Effect of Qingxinkaiqiao compound on cortical mRNA expression of the apoptosis related genes Bcl 2, BAX, caspase 3, and Aβ in an Alzheimer’s disease rat model TOPIC JTCM |www journaltcm com[.]
Trang 1TOPIC EXPERIMENTAL STUDY Effect of Qingxinkaiqiao compound on cortical mRNA expression of the apoptosis-related genes Bcl-2, BAX, caspase-3, and Aβ in an Al-zheimer's disease rat model
Hu Haiyan, Wang Yiyu, Zhang Yihui, Wang Wenhua, Xu Dongmei, Chen Zhiyu, Zhang Xiaoyan, Mao Dandan aa
Hu Haiyan, Wang Wen-hua, Zhang Xiao-yan, the Second
Clinical College of Wenzhou Medical University, Wenzhou
325003, China
Wang Yiyu, Zhang Yihui, Xu Dongmei, Chen Zhiyu, Mao
Dandan, Department of Traditional Chinese Medicine, the
Second Affiliated Hospital of Wenzhou Medical University,
Wenzhou 325003, China
Supported by the National Natural Science Foundation of
China: Study on Mechanisms of Qingxinkaiqiao Fang on
Re-strain Form of β-amyloid in Brain Tissue of Rat Analogue
Model of Alzheimer's Disease by a Multiple (No 30973780)
Correspondence to: Mao Dandan, Department of
Tradi-tional Chinese Medicine, the Second Affiliated Hospital of
Wenzhou Medical University, Wenzhou 325003, China
ma-oddan@sina.com
Telephone: +86-13567786184
Accepted: January 15, 2016
Abstract
OBJECTIVE: To investigate the effects of
Qingx-inkaiqiao (QK) compound in a rat model of
Alzheim-er's disease induced with β-amyloid (Aβ) 1-40
Sprague-Dawley rats were randomly divided into
seven groups: blank control group, surgery group,
model group, low-dose QK group, middle-dose QK
group, high-dose QK group, and Aricept (donepezil
hydrochloride) group, with eight rats in each
group Apart from the control and surgery groups,
an Alzheimer's disease model was established in all
groups by bilateral hippocampal injection of Aβ
1-40 The surgery group received an injection of
the same volume of physiological saline Two days
after model establishment, rats from the drug
groups were administered the corresponding drugs; the control group and model group were ad-ministered an equal volume of physiological saline for 14 days After treatment, real-time quantitative polymerase chain reaction, immunohistochemistry, and western blot assay were employed to confirm mRNA and protein expressions of Bcl-2, Bax, cas-pase-3, and Aβ, respectively
RESULTS: Compared with the model group, Bcl-2
expression increased and Bax, caspase-3, and Aβ expression decreased in each drug treatment group (P < 0.05, P < 0.01) The expressions of mid-dle-dose QK group were more significant than the high- and low-dose QK groups (P < 0.01, P > 0.05)
CONCLUSION: QK treatment resulted in
significant-ly up-regulated Bcl-2 expression, down-regulated Bax, caspase-3, and Aβ expression, and reduced numbers of apoptotic cells in the cortex
© 2016 JTCM All rights reserved
Key words: Alzheimer disease; Amyloid; Apoptosis;
Qingxinkaiqiao (QK) compound
INTRODUCTION
Alzheimer's disease (AD) is a common neurological de-generative disease in the elderly, characterized by a pro-gressive decline in memory and cognitive function, and often accompanied by personality change The inci-dence of AD increases with age The symptoms and eventual cognitive decline have placed a large burden
on family members and society Because of the creased age of our society, there is a great need for
Trang 2in-creased attention to this devastating disease There
re-mains no effective modern treatment for Alzheimer's
disease, but Traditional Chinese Medicine provides a
unique therapeutic perspective for dementia
Qingxinkaiqiao (QK) compound from the
"Fumanji-an" is a Chinese medicine recipe documented in the
medical book Jingyue Quanshu,1 written by Zhang
Jing-yue during the Ming Dynasty It has been used in
clinical practice for many years It can significantly
im-prove cognitive dysfunction, as well as behavioral and
psychological symptoms in patients.2-4 Previous results
from our group showed that QK improves learning
and memory in AD rats and decreases apoptosis in the
hippocampal region.5The present study aimed to
inves-tigate the effects of QK on cortical expression of B-cell
lymphoma-2 (Bcl-2), Bcl-2-associated X protein (Bax),
cysteinyl aspartate specific proteinase-3 (Caspase-3),
andβ-amyloid precursor protein (Aβ) in a rat model
of AD induced by Aβ1-40
MATERIALS AND METHODS
Experimental animals
Fifty-six male, specific pathogen-free, 3-month-old
Sprague-Dawley (SD) rats weighing (250 ± 20) g were
purchased from the Beijing Vital River Laboratory
Ani-mal Technology Co., Ltd [Certification No SCXK
(Beijing) 2012-0001] Rats were bred at the Wenzhou
Medical University Laboratory Animal Center (clean
experimental and standard animal feeding conditions)
The rats were housed in a room with a 12-h light/dark
cycle The animals were subjected to experimentation
after acclimatization for 1 week at 23-25℃ and
rela-tive humidity of 55% ± 5%, with free access to
stan-dard food and water All experimental conditions
fol-lowed ethical requirements related to experimental
ani-mals
Drugs and reagents
The following herbs were purchased from the
Dispen-sary of Traditional Chinese Medicine (Second
Affiliat-ed Hospital of Wenzhou MAffiliat-edical University and
veri-fied by the Department of Chinese Materia Medica of
Wenzhou Medical University): Dihuang (Radix
Rehm-anniae) 6 g, Baishao (Radix Paeoniae Alba) 6 g,
Shichangpu (Rhizoma Acori Tatarinowii) 6 g, Maidong
(Radix Ophiopogonis Japonici) 6 g, Mudanpi (Cortex
Moutan Radicis) 6 g, Fushen (Poria Cum Radix Pini) 6
g, Kushen (Radix Sophorae Flavescentis) 6 g, Shihu
(Her-ba Dendrobii Nobilis) 6 g, Chenpi (Pericarpium Citri
Re-ticulatae) 4 g, and Zhimu (Rhizoma Anemarrhenae) 5 g.
