Identification Of The Pathogen Causing Root And Stem Rot Disease Asparagus (Asparagus Officinalis L.) Cultivated In Ninh Thuan Province

20 3.1 Morphological and cultured characteristics of asparagus root and stem rot pathogen in Ninh Thuan..... The study “Identification of the pathogen causing root and stem rot disease A

NGUYEN TAT THANH

TRUE LEARNING - TRUE PRACTICE - TRUE SUCCESS - TRUE FUTURE

GRADUATION THESIS

Ho Chi Minh City, 2020

TABLE OF CONTENTS ii

ABSTRACT V LIST OF FIGURES vi

LIST OF TABLES vii

LIST OF ACRONYMS viii

INTRODUCTION ix

CHAPTER 1 LITERATURE REVIEW 1

1.1 An overview of asparagus plants 1

1.1.1 Classify 1

1.1.2 Morphological characteristics 2

1.1.3 Ecological characteristics 2

1.2 The nutritious and economic value of the asparagus plant 3

1.2.1 The nutritious and medicinal value of the asparagus plant 3

1.2.2 The economic value of asparagus 3

1.3 Production and consumption of asparagus in the World and Vietnam 4

1.3.1 Production and consumption of asparagus in the World 4

1.3.2 Production and consumption of asparagus in Vietnam 4

1.4 Diseases of asparagus 5

1.5 Identify the pathogen through morphological characteristics 8

1.6 Identify the pathogen through molecular characteristics 8

1.6.1 PCR reaction 8

1.6.2 ITS sequence region 8

1.6.3 Electrophoresis 9

1.7.2 Research situation in Vietnam 10

CHAPTER 2 CONTENTS AND METHODS 12

2.1 Place of administration 12

2.2 Contents 12

2.3 Research materials 12

2.4 Methods 12

2.4.1 Sampling 12

2.4.2 Isolation and identification of the pathogen through morphological characteristics 12

2.4.2 Pathogenicity test 14

2.4.3 Determination of the pathogen by molecular identification 14

2.5 Inquiry into the temperature and pH effects of the growth and development of pathogens 19

2.5.1 Inquiry into the temperature effects of the growth and development of pathogens 19 2.5.2 Inquiry into the temperature effects of the growth and development of pathogens 19 The experiment to investigate the effect on the pH on the growth and development of the fungus were arranged including 5 treatments, 3 replicates/treatment, each treatment was one petri dish with a diameter of 9 cm 19

CHAPTER 3 RESULTS AND DISCUSSION 20

3.1 Morphological and cultured characteristics of asparagus root and stem rot pathogen in Ninh Thuan 20

3.1.1 Symptoms of disease 20

3.3 Identify the pathogen through molecular characteristics 24

3.3.1 Results of electrophoresis of the PCR products in the ITS 18S rRNA sequence region 24

3.3.2 Sequencing PCR products 25

3.3.3 BLAST fungal strains isolated 26

3.3.4 Phylogenetic trees 27

3.4 Inquiry into the temperature and pH effects of the growth and development of fungi F equiseti and F proliferatum 29

3.4.1 Inquiry into the temperature effects of the growth and development of fungi F equiseti and F proliferatum 29

3.4.2 Inquiry into the pH effects of the growth and development of fungi F equiseti and F. proliferatum 32

CONCLUSIONS AND RECOMMENDATIONS 37

REFERENCES 38

APPENDICES 41

The study “Identification of the pathogen causing root and stem rot disease Asparagus (Asparagus Officinalis L.) cultivated in Ninh Thuan province” was carried out between April 2020 and September 2020 in Molecular Biology lab, Faculty of Biotechnology, Nguyen Tat Thanh University to identify the root and stem rot pathogens in Asparagus The contents of this study include: Identification of morphology and culture characteristics of root and stem rot disease among the Asparagus cultivated in Ninh Thuan; Identification of molecular pathogen; Pathogenicity test; Inquiry into the temperature and Hydrogen power (pH) effects of the growth and development of pathogens.

