cdx1

gene expression characterized by

quantita-tive real-time RT-PCR The Cdx1 mRNA

level in Cdx2-transgenic mouse stomach

was almost the same as that in normal

mouse small intestine (B) (C–E)

Immunohis-tochemical staining for Cdx1 in the normal

stomach (C), the normal intestine (D) and

the intestinal metaplasia of the

Cdx2-trans-genic mouse stomach (E).

and in the normal intestinal epithelium have been

gradually clarified Cdx1 is a direct transcriptional

tar-get of both retinoic acid (RA) and the Wnt⁄ b-catenin

signaling pathway during early embryogenesis [15,16]

The Wnt⁄ b-catenin signaling pathway is also active in

the crypt compartment [17] Cdx1 regulation by RA

and Wnt3a is mediated, respectively, through the RA

response element and two LEF⁄ TCF response

ele-ments present on the Cdx1 promoter [17] However,

very little is known about the molecular mechanisms

for induction of the ectopic expression of the Cdx1

gene in the intestinal metaplasia of the H

pylori-infected human stomach In the present study, we

focused on the initiation of Cdx1 gene transcription in

the intestinal metaplasia through Cdx2-transgenic

mouse studies Unlike in normal regulation, ectopic

expression of Cdx1 was upregulated by Cdx2 Cdx2

mRNA and protein were absent in the gastric-like

heteroplasias arising spontaneously in the pericecal

region and proximal colon of Cdx2+ ⁄) mice, and, in

common with that of Cdx2, Cdx1 expression was also

absent in the gastric-like heteroplasias [18] The finding that the gastric-like heteroplasia, which does not express Cdx2, also shows a lack of Cdx1 expression

is consistent with our present data showing that the stomach expressing Cdx2 generated endogenous Cdx1

Epigenetic inactivation, in particular aberrant DNA hypermethylation, is an important mechanism for gene silencing In the majority of human colon cancer specimens and colorectal cancer cell lines, Cdx1 expression is lost due to active Cdx1 gene silencing

by promoter hypermethylation [12,19] However, in this study, we demonstrated that the Cdx1 promoter

is unmethylated in the normal stomach, the normal intestine, and the intestinal metaplasia, indicating that loss of Cdx1 expression in the normal stomach is not associated with promoter hypermethylation Cdx1 and Cdx2 proteins bind to a binding site in an AT-rich motif whose consensus sequence is C⁄ TATAAAT ⁄ G

in direct or reverse orientation [20] In some instances, the Cdx-binding site presents high homology with the

A Cdx1 promoter

B Cdx2 promoter

Fig 3 Cdx1 (A) and Cdx2 (B) promoter bisulfite sequencing of the stomach and intestine of normal mice and the intestinal metaplasia of the Cdx2-transgenic mouse stomach (A) A sequence of the 5¢-flanking region for the mouse Cdx1 gene, including the TATA box, transcrip-tion start site and initiatranscrip-tion codon (ATG) The TATA box is highlighted in green, the transcriptranscrip-tion start site in blue, and the initiatranscrip-tion codon (ATG) in red Cdx1 promoter CpGs are shown in red Base positions relative to the Cdx1 transcription start site are shown on the left of each line of sequence All CpGs were unmethylated CpGs enclosed by the box ( )54 to )68) represent those suggested to be crucial for tran-scriptional control [12] (B) A sequence of the 5¢-flanking region for the mouse Cdx2 gene, including the TATA box, transcription start site, and initiation codon (ATG) The TATA box and another AT-rich motif, designated DBS (downstream binding site) [28], are highlighted in green, the transcription start site in blue, and the initiation codon (ATG) in red Cdx2 promoter CpGs are shown in red Base positions rela-tive to the Cdx2 transcription start site are shown on the left of each line of sequence All CpGs were unmethylated, except for the CpG enclosed by the box, which was methylated in the normal intestine and the intestinal metaplasia.