The raw herbs were decocted with appropriate
amounts of water, extracted two times, filtered and
con-centrated to drug stocks of 1 g/mL (crude drug), and
stored at 4 ℃ Donepezil (Eisai Pharmaceutical,
Su-zhou, China; batch number: 100223A) was made into
a water suspension of the designed concentration prior
to administration
Reagents (sources) used in the study were as follows: Aβ1-40 and DMSO were purchased from Sigma (St Louis, MO, USA); DAB chromogenic reagent kits were purchased from Zymed (San Diego, CA, USA); Hematin dye solution was purchased from Fir Biologi-cal (Beijing, China); Trizol Reagent was purchased from ShengGong Biological Engineering (Shanghai, China); Reverse transcriptase, fluorescence quantitative Ploymerase Chain Reaction (PCR) and SYBR green I were purchased from Bioneer (Daejeon, Korea) The quantitative PCR primers were purchased from Dalian Treasure Biological Engineering (Dalian, China); rab-bit anti-rat BAX actin antibody, rabrab-bit anti-rat Bcl-2 actin antibody and horseradish peroxidase (HRP)-con-jugated goat anti-rabbit secondary antibody were pur-chased from Cell Signal Technology (Beverly, MA, USA); rabbit anti-rat caspase-3 antibody and rabbit an-ti-rat Aβactin antibody were purchased from Bioworld Technology (St Louis, MO, USA); chloral hydrate was purchased from Sinopharm Chemical Reagent (Shang-hai, China); BCA protein assay kit and enhanced che-miluminescence kit were purchased from Pierce (Rock-ford, IL, USA)
Establishment of animal model and grouping
Aβ1-40 was incubated according to the manufacturer's instructions to allow the change in an assembly state of the peptide with ensuing toxicity Fifty-six rats were used in the experiment.6Except for the randomly cho-sen 8 rats that served as the normal controls, the re-maining 48 rats were sedated with 10% chloral hydrate (3-4 mL/kg) by intraperitoneal injection The hair on the skull was shaved and the skin was disinfected with 75% alcohol The skin on the skull was then incised and the periosteum was removed Referring to the Paxi-nos and Watson Rat Brain Atlas,7the bregma served as the 0 point Then, 3 mm ventral from bregma, a
crani-al drill was employed to drill a hole through the skull 1.5 mm to the left and right of the midline A needle was inserted 3 mm deep and a microsyringe was used
to infuse 2 μL double-distilled H2O bilaterally into the hippocampus of the sham-surgery group The remain-ing groups were injected with 2 μL Aβ1-40 at a con-centration of 2.5 μg/μL (equivalent to 5 μg Aβ) and a speed of 0.5 μL/min The needle was then held in place for 10 minutes after infusion to prevent leakage Once the needle was removed, the scalp was sutured and iodine was used to disinfect the incision Except for the normal control group (0 + NS) and the sham-surgery group (NS + NS), the remaining 40 suc-cessfully established model rats were randomly divided into five groups according to a random number se-quence generated by a computer, with eight rats in each group: model control group (Aβ + NS), positive control group (Aβ + Aricept) treated with Aricept [1.67 mg·kg－1·d－1], and three QK-treated groups (Aβ + L-FJ/Aβ + M-FJ/Aβ + H-FJ) treated respectively with QK at various dosages according to the equivalent
Trang 3adult human clinical dose (low-dose QK: 4.75 mg·kg－1·
d－ 1; middle-dose QK: 9.5 mg·kg－ 1·d－ 1; high-dose
QK: 19 mg·kg－1·d－1 Starting the following day, the
rats were intragastrically administered the respective
QK dose place for 14 days at a volume of 10 mg·kg－1·
d－1 (starting at 10 o'clock in the morning every day)
The control and model groups were given equivalent
volumes of normal saline solution
Cortex sample handling
At the end of the experiment, the rats were
anaesthe-tized with 10% chloral hydrate (3-4 mL/kg) via
intra-peritoneal injection The rats were then connected to
the infusion apparatus, and the chest was opened along
both sides of the sternum avoiding large blood vessels
to expose the heart A needle was inserted into the tip
of the heart and into the aorta The needle was then
fixed with a vascular clamp and the right atrial
append-age was incised Cold saline (250 mL) was infused
un-til the liver was clear, which was followed by 250 mL
cold (4℃) paraformaldehyde The brains were quickly
removed and further fixed in 4% paraformaldehyde
The cortex was rapidly separated from the brain and
stored at －80℃
Quantification of mRNA expression of Bcl-2, Bax,
caspase-3, and A β in the cortex using real-time
quantitative PCR
Measurement of concentration and integrity detection
of total RNA extraction Total RNA was extracted
ac-cording to Trizol kit instructions RNA integrity was
tested by separating the RNA by 1.5% agarose gel