Results:

1 Isolations of asparagus root and stem rot pathogen on PGA medium at room temperature for seven days, the mycelium is white, the filaments are spongy and pigmented on agar medium Fungal spores are crescent-shaped with the septum

2 Genetic characteristics based on the 18S rRNA gene sequence revealed that

fungal strains Fusarium sp in this study originated from the same species with the strains of Fusarium equiseti (isolated from many countries in the world such as Pakistan, China) and Fusarium proliferatum (isolated in the Netherlands with 100%

Figure 1.1 Asparagus plant 1

Figure 1.2 Common disease on asparagus 7

Figure 1.3 ITS rRNA sequence region 9

Figure 3.1 Symptoms of root and stem rot disease in the field 20

Figure 3.2 Morphology of colonization on PGA medium 22

Figure 3.3 Fungal spores under a microscope 23

Figure 3.4 Results of pathogenicity test 24

Figure 3.5 Total DNA test 24

Figure 3.6 Results of the electrophoresis of PCR products 25

Figure 3.7 Results of reading the sequence file using BioEdit software 26

Figure 3.8 Results of BLAST strains isolated from group 1 on the gene bank 26

Figure 3.9 Results of BLAST strains isolated from group 2 on the gene bank 26

Figure 3.10 Phylogenetic tree isolated fungus 28

Figure 3.11 Effect of temperature on growth of F equiseti on petri dishes 30

Figure 3.12 Effect of temperature on growth of F proliferatum on petri dishes 31

Figure 3.13 Effect of pH on growth of F equiseti on petri dishes 33

Figure 3.14 Effect of pH on growth of F equiseti on petri dishes 35

Table 2.1 Component content of PCR reaction 17

Table 2.2 PCR cycling conditions 17

Table 3.1 Reference strains 27

Table 3.2 Assessment of the effect of temperature on the growth of fungi F equiseti29

Table 3.3 Assessment of the effect of temperature on the growth of F proliferation 30

Table 3.4 Assessment of the effect of pH on the growth of F equiseti 33

Table 3.5 Assessment of the effect of pH on the growth of F proliferation 34

bp Base pair

1 Rationale for this thesis

Asparagus (Asparagus officinalis L.), belongs to the genus Asparagus,

Asparagaceae is a perennial vegetable native in the Middle East The product is a spear

of the tree which is used as vegetables with high nutritious substances helping humans

in health improvement Asparagus plants are more and more appreciated and expanded

in several provinces such as Hai Phong, Binh Phuoc, Lam Dong, Tien Giang, Long An,

Ho Chi Minh City, and Ninh Thuan In Binh Phuoc, Long An, Ninh Thuan provinces, and Ho Chi Minh City, the Asparagus has gradually replaced the low-value and low- yield vegetable crops to become the province's specific crops

Asparagus is a light-demanding species and grows well in the tropics whose average annual temperature is always high Among the areas growing asparagus, Ninh Thuan province is the location with the most suitable conditions of soil and climate for planting and development on the large-scale Besides aloe vera, rice, apple, and grape, asparagus is identified as an agriculturally featured product of the province Asparagus, which is a high-class vegetable and a crop with high economic value, whose market is large both in domestic regions and foreign countries, therefore the acra growing asparagus has increased significantly in recent years

However, the Asparagus is a long-day crop that is often affected by pests and diseases which are idiopathic in the farming process These idiopathic and common diseases including root and stem rot, Phytophthora rot, Phomopsis stem blight, rust, gray mold, purple spots, viral diseases, etc make the young shoots of the Asparagus grow poorly as well as affect the productivity and quality of asparagus in Ninh Thuan

In particular, root and stem rot diseases are common with the red-brown pale and oval-shaped lesions on the roots, which gradually rot the tissue Rotten asparagus plants infect each other and the disease can spread exponentially and affect the quality and productivity of asparagus growing areas It is worth noting that until now, comprehensive studies have not yet been carried out to identify the root and stem rot pathogens in asparagus in our country With all above reasons, we implemented the

thesis "Identification of the pathogen causing root and stem rot disease

2 Objectives

- Identification of morphological characteristics of pathogens

- Identification of molecular characteristics of the ITS rRNA sequence of pathogens

- Determination of the effects of temperature, pH on the growth and development

of pathogens on asparagus under in-vitro conditions

CHAPTER 1 LITERATURE REVIEW

1.1 An overview of asparagus plants

1.1.1 Classify

Scientific name and location of Asparagus

in the classification system:

Species '.Asparagus officinalis

Figure 1.1 Asparagus plant

Asparagus with the scientific name of Asparagus Officinalis L belonging to the

genus Asparagus is a large genus comprising approximately 150 species which are mostly herbaceous perennials accompanied with tender woody shrubs and vines '

There are only three species including A officinalis, A schoberrioides, and A

cochinchinensis differentiate between male and female flowers on distinctive plants

But only Asparagus Officinalis is used for vegetable purposes, the others are used as ornamental or other purposes

Currently, asparagus is divided into three categories: green asparagus, white asparagus, and purple asparagus Green asparagus, which is represented by the asparagus varieties known as California 500 and uc - 157, have high productivity and easy methods in cultivation and harvest despite their moderate value in commercial White asparagus, which is represented by the Mary Washington variety, is a popular cultivar for high yield and quality White asparagus, which is soft, crunchy, has milder flavor than green asparagus varieties because the texture of the white asparagus is less

woody White asparagus products are most popular in the markets, especially in the European markets Purple asparagus is another form of green asparagus and white asparagus They contain a great deal of sugar and little graininess Its purple color comes from the high levels of anthocyanins (powerful antioxidants) in the buds Purple asparagus is grown in Italy, American, and some other countries at an insignificant acre.

