A functional profile of CD8+ T cell subsets among CCPs revealed a high frequency of monofunctional CD8+ T cells in the most severe patients with IFN-c+- or TNF-a+-producing cells.. 2015
Trang 1Cells in Chronic Chagasic Patients with Severe Forms of the Disease
Jose Mateus1,2, Paola Lasso1,2, Paula Pavia2, Fernando Rosas3, Nubia Roa4,
Carlos Andre´s Valencia-Herna´ndez5, John Mario Gonza´lez6, Concepcio´n J Puerta2, Adriana Cue´llar1*
1 Grupo Inmunobiologı´a y Biologı´a Celular, Pontificia Universidad Javeriana, Bogota´, Colombia, 2 Laboratorio de Parasitologı´a Molecular, Facultad de Ciencias, Pontificia Universidad Javeriana, Bogota´, Colombia, 3 Fundacio´n Clı´nica Abood Shaio, Bogota´, Colombia, 4 Facultad de Medicina, Pontificia Universidad Javeriana, Bogota´, Colombia, 5 Laboratorio de Parasitologı´a, Instituto Nacional de Salud, Bogota´, Colombia, 6 Grupo de Ciencias Ba´sicas Me´dicas, Facultad de Medicina, Universidad de los Andes, Bogota´, Colombia
Abstract
Background:CD8+ T cells have been shown to play a crucial role in Trypanosoma cruzi infection Memory CD8+ T cells can
be categorised based on their distinct differentiation stages and functional activities as follows: stem cell memory (TSCM), central memory (TCM), transitional memory (TTM), effector memory (TEM) and terminal effector (TTE) cells Currently, the immune mechanisms that control T cruzi in the chronic phase of the infection are unknown
Methodology/Principal Findings:To characterise the CD8+ T cell subsets that could be participating in the control of T cruzi infection, in this study, we compared total and T cruzi-specific circulating CD8+ T cells with distinctive phenotypic and functional features in chronic chagasic patients (CCPs) with different degrees of cardiac dysfunction We observed a decreased frequency of total TSCM along with an increased frequency of TTE in CCPs with severe disease Antigen-specific TSCM cells were not detectable in CCPs with severe forms of the disease A functional profile of CD8+ T cell subsets among CCPs revealed a high frequency of monofunctional CD8+ T cells in the most severe patients with IFN-c+- or TNF-a+-producing cells
Conclusions/Significance:These findings suggest that CD8+ TSCM cells may be associated with the immune response to T cruzi and outcome of Chagas disease, given that these cells may be involved in repopulating the T cell pool that controls infection
Citation: Mateus J, Lasso P, Pavia P, Rosas F, Roa N, et al (2015) Low Frequency of Circulating CD8+T Stem Cell Memory Cells in Chronic Chagasic Patients with Severe Forms of the Disease PLoS Negl Trop Dis 9(1): e3432 doi:10.1371/journal.pntd.0003432
Editor: Mauricio Martins Rodrigues, Federal University of Sa˜o Paulo, Brazil
Received August 11, 2014; Accepted November 21, 2014; Published January 8, 2015
Copyright: ß 2015 Mateus et al This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: The authors confirm that all data underlying the findings are fully available without restriction All relevant data are within the paper and its Supporting Information files.