canonical TATA-box sequence, and, indeed, the Cdx1

and⁄ or Cdx2 homeoproteins were found to be able to

bind to the TATA-boxes of some intestinal genes,

such as those of the calbindin-D9 gene [21], the

clus-terin gene [22], and the glucose-6-phosphatase gene

[23] In the present study, CpGs in the 5¢-region of

the TATAAAA sequence located )51 ⁄ )45 upstream

of the transcription start site were also found to be

unmethylated in the normal stomach, the normal

intestine, and the intestinal metaplasia The present

results, including those from ChIP, EMSA and

reporter gene analysis, indicate that Cdx2 is present

on the Cdx1 promoter region containing the

TATAAAA sequence located at )51 ⁄ )45 On the

other hand, endogenous Cdx2 was not expressed in

the intestinal metaplasia of the Cdx2-transgenic mouse

stomach, indicating that endogenous Cdx2 was not

autoregulated

In the present study, we demonstrated that Cdx1 is

expressed in the Cdx2-induced intestinal metaplasia

of Cdx2-transgenic mice This may coincide with our

previous clinical data why the expression of Cdx2 pre-cedes that of Cdx1 during the progression of intestinal metaplasia [3] These clinical data also suggest that Cdx2 might induce Cdx1 expression

In conclusion, we propose that the ectopic expres-sion of Cdx2 in the gastric epithelium is triggered first, and in turn Cdx1 is directly induced by Cdx2 in the intestinal metaplasia The present results indicate that Cdx2 induces Cdx1 expression by directly binding to the Cdx2-consensus cis-regulatory element of the unmethylated Cdx1 promoter region

Experimental procedures

Cdx2-transgenic mice The Cdx2-transgenic mice we generated had free access to standard food and drinking water and were maintained on

a 12 h light⁄ dark cycle All experiments in this study were performed in accordance with the Jichi Medical University Guide for Laboratory Animals

A

Cdx1 promoter-fw1 –400

–341

–281

Cdx1 promoter-fw2

TATA box

–221

–161

–101

Cdx1 promoter-rv1 Initiation codon

Transcription start site (+1) +20

+80 –41

Fig 4 Cdx2 is present on the Cdx1 promoter region in vivo (A) A sequence of the 5¢-flanking region for the mouse Cdx1 gene, including the TATA box, transcription start site, and initiation codon The TATA box is highlighted in green, the transcription start site in blue, and the initiation codon in red PCR fragments corresponding to the DNA sequences including the TATA box were designed for ChIP analysis The sequences for the primers used for ChIP assays are underlined and highlighted in yellow The base positions relative to the transcription start site for the mouse Cdx1 gene are shown on the left of each line of sequence (B, C) ChIP assays that were performed using a Cdx2 antibody [26] or control IgG The region of the Cdx1 promoter encompassing the TATA box sequence was amplified by PCR with the follow-ing primer pairs: (B) Cdx1 promoter-fw1 and Cdx1 promoter-rv1; (C) Cdx1 promoter-fw2 and Cdx1 promoter-rv1 Lane 1: normal stomach Lane 2: normal intestine Lane 3: Cdx2-transgenic mouse stomach Lane 4: input Lane 5: control IgG (D) EMSA A radiolabeled dsDNA probe (CCCGCGGCTATAAAAGGCCGGGGTGGGG) containing the TATAAA sequence in the Cdx1 promoter was incubated with nuclear extracts from AGS cells and separated on a 5% polyacrylamide gel (lane 2) Specificity was determined by addition of antibody for supershift (lane 3) and mutant probe (CCCGCGGCTTCGAAAGGCCGGGGTGGGG) (lane 1).