1.1.2 Morphological characteristics

Asparagus is known as a perennial, shrub, herbaceous plant Its tree is about 1.3 - 3.8 meters high, which can live from 15 to 20 years When the tree grows tall, the trunk turns green and has many branches 2

Asparagus leaves are undeveloped and coniferous with little drainage, which helps it be capable of good drought tolerance The fruit is a berry with an average diameter of 8 - 9 mm When ripping, fruits are red with three compartments, each with 5-6 black seeds, tough seed skin, the average diameter of 3 - 4 mm 1000 seeds weigh about 20 grams, 40 - 60 seeds /g3

The primary roots are very short and die as soon as the seeds germinate, the cylindrical roots are upright, the other roots grow horizontally Asparagus spears grow up near the cylindrical roots which contain the highest level of tree nutrition

1.1.3 Ecological characteristics

Asparagus seeds can germinate at 20 °C with the low germination rate at 27%, the suitable temperature for asparagus to sprout is at approximately 23 - 25 °C and to grow is at approximately 20 - 30 °C Asparagus can withstand cold temperatures theoretically, but in the condition that the temperature is below 10 °C or water is not available, trees will stop growing

Areas with robust light intensity are considered being suitable for asparagus growth Asparagus is a plant that is compatible with moisture Therefore the regular humidity reaches at 80 - 85%, asparagus spears are stimulated to grow more, soft, and sweet However, the high humidity in the air also can make the plant weak and susceptible to disease 2 Asparagus is suitable for sandy soils, heavy soil, with good

drainage, pH from 6 to 7 Asparagus has a well-developed root system that requires a high clearance of soil for maximum growth.

1.2 The nutritious and economic value of the asparagus plant

1.2.1 The nutritious and medicinal value of the asparagus plant

Asparagus can be processed into many dishes such as asparagus salad, stir-fried asparagus beef with mustard sauce, asparagus smoothie, etc depending on the personal taste and preferences

Asparagus is a highly nutritious vegetable that is low in calories with almost no fat, very little sodium, and high glutathione (26 - 40 mg / 100g in fresh weight) more than any fruit and vegetable 4

Asparagus is a rich source of carbohydrates, protein, calcium, iron, fiber, and ascorbic acid In addition to fiber, vitamins E, c, A, pyridoxine (B6), riboflavin (B2), thiamin (Bl), and folic acid, nearly !4 the weight of 100 grams of asparagus are minerals essential for the human body such as potassium, magnesium, calcium, iron 4,5.Vitamin c (ascorbic acid) is an antioxidant that can help prevent cancer, coronary artery disease, and arthritis as well as reduce the effects of aging It enhances the effectiveness of other antioxidants involving vitamin E, which has recently been proven the capability in reducing heart disease Asparagus has a high ascorbic acid content ranging from 6 - 12 mg / 100 g of white asparagus and green asparagus 6

Glutathione is a sulfur-containing antioxidant with anti-cancer properties Glutathione often participates in the human body's immune system Rich source of glutathione in asparagus, avocado, and watermelon contains 28 - 35 mg glutathione /

100g fresh weight4’7

1.2.2 The economic value of asparagus

Asparagus is a premium vegetable with great nutritious value and significant economic benefits It is not only raw material for the canning industry but is a valuable exported product grown in many countries around the world such as Europe, Asia, and America In the US, asparagus is rated as the 10th position among vegetables 2

The world's import market mainly involving Europe, Japan, Thailand, Singapore, and Taiwan, Korea at the present for asparagus is up to thousands of tons per year and has a tendency to increase year by year2.