elec-trophoresis The RNA solution was diluted and zeroed
with diethypyrocarbonate water (DEPC water) The
OD values (A260/A280) at 260 nm and 280 nm were
obtained by ultraviolet spectrophotometer to determine
RNA purity and to calculate the RNA concentration
Synthesis of cDNA A mixture of 1.0 μL (1.0 μg/μL)
template total RNA, 2.0 μL (T18, 10 pmol/μL) and
2.0 μL (10 mmol/L) dNTP mix was placed into a
cen-trifuge tube (0.5 mL) and water was added to a total of
15.0 μL After mixing, the RNA was denatured for 10 min at 25 ℃ The sample was centrifuged to collect the solution at the bottom of the centrifuge tube, and then 4.0 μL 5× reaction buffer, 1.0 μL RNase inhibi-tor, and 1.0 μL M-MLV RT were added to the sample, water was added to a total of 25.0 μL The reaction was extended at 42 ℃ for 60 min, maintained at 85 ℃ for 5 min, and then terminated The synthesized
cD-NA was stored at －20℃
Design of PCR primer Primers for Bcl-2 mRNA, Bax mRNA, caspase-3 mRNA, and Aβ mRNA were de-signed according to the standard principle of real-time PCR primer designation (Shanghai Rui Jingsheng Bio-logical Engineering Co., Ltd., Shanghai, China) Fluorescence real-time quantitative PCR detection The reaction mixture was as follows (50 μL total): 25 μL 2× PCR buffer, 0.6 μL × 2 primers (25 pmol/μL), 0.3 μL SYBR green I (20×), 1 μL cDNA template, and 22.5 μL DEPC H2O The PCR amplification reaction condi-tions were as follows: 94℃ for 4 min; 94 ℃ for 20 sec-onds, 60 ℃ for 30 seconds, and 72 ℃ for 30 seconds for 35 cycles, following by 72 ℃ elongation Dissolu-tion curve analyses were performed on the amplified PCR products Sequence Detection Software 2.2 was used to analyze the data and calculate the Ct value, which was the value for each sample to reach the threshold value during PCR amplification The relative expression quantities of each sample (Bcl-2/β-actin, Bax/β-actin, caspase-3/β-actin, and Aβ/β-actin) were obtained followingβ-actin correction (Table 1)
Western blot assay
Following extraction of tissue protein, the protein con-centration was determined using the BCA protein as-say kit according to kit instructions The OD562 value and the protein concentration standard curve were used to calculate the total sample protein concentra-tion Tissue extracts were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis Equal amounts of protein were subjected to electrophoresis
on 10% SDS-PAGE gels and then the proteins were
Primers
Bcl-2
Bax
Caspase-3
Aβ
β-actin
Sequence (5'-3')
Upstream Downstream
Upstream Downstream
Upstream Downstream
Upstream Downstream
Upstream Downstream
Amplified fragment length GTGAACTGGGGGAGGATTGT GCATCCCAGCCTCCGTTA CCCGAGAGGTCTTCTTCCG GAAGTCCAGTGTCCAGCCCA CGAAACTCTTCATCATTCAGGC AGTAAGCATACAGGAAGTCGGC CTGGAGGTGCCCACTGATG GGGTCTGACTCCCATTTTCC CCCATCTATGAGGGTTACGC TTTAATGTCACGCACGATTTC
bp 167 -167 -129 -150 -150
-Annealing temperature (℃)
51 -50 -54 -55 -51 -Table 1 Ploymerase chain reaction primers
Trang 4transferred to polyvinylidene difluoride (PVDF)
mem-branes using an electrophoretic transfer system The
PDVF membranes were then blocked for 1 h at room
temperature and incubated with primary antibodies
(Bax, Bcl-2, and caspase-3 were diluted 1∶500, and Aβ
was diluted 1∶100 in TBS) overnight at 4 ℃ After
three washes with TBST for 5 min each, the
mem-branes were incubated with horseradish
peroxidase-con-jugated goat anti-rabbit secondary antibody (1∶1000)
at room temperature for 2 h Finally, after washing the
membranes three times with TBS for 5 min each,
im-mune-labeled bands were identified by using a
chemilu-minescence-based detection kit (Pierce) The OD
val-ues for Bax, Bcl-2, caspase-3, Aβ, and β-actin were
ob-tained using the Quantity One Gel Analysis System
(Bio-Rad, Hercules, USA)as follows: target-protein
op-tical density ratio = opop-tical density value of the target
protein To reduce experimental error, the western blot
assay was performed three times for each rat
Immunohistochemistry and quantitative analysis
The fixed brain tissues were dehydrated through an
al-cohol gradient, followed by xylene The tissues were
then embedded in paraffin and sectioned on a cryostat
at a thickness of 5 μm Sections were dewaxed and
sub-jected to 3% H2O2 for 10 min, followed by several
washes in distilled water Then sections to
heat-mediat-ed antigen retrieval with 0.01 M citric acid buffer (pH
6.0) Following several washes in phosphate-buffered
saline (PBS), sections were bolcked with 10% goat
se-rum (30 min), and then incubated with rabbit anti-rat
BAX antibody (1∶1000), Bcl-2 antibody (1∶1000),
Caspase-3 antibody (1∶1000) and Aβ antibody (1∶
1000) at 4℃ overnight After incubation with the goat