RNA isolation and RT-PCR

Total RNA was extracted from the stomach (normal mice),

small intestine (normal mice), intestinal metaplasia

(Cdx2-transgenic mice), and human gastric cancer cell lines AGS,

MKN45 and MKN74, using the guanidinium

isothiocya-nate⁄ phenol method (Isogen; Nippon Gene, Tokyo, Japan),

according to the manufacturer’s instructions Total RNA

(1 lg) was reverse-transcribed as previously described [24]

To compare endogenous Cdx1 expression, endogenous Cdx2

expression and total (endogenous and transgenic) Cdx2

expression in the stomach (normal mice), small intestine

(normal mice), and intestinal metaplasia (Cdx2-transgenic mice), PCR amplification was performed using the primer pairs Cdx1cDNAfw and Cdx1cDNArv (for endogenous Cdx1), Cdx2-fw and Cdx2 coding-rv (for total Cdx2), and Cdx2-fw and Cdx2 noncoding-rv (for endogenous Cdx2) (Table 1), by incubation at 94C for 2 min, followed by 35 cycles of 94C for 30 s, 60 C for 30 s and 72 C for 30 s, and a final extension at 72C for 10 min The PCR products were separated in 2% agarose gels As an internal standard, RT-PCR was performed with primers hybridizing to the mRNA encoding b-actin or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Table 1)

Real-time RT-PCR One hundred nanograms of cDNA was used in each real-time PCR reaction Expression levels for the Cdx1 gene were determined by real-time PCR using ready-to use Assay-on-Demand gene expression product (Applied Bio-systems, Foster City, CA, USA): Mm00438172_m1 for mouse Cdx1, and Hs00156451_m1 for human Cdx1 Each Assay-on-Demand gene expression product contains tar-get-specific primers and probes and a Taqman Gene Expression Master Mix containing AmpErase uracil-N-gly-cosylase (Applied Biosystems) to prevent reamplification of carryover PCR products PCR amplification and fluores-cence data collection were performed with the ABI PRISM 7900 HT Sequence Detection System (Applied Biosystems), using the following conditions: 50C for

A

Cdx2

GAPDH

Cdx1

(Ratio of firefly to renilla luciferase)

0 2 4 6 8 10 12 14 16 18

(–) (–)

+Cdx2 +siCdx2

+Cdx2

(–)

(–)

+siCdx2

(–) +Cdx2 +siCdx2

+Cdx2 +siCdx2

+Cdx2

(–)

(–) +siCdx2

(–) +Cdx2 +siCdx2

(–) (–) (–) –78

–365

–365 +12

AGS MKN45 MKN74

TATAAA

TTCGAA

C

1

2

0

Cdx2

siRNA

+

Fig 5 Activation of the Cdx1 promoter in Cdx2-expressing AGS, MKN45 and MKN74 cells (A) Cdx2 and Cdx1 expression deter-mined by RT-PCR Human gastric carcinoma AGS, MKN45 and MKN74 cells expressed both Cdx2 and Cdx1 The lower panel in (A) shows standard RT-PCR conducted with primers designed to detect GAPDH mRNA (B) Cdx1 promoter reporter gene activities AGS, MKN45 and MKN74 cells were transiently transfected with the different fragments of Cdx1 promoter fused to a luciferase reporter vector, pGL4.10[luc2], and pGL4.70[hRluc] vector Lucifer-ase activities were normalized relative to the level of Renilla lucifer-ase activities The lengths of the promoter fragments tested are indicated The numbers correspond to the relative positions with respect to the transcription start site The sequence of the pre-sumptive Cdx2-binding site (TATAAA) was changed to TTCGAA Cdx1 promoter reporter plasmids were added to each plate with or without Cdx2 expression vector (pRC ⁄ CMV–Cdx2) or siRNA (Applied Biosystems, Silencer Select Pre-designed siRNA, #s2878; UUCUUGUUGAUUUUCCUCUcc) The luciferase activities of empty pGL4.10[luc2], which does not contain any Cdx1 promoter, were used as controls for AGS, MKN45 and MKN74 cells, respectively Each bar represents the mean ± standard error Transfections were performed in triplicate and repeated three times (C) Cdx1 mRNA levels of AGS, MKN45 and MKN74 cells transfected with Cdx2 expression plasmid, Cdx2 siRNA, or negative control At 24 h after transfection, total RNA was extracted.