In Vietnam, asparagus was planted during the French colonial period Many regions in the country have grown asparagus for export processing such as Dong Anh (Ha Noi), Kien An (Hai Phong), Duc Trong (Lam Dong) The main export markets of Vietnamese asparagus are Western European countries

1.3 Production and consumption of asparagus in the World and Vietnam

1.3.1 Production and consumption of asparagus in the World

Currently, the area growing asparagus over the world is about 265,000 hectares (ha), of which Asia is the largest asparagus growing region in the world Some countries with asparagus plants growing in large scale are China, America, Mexico, Germany, Peru, and Spain China is the one which owns the largest area at 93,000 ha, followed by Mexico at 29,000 ha, Germany at 28,500 ha, and Peru at 22,000 ha (https://fliphtml5.com/oyjk/xmpl/basic)

Approximately 20,700 acres of asparagus were harvested in the US in 2019 US acreage growing asparagus at the current time is just about one-third as the one 15 years ago due to the increasing imports from Central and South America Essentially all of the US commercial asparagus production occurs in Michigan, California, and Washington The national average yield in 2019 was around 4 076 pounds per acre In

2019, total asparagus production was 84.39 million pounds Approximately 502.4 million pounds of fresh asparagus was imported in 2017, mostly from Mexico, Peru, and Chili The value of the 2017 US commercial asparagus crop was approximately

$73.1 million

(https://www.agmrc.org/commodities-products/vegetables/asparagus)

1.3.2 Production and consumption of asparagus in Vietnam

In Vietnam, the asparagus plant was introduced in the 1960s - 1970s But in that time, the market can not be found, therefore asparagus can not develop It was not until 2005 that the asparagus tree reappeared in Vietnam again with its appreciable

value2 Some regions in the North have grown asparagus for export such as Dong Anh (Ha Noi), Kien An (Hai Phong), however the yield is not high at about 3-4 tons per hectare Due to a cold winter in the North, the tree can only harvest in late spring­summer Harvesting time in a year is only 4-5 months Asparagus trees can plant through the year round if farmers can actively water and take care of seedlings according to technical requirements However, it is to avoid planting during times of the year with heavy rainfall (June to September).

The situation of asparagus cultivation in Ninh Thuan province: Ninh Thuan

province is known as the land of sunshine and winds with the annual average temperature ranging from 26 to 27 °C , in which the total heat is up to 9 500 - 10

000 °C Strong winds and sandy soil are suitable conditions for the growth and development of asparagus Asparagus trees have been tested in Ninh Thuan province since 2005 Besides aloe vera, rice, apple, and grape, asparagus is identified as an agriculturally featured product of the province Asparagus planting area in 2017 reached 700 ha, the average yield 22 - 25 tons/hectare/year Asparagus is grown densely in the cities of Phan Rang - Thap Cham and Ninh Phuoc, which brings about 3-4 times more income than growing other vegetables in the same area unit This is one of the crops that make economic breakthroughs and adapt to the dry climate conditions of Ninh Thuan

1.4 Diseases of asparagus

With a tropical monsoon climate, hot and rainy weather like our country, without proper care, asparagus will be susceptible to fungal infections Fungal pathogens are the agent that causes many diseases on asparagus such as root and stem rot, Phytophthora rot, dry branches, rust, gray mold, purple spots, etc That causes underdeveloped shoots and plants, which affect the yield and quality of asparagus in Ninh Thuan

Because asparagus provides both nutritious values in daily meals and high economic value for the farmer, it is very grave for the plant to become infected with factors such as fungi and bacteria Some pathogens produce toxins in the hosts For

diseases such as cancer, hemorrhage, edema, and immunodeficiency The World Health Organization (WHO) reports that mycotoxins pose a danger to human and animal health For this reason, asparagus fungal disease needs correctly controlled Some common diseases on the current asparagus plant are:

Root and stem rot is one of the most important diseases of the asparagus plant worldwide The disease's first record in the US in 1908 8 Over the years the disease has been called dwarf asparagus, wilt and root rot, seedling blight, crown rot complex, and Fusarium stem and crown rot The disease affects seedlings and mature plants Symptoms of disease in older plants include gradual yellowing and death Sapling and shoots develop slowly, which stop growing The stem is wrinkled, yellowed, and withered The crown and roots are initially light reddish-brown, oval in shape, gradually rotting tissues and turning dark brown Rotten asparagus plants infect each other, and the disease can spread exponentially These fungi exist in the soil for a very long time, which can grow as some saprophytic bacteria and reproduce a lot The

fungus infects the tree through old roots, crown roots, wounds on trees Fusarium

species can spread by soil, plant debris, seeds, or nursery trees

Rust affects the premature depletion of asparagus caused by the fungus Puccinia

asparagi DC The disease was first described in 1805 in France 9 It was initially small oval spots, then expanded to 10-20 mm long, with a light green color, sometimes difficult to recognize especially on young plants The second stage of the disease is yellow-orange in the middle is concave and then turns light brown and swollen like pustules As these pustules age, they release large numbers of reddish-brown oozing spores that continue to infect l0 Stage three, on the lesions, appear black spores loaf containing spores This spore form helps the fungus survive the winter and cause it to return next season This phase requires moisture to infect, and rust outbreaks typically occur from rain, prolonged rain 1 *’12

Phytophthora spear rot was first described in California in 1938 8 There are many types of Phytophthora fungi found from the disease samples that are confirmed

to be caused by the fungus Phytophthora megasperma Drechs 13 Symptoms include soft, wet sprouts, mucus both above and below the ground The disease develops to rot

both the base of the shoots and the spear on the land Always wet soil is a favorable condition for fungal spores to germinate and infect diseases Studies show that asparagus yield is reduced during the rainy season harvests.