secondary antibody, at room temperature for 2 h After
detected with a DAB staining kit, the sections were
counterstained with hematoxylin The MIAS Medical
System (Media Cybernetics, Rockville, MD, USA) was
used for image analysis A total of six sections were
se-lected for each group, and five fields were analyzed on
each section (× 400 magnification) All positive cells
were selected within the view, and the computer
soft-ware IPP6.0 image analysis system (Media
Cybernet-ics) automatically calculated the cell density The
posi-tive target area/total area of the field of view was
calcu-lated for quantitative expression
TUNEL assay
To detect cells undergoing apoptosis, TUNEL was
per-formed according to the manufacturer's protocol
sup-plied within the TUNEL-pod kit (Roche, Basle,
Swit-zerland) The brain sections were first immersed in
xy-lene and dehydrated through serial alcohol dilutions
followed by a wash step in distilled water After
treat-ing with 3% H2O2 for 10 min at room temperature,
the sections were incubated with proteinase K for
20 min at 37° C to enhance permeability Then, the
sections were incubated for 60 min with TUNEL
reac-tion mixture and for 30 min with converter-POD at
37℃ After incubating for 10 min with DAB substrate solution (Zymed, San Diego, CA, USA), the sections were counterstained with hematoxylin, and then exam-ined under a light microscope Positive and negative controls were included on slides from the same block Stained slides were randomly observed at a high-power field (× 400 magnification), and pathological changes near the injection site were photographed The image pictures were processed using America IPP6.0 software (Media Cybernetics, Rockville, MD, USA) and the apoptotic ratio was calculated according to the follow-ing formula: apoptotic ratio = number of TUNEL-posi-tive cells/ total number of cells
HE staining
In brief, after the paraffin sections were dewaxed, hema-toxylin staining was performed for 3 min, followed by eosin staining for 3 s The sections were then
dehydrat-ed with alcohol, followdehydrat-ed by xylene, and then cover-slipped Cortical histopathological abnormalities were investigated under a light microscope Two different pa-thologists quantified the number of cells in the cortical region of each section in a blinded manner, and the av-erage number was served as the final result
Statistical analysis
All data were processed using SPSS 16.0 statistical soft-ware (SPSS, Chicago, IL, USA) All data were
ex-pressed as mean ± standard deviation ( xˉ ± s) Least
sig-nificant difference and Dunnett test were performed
for group comparisons P < 0.05 was the statistically
significant level
RESULTS
Comparison of mRNA expression of Bcl-2, Bax, caspase-3, and A β in the cortex
Results showed no significant difference in mRNA ex-pression of Bcl-2, Bax, caspase-3, and Aβ between the
normal control and the sham-surgery groups (P >
0.05) Compared with the normal control group, Bcl-2 mRNA expression in the model control group signifi-cantly decreased, whereas Bax, caspase-3, and Aβ mRNA expressions significantly increased (P < 0.01) Compared with the model control group, Bcl-2 mRNA expression in each treatment group
significant-ly increased, but Bax, caspase-3, and Aβ mRNA
expres-sions significantly decreased (P < 0.01) Bcl-2 mRNA
expression in the middle-dose QK group significantly increased, but Bax, caspase-3, and Aβ mRNA expres-sions significantly decreased compared with the
low-dose and high-dose group (P < 0.01) Compared
with the Aricept group, Bcl-2 mRNA expression in the low-dose and high-dose groups were decreased, but no significant differences in Bax mRNA expression were
found in the two groups (P > 0.05) (Figure 1).
Trang 5Comparison of Bcl-2, Bax, caspase-3, and Aβ
protein expressions in the cortex of AD rats
To investigate changes in Bcl-2, Bax, caspase-3, and
Aβ protein expression in the cortex, we used western
blot analysis Results are shown in Figure 2 There was
no significant different in Bcl-2, Bax, caspase-3, and
Aβ protein expressions between the normal control
group and the surgery control group (P > 0.05) Bax,
caspase-3, and Aβ protein expression significantly
in-creased in the model control group rats, and Bcl-2
pro-tein significantly decreased, compared with the
sham-surgery group (P > 0.01) Compared with the
model control group, Bcl-2 mRNA expression in each
treatment group significantly increased, but Bax,
cas-pase-3, and Aβ mRNA expressions significantly
de-creased (P < 0.01) However, there were no differences
in Bcl-2, Bax, caspase-3, and Aβ protein expression
be-tween the middle-dose QK group and the Aricept
group (P > 0.05) (Figure 2).