2 min, 95C for 10 min, and 40 cycles for amplification

(95C for 15 s, and 60 C for 1 min) PCR reactions were

performed in 96-well plates, using a final volume of 20 lL,

and the Cdx1 gene was studied in triplicate In order to

normalize RNA transcript abundance for the Cdx1 gene, a

housekeeping gene (the b-actin gene) (Pre-Developed

Taq-man Assay Reagents; Applied biosystems) was used to

cal-culate the DCT (DCT= CT target⁄ CT actin) The Ct values

for the b-actin gene for the normal stomach, the normal

intestine and Cdx2-transgenic mouse stomach tissues fell

in a close range, with no specific pattern of spatial or

tem-poral variation (data not shown) A relative quantification

approach was used in this study to describe the change in

expression of the target gene in a test sample relative to a

calibrator sample (reference) The relative RNA transcript

abundance value was calculated as follows First, the DCT

for the normal stomach, normal small intestine and

Cdx2-transgenic mouse stomach tissues was calculated In the

second step, differences between the normal and

Cdx2-transgenic mouse stomach tissues were calculated as DDCT

(DCT target⁄ DCT reference) The normal mouse small intestine

was used as reference for Cdx1 expression Finally, the

fold difference (relative abundance) was calculated using

the formula 2)DDCT [25], and was plotted as means

(n = 6)

Immunohistochemistry

Murine tissue sections were stained with the antibody for

Cdx1 (1 : 40, rabbit polyclonal; Abcam, Cambridge, UK)

after antigenicity was enhanced by autoclaving the sections,

as previously described [24]

Bisulfite sequencing for Cdx1 and Cdx2

promoters

The methylation status of gene promoter CpGs is best

analyzed by using direct sequencing after sodium bisulfite

modification of target DNA (bisulfite sequencing) DNA

(1 lg of DNA per sample) was sodium bisulfite modified

with the DNA modification kit (Zymo Research Intergen,

Purchase, NY, USA), according to the manufacturer’s

instructions A 426 bp region of Cdx1 was amplified from

bisulfite-modified genomic DNA by nested PCR using two

sets of primers Genomic DNAs were extracted from five

stomachs and five intestines of five normal mice and five

stomachs of five Cdx2-transgenic mice The first PCR

reaction was performed using the forward primer

CpG-Cdx1-fw1[)331 ⁄ )305] and the reverse primer

CpG-Cdx1-rv[+114⁄ +89] (Table 1) A second, nested, PCR was then

performed on 1 lL of the amplificate, using the upstream

(CpG-Cdx1-fw2[)312 ⁄ )293]) and downstream

(CpG-Cdx1-rv[+114⁄ +89]) primers (Table 1) A 400 bp region of

Cdx2 was amplified from bisulfite-modified genomic DNA

by nested PCR, using two sets of primers The first PCR

reaction was performed using the forward primer CpG-Cdx2-fw1[)234 ⁄ )212] and reverse primer CpG-Cdx2-rv[+194⁄ +173] (Table 1) A second, nested, PCR was then performed on 1 lL of the amplificate, using the upstream (CpG-Cdx2-fw2[)206 ⁄ )185]) and downstream (CpG-Cdx2-rv[+194⁄ +173]) primers (Table 1) The pri-mer pairs were designed to bind sequences lacking any CpGs, therefore avoiding any preferential amplification of methylated or unmethylated DNA strands The PCR products were purified (GenElute agarose spin column; Sigma, St Louis, MO, USA), and the purified product was used for cloning (Topo TA Cloning kit; Invitrogen, Carls-bad, CA, USA) and sequencing by using the Big Dye Terminator Cycle Sequencing kit (Applied Biosystems)

ChIP assay The mucosae removed from the stomach (normal mice), the small intestine (normal mice) and the intestinal metaplasia (Cdx2-transgenic mice) were incubated with fixation solu-tion (1% formaldehyde, 4.5 mm Hepes, pH 8.0, 9 mm NaCl, 0.09 mm EDTA, 0.04 mm EGTA) in NaCl⁄ Pi for