Asparagus purple spot disease caused by the fungus Pleospora herbarium (anamorph Stemphylium vesicarium) was first reported in the US in 1981 1 Diseased plants initially have small purple spots around, light brown in the middle and concave The disease usually appears in the base of shoots and the maternal stem tree In areas with a long rainy season, many patches of fog cause serious harm, seriously infected plants will lose their leaves, dry and die, on shoots become barren and slow to grow in height

Figure 1.2 Common disease on asparagus (A): Root and stem rot disease;

(B): Purple spot disease; (C): Phytophthora rot; (D): Asparagus rust)

1.5 Identify the pathogen through morphological characteristics

According to research in Spain, asparagus plants can exhibit symptoms of stunting, root rot, crown roots, and stems Reddish-brown, oval lesions on the surface

of the base and stem, the foliage can become stunted, wilted, and yellow lead to the death of seedlings The samples were collected and isolated on potato agar (PDA) Isolation plates are incubated at 25 °C for two days in the dark, then for 5 to 8 days inoculated with a 12-hour morning cycle 15 Create branched mycelium, which is usually colorless, turning brown as you age The fungus can be cotton-like or flat or spread on the culture medium Macroconidia transparent, with 3-5 septum, slightly curved, the size ranges from 3 to 8 X 11 - 70 pm Microconidia without a septum, oval

to elliptical in size 2 - 4 X 4 - 8 pm

1.6 Identify the pathogen through molecular characteristics

1.6.1 PCR reaction

Polymerase chain reaction (PCR) was invented by Mullis in 1983 and patented in

1985 Its principle is based on the use of DNA polymerase which is an in vitro replication of specific DNA sequences This method can generate tens of billions of copies of a particular DNA fragment (the sequence of interest, DNA of interest, or target DNA) from a DNA extract (DNA template)

Amplification is executed using a repeating heat cycle The PCR reaction consists of several repetitive cycles in series Each cycle consists of three phases as denaturation, annealing, and extension

1.6.2 ITS sequence region

The Internal transcribed spacer (ITS) buffer zone is an area interspersed with rDNA sequences encoding rRNAs The rRNA will combine with proteins to form a ribosome function for protein synthesis

The ribosomal RNA (rRNA) region consists of multiple copies (up to 200 duplicate for the haploid genome) arranged in parallel repetitions consisting of small 18S subunits, 5.8S, and large 28S subunit genes separated by internally transcribed buffers (ITS1 and ITS2) 16 This zone contains highly conserved areas sufficient to

design primers for homogeneous species (RNA ribosome genes), interspersed with highly variable regions allowing differentiation at multiple levels of the taxonomy (ITS region)16.

The ITS region is short in size (about 500 - 800 bp), easily amplified by PCR reaction PCR can amplify this region with characteristic primers The researchers selected the ITS region to find the genetic regions specific to the species, thereby quickly identifying the species The ITS region has been used in research to find and determine the genetic diversity of many fungal species

1.7 Research situation in the world and Vietnam

1.7.1 Research situation in the world

Root and stem rot is one of the most important diseases of the asparagus plant worldwide The disease's was first recorded in the US in 1908 8 It is caused by several species of Fusarium spp This affects seeds and mature plants

The first Fusarium pathogen found to be associated with this disease was

Fusarium oxysporum in 1941 18 F proliferatum was also discovered as a pathogen in

1979 Fusarium species that cause asparagus disease have isolated from asparagus

fields across New Zealand l9 Up to eight species of Fusarium fungi are found in asparagus soil in Australia and New Zealand Inside, F oxysporum, F equiseti, F solani, F semitectum account for over 90% But F oxysporum, F prolireatum, and F moliniforme are found in diseased asparagus fields in Australia and many other countries 20 In 2006, Corpas-Hervias et al investigated the properties of Fusarium isolated from asparagus fields in Spain 21.