Immunohistochemistry of Bcl-2, Bax, caspase-3, and
A β in the cortex
In the AD model group, there was a significant
in-crease in the number of cells expressing Bax, caspase-3,
and Aβ in the cortex, and a significant decrease in the
number of cells expressing Bcl-2 (P < 0.01; Figure 3)
compared with the other groups Following treatment
with donepezil or QKF, these results were reversed
The 9.5 mg·kg－ 1·d－ 1QK dose produced the
stron-gest effect, which was compared with 4.75 and 19 mg·
kg－ 1·d－
TUNEL assay results
Microscopic inspection of the cortical sections from
normal control and sham-surgery rats revealed morpho-logically normal neurons with no TUNEL reaction Compared with the control group, the number of apoptotic cells significantly increased in the model
group (P < 0.01; Figure 4) After treatment with
done-pezil or QK, the number of TUNEL-positive cells sig-nificantly decreased compared with the model group
(P < 0.01) The 9.5 mg·kg－1·d－1QK dose produced the strongest effect, which was comparable to 4.75 or
19 mg·kg－1·d－1
HE staining
HE staining revealed no remarkable neuronal abnor-malities in the cortex of rats in the control and sham-surgery groups The pyramidal cells were neatly and tightly arranged, and no cell loss was found Addi-tionally, for these groups, the cells were round and in-tact with clear, dark-blue nuclei (Figure 5) However, obvious cortical histopathological damage was ob-served in the model groups The pyramidal layered structure was disintegrated, and neuronal loss was found Neurons with pyknotic nuclei and with a shrunken or irregular shape were also observed (Figure 5C) These abnormalities were attenuated by treat-ment The cells in the Aricept and QK groups
exhibit-ed better cell morphology and were more numerous than in the model group, but were overall worse than
in the control and sham-surgery groups (Figure 5D, 5E)
DISCUSSION
AD is the most common type of dementia The inci-dence of AD increases with age, which is compounded
0.40 0.35 0.30 0.25 0.20 0.15 0.10 0.05 0.00
0+NS NS+NS Aβ+NS Aricept L-FJ M-FJ H-FJ
Groups
0.40
0.35
0.30
0.25
0.20
0.15
0.10
0.05
0.00
0+NS NS+NS Aβ+NS Aricept L-FJ M-FJ H-FJ
Groups
0.40 0.35 0.30 0.25 0.20 0.15 0.10 0.05 0.00
0+NS NS+NS Aβ+NS Aricept L-FJ M-FJ H-FJ
0.35
0.30
0.25
0.20
0.15
0.10
0.05
0.00
0+NS NS+NS Aβ+NS Aricept L-FJ M-FJ H-FJ
Figure 1 Cortical mRNA expression of Bax, Bcl-2, caspase-3, and Aβ
A: Bax; B: Bcl-2; C: caspase-3; D: Aβ 0+NS: normal control group (no treatment); NS+NS: sham-surgery group (no treatment); Aβ+ NS: model control group (no treatment); Aricept: treated with Aricept (1.67 mg ·kg －1 ·d －1 ); L-FJ: treated with QK (low dose of 4.75
mg ·kg －1 ·d －1 ); M-FJ: treated with QK (medium dose of 9.5 mg ·kg －1 ·d －1 ); H-FJ: treated with QK (high dose of 19 mg ·kg －1 ·d －1 ) NS: normal saline; Aβ: amyloid-β 1-40 protein; L-FJ: low dose of QK (4.75 mg ·kg －1 ·d －1 ); M-FJ: medium dose of QK (9.5 mg ·kg －1 ·d －1 ); H-FJ: high dose of QK (19 mg ·kg －1 ·d －1 ) Data are presented as mean ± standard deviation (n = 6) Significant differences com-pared with NS+NS (sham-surgery) group at the same time point are designated as a P < 0.01 and with Aβ+NS (model control) group at the same time point as b P < 0.01, c P < 0.05, and d P < 0.01.
a
a
b c
c c
a
a
Trang 6by the fact that people are living longer these days.