30 min at 37C The reaction was terminated by the addi-tion of glycine to a final concentraaddi-tion of 150 mm After being washed in NaCl/Pi containing protease inhibitors (Protease inhibitor cocktail; Sigma), the samples were soni-cated in SDS lysis buffer (50 mm Tris⁄ HCl, pH 8.0, 10 mm EDTA, pH 8.0, 1% SDS, 0.5 mm phenylmethanesulfonyl fluoride), when the DNA size of samples was 200–500 bp The solubilized chromatin was incubated with anti-Cdx2 IgG (BioGenex, San Ramon, CA, USA) [26] or control IgG for 90 min at 4C Beads were washed five times with

IP buffer (50 mm Hepes, pH 7.5, 150 mm KCl, 5 mm MgCl2, 10 lm ZnSO4, 1% Triton X-100, 0.05% SDS), and then incubated with elution buffer (50 mm Tris⁄ HCl,

pH 8.0, 1% SDS, 10 mm EDTA) for 30 min at 65C The supernatant was collected and coimmunoprecipitated DNA was recovered Primer sequences used for the ChIP assays are listed in Table 1 All ChIP assays were repeated at least twice, and representative data are presented

EMSA Nuclear fractions were extracted for EMSA from AGS cells To extract nuclear fractions for EMSA studies, AGS cells were washed in NaCl⁄ Pi, and subjected to swelling in

400 lL of hypotonic buffer A (10 mm Hepes, pH 7.9,

10 mm KCl, 0.1 mm EDTA, 0.1 mm EGTA, 1 mm dith-iothreitol) supplemented with protease inhibitor cocktail (Sigma Chemical Co.), and lysed [27] Then, 25 lL of 10% Nonidet P-40 solution were added, and nuclear fractions were collected by sedimentation for 5 min at 500 g Super-natants were discarded, and precipitated nuclei were resus-pended in 100 lL of buffer C (20 mm Hepes, pH 7.9,

400 mm NaCl, 1 mm dithiothreitol, 1 mm EDTA, 1 mm

EGTA, and protease inhibitor cocktail) and centrifuged for

5 min at 14 000 g Supernatants containing nuclear proteins

were collected, and tested for their ability to bind labeled

nucleotides corresponding to the Cdx1 promoter All

DNA–protein binding reaction protocols were those of the

manufacturer (Promega, Madison, WI, USA) The dsDNA

probes used in the gel mobility shift assays were as follows:

wild-type sequence, CCCGCGGCTATAAAAGGCCGGG

GTGGGG; mutant sequence, CCCGCGGCTTCGAAAG

GCCGGGGTGGGG Briefly, 0.5 ng of 32P-labeled probe

was incubated for 20 min at 4C with 5 lg of nuclear

extracts in the presence of 1· gel shift buffer (Promega)

Subsequently, 1.5 lL of 10· loading buffer were added to

the reaction, and this was followed by separation by

elec-trophoresis on 5% nondenaturing polyacrylamide gel until

free probe was close to the bottom of the gel

Luciferase assays

To construct the luciferase reporter vector pGL4.10[luc2]–

Cdx1, 377 bp ()365 to +12) and 288 bp ()365 to )78)

fragments, located at 5¢-region of the mouse Cdx1 coding

sequence, were amplified by PCR with specific primers

(Table 1) from 500 ng of mouse genomic DNA The

ampli-fied fragments for the Cdx1 promoter were directly cloned

into the TA cloning vector pCRII (Invitrogen), to yield the

plasmid pCRII⁄ Cdx1 promoter Each pCRII ⁄ Cdx1

pro-moter was digested with XhoI and HindIII (sites underlined

in the primers in Table 1), and the resulting fragments were

subcloned into the XhoI and HindIII restriction sites of the

pGL4.10[luc2] vector (Promega) and confirmed by sequence

analysis The sequence of the presumptive Cdx2-binding

site (TATAAA) was changed to TTCGAA (underlined in

the primers) by using Cdx1-Csp45I-fw and Cdx1-Csp45I-rv

primers (Table 1)