According to the first report of Fusarium proliferation as the cause of asparagus root rot in Turkey in 2011, symptoms of root rot appeared in asparagus cultivated areas for 3 to 8 months Symptoms include decreased shoot tip yield and brown damage, vascular discoloration, and root, rhizome, and stem rot Based on morphological data and PCR assays, the causative agent is F proliferation 22

Ana Borrego - Benjumea et al (2013) had ninety-three Fusarium isolates, obtained from plant and soil samples taken from commercial asparagus fields in southwestern Ontario identified as F oxysporum ( 65.5%), F proliferation (18.3%), F solani (6.4%), F acuminatum (6.4%), and F redolens (3.2%) based on morphological

characteristics or cultural characteristics and PCR analysis with species-specific primers23

1.7.2 Research situation in Vietnam

In Vietnam, studies on diseases on asparagus are not universal, especially root and stem rot, which has not yet been published on the causative agent However, there have been studies of root rot and the fungal agent Fusarium also causing disease in other plant subjects

In 2008, Nguyen Thi Sao carried out the studies Investigation farming techniques, identification of the agent causation among asparagus blight (Asparagus Officinalis L.) cultivated in Cu Chi district, Ho Chi Minh City And it has identified the causative agent of the fungus Phoma sp cause Fungi thrive in the rainy season and high humidity conditions

According to the results of the research studies on solutions to control root rot disease on some specialty fruit trees in the Mekong Delta, the authors isolated and

identified the root rot pathogen Research results showed that the root rot pathogen on durian is Pythium vexans Among 18 strains of fungi isolated from citrus trees with root rot disease showed that there were eight lines of seriously pathogenic fungi belonging to three groups of fungi Phytophthora, Fusarium, and Pythium Involve,

two strains of fungi Phytophthora palmivora and Fusarium solani cause the most damage in greenhouse conditions24

Nguyen Minh Chi et al described the morphological, taxonomic, and pathogenic characteristics of the fungal strains of the genus Fusarium that cause orange root rot in Quang Ninh province The results of identification using the molecular marker: primer pair ITS 1 and ITS4, which have identified the fungal root rot pathogens of Fusarium

proliferatum species The fungus F proliferatum is pathogenic in both leaf and seed 25

In 2017, Nguyen Don Hieu et al identified the fungus Fusarium spp which causes bark rot on rubber trees in Vietnam Pathogens are isolated and preliminarily identified based on morphological characteristics and then identified by molecular techniques ITS DNA regions of 15 fungal isolates were identified in the genus

Fusarium based on PCR multiplying the ITS sequence by ITS 1 and ITS 4 primers and sequencing In all 15 fungal isolates obtained from multiple clones of rubber clones in different geographical regions, the 546 bp DNA fragment amplified 26

CHAPTER 2 CONTENTS AND METHODS

2.4 Methods

2.4.1 Sampling

The collected sample was a sample of asparagus stem and base with symptoms

of disease showing outward signs such as wrinkled stem, yellow fall, light reddish- brown disease wound, oval shape Disease samples were collected at Ninh Phuoc district, Ninh Thuan province The sample is then placed in a zip bag with name, location, and time of collection

2.4.2 Isolation and identification of the pathogen through morphological characteristics

2.4.2.1 Method of isolation of infected asparagus stem and base sample

Steps for isolation from asparagus stem and base:

1 Wipe the work area with 70% ethyl alcohol.

2 Dip instrument (forceps and knife or scalpel) in 70% ethyl alcohol and flame dry

3 Rinse the sample in water to remove soil and other debris

4 Surface sterilise stem tissue by wiping the stem tissue with a soft paper (paper tissue) dipped in 70% ethyl alcohol

5 Aseptically cut small pieces (approximately 2x2 mm) from the margin of the healthy and diseased tissue, and transfer them to a low - nutrient medium (water agar)

6 Incubate the plates at approximately 25 °C, ideally under lights

7 Check plates each day, and when fungal colonies develop from the pieces of plant tissue, transfer material from the margin to a PGA medium

2.4.2.2 Method of inoculation from isolation plates

1 Examine the plates each day and assess the growth of fungal hyphae from the cultures

2 Determine if there is more than one fungal species growing

3 Subculture when there is approximately 5 mm of hyphal from the plant tissue

4 Cut out a small block agar (2x2 mm) from the margin of each colony and transfer it to PGA medium

Tracking criteria: monitoring parameters such as morphology, structure, spores and colony color, and mycelium

2.4.2.3 Examination of fungal spores under a compound microscope

The pathogen identified by the basic methods guided by Domsch (1972), Barnet

và Hunter (1998), and on indicators such as morphology, structure, spores, and color

27.28

Chemical: Lactophenol dye

Materials: fungal spores , PGA medium

Instrument: Slide, lamen

Spores from a diseased plant or culture can be scraped off with a transfer needle and transferred to the Lactophenol drop Then proceed to observe the slide under a microscope.