There are many hypotheses for AD etiology, including
the Aβ waterfall hypothesis,8,9 immune and
inflamma-tory involvement hypothesis,10,11the cholinergic defects
hypothesis,12,13 the tau protein hyperphosphorylation
hypothesis,14,15the intracellular calcium homeostasis
dis-orders hypothesis,16,17 and the peroxidation
hypothe-sis.18It has been suggested that the incidence of AD is
caused by multiple factors, and Aβ deposition in
neu-ronal cells of the brain is the initial event that occurs in
AD.19Therefore, for the present study, the bilateral
hip-pocampi of rats were injected with Aβ1-40 fragments
to establish an experimental model of AD This
meth-od has been shown to be stable and reliable and very
ef-fectively simulates the pathological and
pathophysiolog-ical characteristics of AD.20-22
Aβ is neurotoxic and induces apoptosis through a
se-ries of pathological and physiological mechanisms that
lead to AD,23such as activation of glial cells, which
ini-tiates neuroinflammation,24induction of the
inflamma-tory cascade,25 induction of oxidative stress
mecha-nisms,26,27and excessive expression of NO and NO
tox-icity.28Taken together, these results suggest that
Aβ-in-duced neuronal apoptosis is an important pathological
characteristic of AD Caspase-3 is an effector of
apopto-sis and the final executor of apoptoapopto-sis.29The Bcl-2
fami-ly is intricatefami-ly involved in neuronal apoptosis; Bcl-2 is
an important endogenous anti-apoptotic gene, Bax is
the most important pro-apoptotic gene in this family,30
and the ratio between these two genes plays a role in the physiological state Previous experiments31 have shown that Aβ can lead to increase toxicity in neural stem cells, reduced Bcl-2 expression, increased Bax ex-pression, and imbalanced Bax/Bcl-2 ratios, all of which undermine the integrity of cell membranes
Compared with the model group, Bcl-2 expression in-creased and Bax, caspase-3, and Aβ expression de-creased in the cortex of each QK treatment group In conclusion, QK significantly increased expression of Bcl-2, down-regulated expression of Bax, caspase-3, and Aβ, and reduced the number of apoptotic cells in the cortex
REFERENCES
1 Zhang JB Complete Works of jingyue, Shanghai: The sec-ond facility press, 2006: 685.
2 Wang YF Yan QL uses the clearing method in the treat-ment of Alzheimer's disease experience Jiang Su Zhong Yi
Za Zhi 2004; 25(3): 10-11.
3 Hong W Zhang Jingyue's academic thoughts about de-mentia Hebei Zhong Yi Za Zhi 2000; 22(7): 551-552.
4 Yan QL, Xing B Development of TCM treatment in Al-zheimer's disease objective and method Zhong Yi Za Zhi 2003; 44(10): 725-726.
5 Hu HY, Cui ZH, Li HQ, et al Fumanjian, a Classic
Chi-6.0
5.0
4.0
3.0
2.0
1.0
0.0
0+NS NS+NS Aβ+NS Aricept L-FJ M-FJ H-FJ
Groups
a
2.5 2.0 1.5 1.0 0.5 0.0
a
0+NS NS+NS Aβ+NS Aricept L-FJ M-FJ H-FJ
Groups
3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0
0+NS NS+NS Aβ+NS Aricept L-FJ M-FJ H-FJ
a
b
3.0
2.5
2.0
1.5
1.0
0.5
0.0
0+NS NS+NS Aβ+NS Aricept L-FJ M-FJ H-FJ
a
Bcl-2 β-actin
Aβ β-actin
kDa 26 43 87 43
Bax
β-actin
Caspase-3
β-actin
kDa 21 43 17 43
D C
Figure 2 Protein expression of Bcl-2, Bax, caspase-3, and Aβ in the cortex
A and E: protein levels of Bax in all groups B and F: protein levels of Bcl-2 in all groups C and G: protein levels of caspase-3 in all groups D and G: protein levels of Aβ in all groups 0 + NS: normal control group (no treatment); NS + NS: sham-surgery group (no treatment); Aβ + NS: model control group(no treatment); Aricept: treated with Aricept (1.67 mg ·kg －1 ·d －1 ); L-FJ: treated with QK (low dose of 4.75 mg ·kg － 1 ·d － 1 ); M-FJ: treated with QK (medium dose of 9.5 mg ·kg －1 ·d －1 ); H-FJ: treated with QK (high dose of 19 mg ·kg －1 ·d －1 ) NS: normal saline; Aβ: amyloid-β 1-40 protein; L-FJ: low dose of QK (4.75 mg ·kg －1 ·d －1 ); M-FJ: medium dose of QK (9.5 mg ·kg －1 ·d －1 ); H-FJ: high dose of QK (19 mg ·kg －1 ·d －1 ) Data are presented as mean ± standard deviation (n = 6) Significant differences compared with NS + NS (sham-surgery) group are designated as a P < 0.01 and with Aβ + NS (model con-trol) group as b P < 0.01, c P < 0.01, and d P < 0.05.