AGS, MKN45 and MKN74 cells were seeded at

2· 105

cells per well in Nunc 24-well dishes 18–24 h before

transfection Transient transfections were performed using

Lipofectamine 2000 (Invitrogen) One hundred nanograms

of a Cdx1 promoter reporter plasmid with or without

800 ng of Cdx2 expression vector (pRC⁄ CMV–Cdx2) or

2.5 pmol of siRNA (Applied Biosystems, Silencer Select

Pre-designed siRNA, #s2878; UUCUUGUUGAUUUUC

CUCUcc) were added to each plate, together with 50 ng of

the Renilla luciferase control reporter plasmid

(pGL4.70[hRluc]; Promega) as a control for the transfection

efficiency At 24 h after transfection, the cells were lysed in

lysis buffer (Promega), and the firefly and Renilla luciferase

activities were measured, using the Dual-Luciferase

Repor-ter Assay System (Promega) in a luminomeRepor-ter The relative

firefly luciferase activities were calculated by normalizing

the transfection efficiency according to the Renilla luciferase

activities produced by the internal control plasmid

pGL4.70[hRluc] Three separate experiments were

per-formed in triplicate

Transfections of Cdx2 expression plasmid or Cdx2 siRNA

AGS, MKN45 and MKN74 cells were plated in 10 cm plates 24 h before transfection Transfections were performed using Lipofectamine 2000, following the manufacturer’s protocol (Invitrogen) Six micrograms of Cdx2 expression plasmid and 25 pmol of siRNA or nega-tive control were used for the transfection siRNA (Applied Biosystems, Silencer Select Pre-designed siRNA, #s2878; UUCUUGUUGAUUUUCCUCUcc) was used At 24 h after transfection, total RNA was extracted

References

1 Correa P (1992) Human gastric carcinogenesis: a multi-step and multifactorial process – First American Cancer Society Award Lecture on Cancer Epidemiology and Prevention Cancer Res 52, 6735–6740

2 Silberg DG, Furth EE, Taylor JK, Schuck T, Chiou T

& Traber PG (1997) CDX1 protein expression in nor-mal, metaplastic, and neoplastic human alimentary tract epithelium Gastroenterology 113, 478–486

3 Eda A, Osawa H, Yanaka I, Satoh K, Mutoh H, Kihira

K & Sugano K (2002) Expression of homeobox gene CDX2 precedes that of CDX1 during the progression

of intestinal metaplasia J Gastroenterol 37, 94–100

4 Satoh K, Mutoh H, Eda A, Yanaka I, Osawa H, Honda S, Kawata H, Kihira K & Sugano K (2002) Aberrant expression of CDX2 in the gastric mucosa with and without intestinal metaplasia: effect of eradica-tion of Helicobacter pylori Helicobacter 7, 192–198

5 Mutoh H, Hakamata Y, Sato K, Eda A, Yanaka I, Honda S, Osawa H, Kaneko Y & Sugano K (2002) Conversion of gastric mucosa to intestinal metaplasia in Cdx2-expressing transgenic mice Biochem Biophys Res Commun 294, 470–479

6 Mutoh H, Satoh K, Kita H, Sakamoto H, Hayakawa

H, Yamamoto H, Isoda N, Tamada K, Ido K & Sugano K (2005) Cdx2 specifies the differentiation of morphological as well as functional absorptive entero-cytes of the small intestine Int J Dev Biol 49, 867–871

7 Mutoh H, Sakurai S, Satoh K, Tamada K, Kita H, Osawa H, Tomiyama T, Sato Y, Yamamoto H, Isoda

N et al (2004) Development of gastric carcinoma from intestinal metaplasia in Cdx2-transgenic mice Cancer Res 64, 7740–7747

8 Eda A, Osawa H, Satoh K, Yanaka I, Kihira K, Ishino

Y, Mutoh H & Sugano K (2003) Aberrant expression

of CDX2 in Barrett’s epithelium and inflammatory esophageal mucosa J Gastroenterol 38, 14–22

9 Kazumori H, Ishihara S, Rumi MA, Kadowaki Y & Kinoshita Y (2006) Bile acids directly augment caudal related homeobox gene Cdx2 expression in oesophageal keratinocytes in Barrett’s epithelium Gut 55, 16–25