2.4.2 Pathogenicity test

The method of soil inoculation was conducted according to Burgess et al (2009)29

1 Soak millet seed and rice hulls overnight in water in a refrigerator, to allow the mixture to absorb water

2 Pour the water away

3 Transfer approximately 150 mL of medium to a 250 mL conical flask

4 Cover the opening of the flask with a layer of aluminium foil and autoclave

5 Inoculate the flasks using mycelial plugs

6 Incubate at approximately 25 °C for 2 weeks under alternating light and dark conditions to allow complete colonisation of the substrate

7 Shake the flasks 2-3 days after inoculation to ensure an even distribution of the pathogen throughout the substrate

Targets and monitoring methods:

- Symptoms of the disease

T^ znzx _ Number of infected trees

Total number of trees surveyed

Pathogenicity test and asparagus check for disease symptom appearance and symptom description After that, the disease sample again (performed same content 1) and confirmed the pathogen Examination and comparison the characteristics of the re-isolated pathogenic fungi in colony shape, color, spores, mycelium with original purebred fungi to accurately close the pathogen

Plants used for the experiment are the seedlings purchased from a home garden

in Ninh Thuan After buying the tree, take care of one more month to make sure the tree does not get sick naturally Healthy plants are used to inoculate the disease

2.4.3 Determination of the pathogen by molecular identification

Materials: Mycelia cultured in content 1

Primer sequence ITS 1, ITS4Forward primer (ITS 1 -F)30: 5’- CTTGGTCATTTAGAGGAAGTAA - 3’

Reverse primer (ITS4)31: 5’ - TCCTCCGCTTATTGATATGC - 3’

2.4.3.1 Total DNA extraction

Total DNA was extracted using TopPUREK Plant DNA Extraction Kit (HI-122 - ABT, Vietnam) according to the manufacturer's instructions, the following steps:

Step 1: Sample collection: Use 30 - 100 mg of plant tissue sample into 2 ml tube, grind the sample with a glass rod and add liquid nitrogen to crush the sample effectively

Step 2: Sample resolution:

- Add 400 pl PLS 1 solution into 2 ml tube (containing sample to extract) and vortex evenly

- Add 10 pl RNase, lighten vortex and incubate at 65 °C for 30 minutes until the cell is completely dissolved

- Add 130 pl PLS 2, mix well and incubate for 5 minutes on stone or cabinet

4 °C

- After incubation, centrifuge at maximum speed (15000 rpm) for 5 minutes and suck all floating fluids (about 450 pl) into 1.5 ml tube

Step 3: Attach DNA to the silica column:

- Give PBB 1.5 times the volume of aspirated fluid in step 2, stir evenly at room temperature for 1 - 2 minutes

- Transfer 600 pl floating fluid into silica column

- Centrifugal 11000 rounds in 2 minutes

- Discard the filtrate, reuse the tube containing the solution and retain the silica column

- Continue centrifugation again with the amount of remaining mixture (DNA will now attach to the silica in the column)

Step 4: Wash the column for the first time

- Give 500 pl PWB to the silica column

- Centrifugal 11000 rounds in 1 minute

- Discard the filtrate, reuse the tube containing the solution and retain the silica column

Step 5: Wash the column for the second time

- Give 500 pl PWB to the silica column

- Centrifugal 11000 rounds in 1 minute

- Discard the filtrate, re - use the untreated tube and retain the silica columnStep 6: Dry silica column

- Centrifugal at 11000 rounds in 2 minutes

- Remove the tube containing the solution and retain the silica column

Step 7: DNA storage

- Transfer silica column to 1.5 mL tube

- Add 100 pl EB solution (incubated at 70 °C) to the silica column

- Centrifugal 11000 rounds in 2 minutes

Keep 1.5ml tube and store - 20 °C if not used

2.43.2 ITS rRNA sequence region PCR

Primer pair sequence used for PCR:

Forward primer (ITS1-F)30: 5’- CTTGGTCATTTAGAGGAAGTAA - 3’

Reverse primer (ITS4)31: 5’ - TCCTCCGCTTATTGATATGC - 3’

Table 2.1 Component content of PCR reaction

Step 1: Take 10 pl Mytaq Mix

Step 2: Take 1 pl of the forward primer

Step 3: Take 1 pl of the reverse primer

Step 4: Take 3 pl of template DNA

Step 5: Take 10 pl dd H2O

Put the above mixture in the PCR system and heat cycle as Table 2.2

Table 2.2 PCR cycling conditions

2.4.33 Electrophoresis method

The PCR products were detected by electrophoresis on agarose gel with a concentration of 1%