Trang 70.20
0.15
0.10
0.05
0.00
0+NS NS+NS Aβ+NS Aricept L-FJ M-FJ H-FJ
a
0.30
0.25
0.20
0.15
0.10
0.05
0.00
0+NS NS+NS Aβ+NS Aricept L-FJ M-FJ H-FJ
Groups
0.25 0.20 0.15 0.10 0.05 0.00
0+NS NS+NS Aβ+NS Aricept L-FJ M-FJ H-FJ
Groups
0.16 0.12 0.08 0.04 0.00
0+NS NS+NS A β+NS Aricept L-FJ M-FJ H-FJ
Figure 3 Immunohistochemical staining of the cortex (× 400)
A1-H1: OD level of BAX in all groups A2-H2: OD level of Bcl-2 in all groups A3-H3: OD level of caspase-3 in all groups A4-H4: OD level of Aβ in all groups A: control; B: sham-surgery; C: control model; D: Aricept; E: low-dose QK; F: middle-dose QK; G: high-dose
QK 0+NS: normal control group(no treatment); NS+NS: sham-surgery group (no treatment); Aβ+NS: model control group (no treatment); Aricept: treated with Aricept (1.67 mg ·kg －1 ·d －1 ); L-FJ: treated with QK (low dose of 4.75 mg ·kg －1 ·d －1 ); M-FJ: treated with QK (medium dose of 9.5 mg ·kg －1 ·d －1 ); H-FJ: treated with QK (high dose of 19 mg ·kg －1 ·d －1 ) NS: normal saline; Aβ: amyloid-β 1-40
protein; L-FJ: low dose of QK (4.75 mg ·kg －1 ·d －1 ); M-FJ: medium dose of QK (9.5 mg ·kg －1 ·d －1 ); H-FJ: high dose of QK (19 mg ·kg －1 ·
d － 1 ) Data are presented as mean ± standard deviation (n = 6) Significant differences compared with NS + NS (sham-surgery) group are designated as a P < 0.01 and with Aβ + NS (model control) group as, b P < 0.01 and c P < 0.01.
D2
B2 A2
G1
C1
Trang 8nese Herbal Formula, Can Ameliorate the Impairment of
Spatial Learning and Memory through Apoptotic
Signal-ing Pathway in the Hippocampus of Rats with
Aβ1-40-In-duced Alzheimer's Disease EVID-BASED COMPL ALT
2014 Available from URL: http://dx.doi.org/10.1155/
2014/942917.
6 Zhang YL, Liou DM, Wu QS, Yao YY, Li WP Effect of
the extract of astragalus on the ability of learning and
memory and the expression of Bcl-2 and Bcl-xl protein
of the hippocampal neurons in rat model of Alzheimer's
Disease Anhui Yi Ke Da Xue Xue Bao 2007; 42(3):
299-302.
7 George P, Charles W The rat brain in stereotaxic
coordi-nates Thirded Beijing: People, Publishing House, 2005:
30-36.
8 Zhao WQ, Fernanda GDF, Sara F, et al Amyloid beta
oligomers induce impairment of neuronal insulin
recep-tors FASEBJ 2008; 22(1): 246-260.
9 Viola KL, Velasco PT, Klein WL Why Alzheimer's
dis-ease is a disdis-ease of memory: the attack on synapses by
A-beta oligomers (ADDLs) J Nutr Health Aging 2008; 12
(1): 51S-57S.
10 Ojala J, Alafuzoff I, Herukka SK, van Groen T, Tanila H,
Pirttila T Expression of interleukin-18 is increased in the
brains of Alzheimer's disease patients Neurobiol Aging
2009; 30(2): 198-209.
11 Vasto S, Candore G, Listi F, et al Inflammation, genes and zinc in A1zheimer's disease Brain Res Rev 2008; 58 (l): 96-105.
12 Gulledge AF, Stuart GJ Cholinergic inhibition of neocor-tical pyramidal neuron J Neurosci 2005; 25(44): 10308-10320.
13 Watanabe T, Yamagata N, Takasaki K, et al Decreased acetylcholine release is correlated to memory impairment
in the Tg2576 transgenic mouse model of Alzheimer's dis-ease Brain Res 2009; 1249(1): 222-228.
14 Muntane G, Dalfo E, Martinez A, Ferrer I Phosphoryla-tion of tan and alpha-synuclein in synaptic-enriched frac-tions of the frontal cortex in Alzheimer's disease, and in Parkinson's disease and related alpha-synucleinopathies Neuroscience 2008; 152(4): 913-923.
15 Hanger DP, Anderton BH, Noble W Tau phosphoryla-tion: the therapeutic challenge for neurodegenerative dis-ease Trends Mol Med 2009; 15(3): 112-119.
16 Thibault O, Gant JC, Landfield PW Expansion of the calcium hypothesis of brain aging and Alzheimer's disease: minding the store Aging Cell 2007; 6(3): 307-317.
17 Cheung KH, Shineman D, Mulle M, et al Mechanism of Ca2+ disruption in Alzheimer's disease by Presenilin regu-lation of InsP3 receptor channel gating Neuron 2008; 58
0+NS NS+NS Aβ+NS Aricept L-FJ M-FJ H-FJ
Groups
1.0 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0.0
a b
c c
E
Figure 4 TUNEL staining showing cell apoptosis in the cortex (× 400)
A: control; B: sham-surgery; C: control model; D: Aricept; E: low-dose QK; F: middle-dose QK; G: high-dose QK Apoptosis is ex-pressed as the percentage of the number of TUNEL-positive cells to the total number of cells 0+NS: normal control group (no treatment); NS + NS: sham-surgery group (no treatment); Aβ + NS: model control group (no treatment); Aricept: treated with Ari-cept (1.67 mg ·kg － 1 ·d －1 ); L-FJ: treated with QK (low dose of 4.75 mg ·kg － 1 ·d －1 ); M-FJ: treated with QK (medium dose of 9.5 mg ·kg － 1 ·d －1 ); H-FJ: treated with QK (high dose of 19 mg ·kg －1 ·d －1 ) NS: normal saline; Aβ: amyloid-β 1-40 protein; L-FJ: low dose of QK (4.75 mg ·kg －1 ·d －1 ); M-FJ: medium dose of QK (9.5 mg ·kg －1 ·d －1 ); H-FJ: high dose of QK (19 mg/kg/d) TUNEL: Termi-nal-deoxynucleoitidyl Transferase mediated nick end labeling Data are presented as mean ± standard deviation (n = 6) Signifi-cant differences compared with NS + NS (sham-surgery) group are designated as a P < 0.01 and with Aβ + NS (model control) group as c P < 0.01 and b P < 0.01.