Step 1: Prepare 1 % agarose gel

- Add 0.5 g of agarose powder to Erlen, add 50 ml of TBE, shake to dissolve

- Put in the microwave for 1 - 2 minutes

- Allow to cool about 50 °C then pour into the pre-set mold

- Let stand for 15 - 20 minutes for the gel to solidify

Step 2: Inject the sample into the gel well and run electrophoresis

- Put the prepared gel pad into the electrophoresis tank containing TBE solution, the well part of the gel pad turns toward the cathode

- Add 2 pl of gelred dye and 3 pl of PCR sample, mix well

- Pump the entire 5 pl mixture into the gel well

- Inject the DNA ladder into the first well

- Close the lid of the electrophoresis tank and plug in the power source

- Electrophoresis was performed for 45 minutes at 60 mA

Step 3: Check the electrophoresis results

- After electrophoresis, place the gel into the gel scanner

- Observe and photograph the results

2.43.4 Sequence analysis and identification of pathogenic species on asparagus

PCR products were submitted for sequencing at 1st Base, Malaysia The sequences were used to blast with the sequences on the genbank database (Genbank) using the online software BLAST at NCBI (the National Center for Biotechnology Information) The sequence of the obtained fungus samples and the similar samples on the genbank was used for sequence analysis and genealogy using MEGA 6.0 software 32

2.5 Inquiry into the temperature and pH effects of the growth and development

Tracking criteria: Tracking the growth of fungi on days 2, 4, 6 after transplanting

by measuring colony diameter

2.5.2 Inquiry into the temperature effects of the growth and development of pathogens.

The experiment to investigate the effect on the pH on the growth and development of the fungus were arranged including 5 treatments, 3 replicates/treatment, each treatment was one petri dish with a diameter of 9 cm

Tracking criteria: Tracking the growth of fungi on days 2, 4, 6 after transplanting

by measuring colony diameter

CHAPTER 3 RESULTS AND DISCUSSION

3.1 Morphological and cultured characteristics of asparagus root and stem rot pathogen in Ninh Thuan

Figure 3.1 Symptoms of root and stem rot disease in the field

3.1.2 Isolation and purification of the pathogen

In this study, fungi were isolated on Water Agar (WA) and Potato Glucose Agar (PGA) medium in which WA is a nutrient-poor medium used to eliminate bacterial contamination in the sample The results were scored that 5 fungal strains were isolated which were divided into 2 groups with 2 typical morphologies on PGA medium

The first group consists of samples SRI, SR2, SR3, SR4 which had white and spongy mycelium which turned yellow after 6 days culturing (Figure 3.2 Al, A2) On the PGA medium after 6 days of isolation, the samples of group 1 were morphologically similar in colony shape on the agar surface In the first 2-3 days of isolation, mycelium began to form filaments that were spongy and swollen higher than the medium surface The white mycelium turned yellow by the time, the opposite side

of the plate experienced the pigment from yellow to brown The diameter of fungal strains was about 4 - 4.2 cm after 4 days of isolation Then, the mycelium began to spread out all the plate, which was spongy but not as high as the one on the first days

of isolation

The second group consists of samples SR5 with white mycelium similar to those

of group 1, however the colony swelled up in the middle, the mycelium was flat and grew only close to the agar surface Colony diameter reached 7 cm and produced a slight purple pigment after 6 days on PGA agar at 27 °C The opposite of the plate experienced the pink to dark purple pigment (Figure 3.2 Bl, B2)

Figure 3.2 Morphology of colonization on PGA medium (Al) and (A2): Top and bottom surface of fungi sample isolates group 1 (Bl) and (B2): Top and the bottom

surface of the fungi sample is isolated in group 2.)Based on the colony morphology as well as the mycelium color, Fusarium sp was identified as the agent causation of the root and stem rot pathogen in Ninh Thuan, Vietnam This result was similar to the results of Darmadi and Leslie, Summerell34'35

3.1.3 Microscopic characteristics of the fungus that cause root and stem rot

For the distinction of five samples isolated from asparagus root and rot samples having similar characteristics of the colony, those samples were stained by lactophenol, then the spore and mycelial characteristics of pathogenic fungi was observed under microscope (Figure 3.3) Under the microscope, macroconidia of samples in group 1 had a strong curve in sickle shape with 5-7 septum (Figure 3.3 A) Fungi samples in group 2 under a microscope had two types of spores Those macroconidia resembled the one in group 1 with a slight curve and 3-5 septum (Figure 3.3 B) Microconidia which was without septum was oval, small and not curved (Figure 3.3 C)