Figure 5 HE staining showing cellular morphology in the cortex (× 200)
A: control (no treatment); B: sham-surgery (no treatment); C: control model (no treatment); D: Aricept (1.67 mg ·kg －1 ·d －1 ); E: QK groups (medium dose of 9.5 mg ·kg －1 ·d －1 ) Rats in the control and sham-surgery groups did not show histopathological abnor-malities In the model group, remnants of the pyramidal cells were irregularly arranged and some exhibited a shrunken and irreg-ular shape Cells in the Aricept and QK groups exhibited better cell morphology and were more numerous than in the model group HE: hematoxylin eosin.
Trang 9(6): 871-883.
18 Reed T, Perluigi M, Sultana R, et al Redox Proteomic
identification of 4-hydroxy-2-nonenal-modified brain
pro-teins in amnestic mild cognitive impairment: insight into
the role of lipid peroxidation in the progression and
patho-genesis of Alzheimer's disease Neurobiol Dis 2008; 30(1):
107-120.
19 Moir RD, Tanzi RE LRP-mediated clearance of Aβ is
in-hibited by KPI-containing is form of APP Curr Alzheimer
Res 2005; 2(2): 276-280.
20 Shin RW, Ogino K, Kondo A, et al Amyloid β-protein
(Aβ)1-40 but not Aβ1-42 contributes to the experimental
formation of Alzheimer disease amyloid fibrils in rat brain.
J Neurosci 1997; 17(21): 8187-8193.
21 Yamaguchi Y, Miyashita H, Tsunekawa H, et al Effects of
a novel cognitive enhancer,
spiro[imidazo-[1,2-a]pyri-dine-3,2-indan]-2(3H)-one (ZSET1446), on learning
im-pairments induced by amyloid- β1-40 in the rat J
Pharma-col Exp Ther 2006; 317(3): 1079-1087.
22 Zou K, Kim D, Kakio A, et al Amyliod β-protein (Aβ)
1-40 protects neurons from damage induced by Aβ1-42 in
culture and in rat brain J Neurochem 2006; 87(3):
609-619.
23 Zhang HS, Lin Q, Yang DH Research progress of Aβ
tox-icity mechanism of Alzheimer's diseas Zhong Guo Dang
Dai Yi Yao 2009; 16(9): 23-24.
24 Stein TD, Andersn J, Decarli C, Chan SL, Mattson MP,
Johnson JA Neutralization of transthyretin reverses the
neuroprotective effects of secreted amyloid precursor
pro-tein (APP) in APPSW mice resulting in tau phosphoryla-tion and loss of hippocampal neurons: support for the am-yloid hypothesis Neurosci 2004; 24(35): 7707-7717.
25 Streit WJ Microglia and Alzheimer's disease pathogene-sis J Neurosci Res 2004; 77(1): 1-8.
26 Klyubin I, Walsh DM, Lemere CA, et al Amyloidbeta protein immunothempy neutralizes Abeta oligomem that
disrupt synaptic plasticity in vivo Nat Med 2005; 11(5):
556-561.
27 Ma GS, Chen SD, Ba MW, et al Aβ Induced Glioma Cell U251 Protein Aggregates Formation of Oxygen Con-tent and Mitochondrial Membrane PoCon-tential Increasedac.
J Neurol 2005; 38(4): 265-266.
28 Rowan MJ, Klyubin I, Wang Q, Anwyl R Synaptic plas-ticity disruption by amyloid beta protein:modulation by potential Alzheimer's disease modifying therapies Bio-chem Soc Trans 2005; 33(Pt 4): 563-567.
29 Ozoren N, El-Deiry WS Cell-surface-death-receptor-sig-naling in normal and cancer cells J Semin Cancer Biol 2003; 13: 135-147.
30 Fletcher JI, Meusburger S, Hawkins CJ, et al Apoptosis
is triggered when prosurvival Bcl-2 proteins cannot re-strain Bax Proc Natl Acad Sci USA 2008; 105(47): 18081-18087.
31 Holsinger RM, Schnarr J, Henry P, Castelo VT, Fahne-stock M Quantitation of BDNF mRNA in human pari-etal cortex by competitive reverse transcription- poly-merase chain reaction:decreased levels in Alzheimer's dis-ease Brain Res 2000; 76(2): 347-354.