Funding: This work belongs to the project ‘‘Identificacio´n de ce´lulas T stem cell memory (TSCM) CD8+ en pacientes chaga´sicos’’, funded by Pontificia Universidad Javeriana [PUJ ID PROP 4540; ID PROY 4325] The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* Email: acuellar@javeriana.edu.co
Introduction
The memory CD8+T cell compartment comprises cells that
represent distinct differentiation stages and different functional
activities This cellular compartment has been divided into stem
cell memory (TSCM), central memory (TCM), transitional memory
(TTM), effector memory (TEM) and terminal effector (TTE) cells [1]
TSCMare considered an early differentiated and long-lived human
memory T cell population with an enhanced capacity for
self-renewal and a multipotent ability to generate other subsets of
memory cells [2] As shown in a viral infection model in
non-human primates, TSCM cells also demonstrate better survival
capacity compared with conventional memory T cells, even in the
presence of little or no antigen stimulus [3] Therefore, as a
potential reservoir to maintain and to replenish the memory T cell pool, TSCM cells represent a potential tool for cellular immune therapies in chronic infectious diseases
Chagas disease (CD), caused by the intracellular parasite Trypanosoma cruzi, is a public health problem that affects nearly
8 million people in Latin America, and almost 25 million people are at risk for contracting this disease [4] In addition, cases are reported on different continents due to the migration of people from CD-endemic countries [5] Classically, the course of CD consists of consecutive acute and chronic phases The acute phase, lasting several weeks, is associated with a high parasitaemia that can be controlled but not eliminated by the immune system Indeed, parasite persistence at low levels is the hallmark of the indeterminate or asymptomatic phase, which can last a lifetime
Trang 2However, between 30–40% of infected individuals in the chronic
phase develop a symptomatic phase with heart or gastrointestinal
involvement [6]
Currently, the immune mechanisms that control T cruzi
infection and do not permit chronic phase progression are
unknown However, in mouse models of T cruzi infection, it
was shown that CD8+ T cells contribute to the control of
intracellular pathogen infection by secreting cytokines and
perforin For example, CD8+T cell knockout (KO), IFN-c KO
and perforin KO mice infected with T cruzi were unable to
control parasitemia and succumbed faster to infection than
wild-type infected mice [7,8] In humans with severe cardiac forms of
CD, it has been demonstrated that CD8+T cells decline both in
number and function, and there is a low frequency of early
differentiated cells along with a high frequency of late
differen-tiated cells compared with patients with less severe forms of the
disease [9] Additionally, patients with severe disease forms have a
lower frequency of IFN-c-producing T cells than patients with
mild forms [9,10] Indeed, a low frequency of IFN-c-producing
CD4+CD8+ T cells, reduced proliferative capacity and CD28
expression in T cells have been observed in patients with severe
forms of the disease in previous group studies [11,12] As CD8+T
cells are a heterogeneous population with distinct proliferative,
survival and functional abilities, it is important to characterise
CD8+T cell subsets in chronic chagasic patients (CCPs) to define
the types of cellular immune responses participating in the control
of T cruzi The aim of the present study was to compare
circulating CD8+T cell subsets in CCPs with different degrees of
disease severity, with particular focus on TSCMcells, which have
the capability to generate all memory subsets
Methods
Ethics statement
The Research and Ethics Committees from the Pontificia
Universidad Javeriana, Instituto Nacional de Salud, Fundacio´n
Abood Clı´nica Shaio and Hospital Universitario San Ignacio
approved this study following the national regulations and the
Declaration of Helsinki Signed informed consent was obtained from all individuals prior to their inclusion in the study
Study participants
A total of 32 cardiac CCPs from endemic areas were recruited
at the Instituto Nacional de Salud, Fundacio´n Abood Clı´nica Shaio and Hospital Universitario San Ignacio in Bogota´, Colombia Additionally, nine healthy donors (HD) from non-endemic areas were included All subjects were tested for Trypanosoma cruzi antibodies using an indirect immunofluores-cence assay (IFI) and an enzyme-linked immunosorbent assay (ELISA) CCPs were classified into groups A, B, C or D according
to their disease severity score as previously described [13] Group
A included individuals with a normal electrocardiogram (ECG), heart size and left ventricular ejection fraction (LVEF) and a New York Heart Association (NYHA) class I designation Group B individuals had an abnormal ECG but normal heart size and LVEF and a NYHA class I designation Group C individuals had
an abnormal ECG, increased heart size, reduced LVEF and a NYHA class II or III designation Finally, group D individuals had
an abnormal ECG, increased heart size, reduced LVEF and were NYHA class IV Patients from groups A and B correspond to patients with mild forms of disease severity, and those from groups
C and D are patients with severe forms Clinical characteristics and the classification of study participants are reported in Table 1
Blood samples
Blood samples were obtained from all study participants in EDTA and heparinised tubes (BD Vacutainer; Franklin Lakes; NJ, USA) The absolute number of lymphocytes was determined from the EDTA tube by a standard differential blood count Peripheral blood mononuclear cells (PBMCs) were isolated with a Ficoll-Hypaque density gradient (GE Healthcare; Uppsala, Sweden) from the heparinised tubes Non-frozen cells were used in phenotypic and functional activity analyses
Antibodies
The following conjugated antibodies were used for cell-surface staining: CD3-Pacific Blue (BD Pharmingen; Clone UCHT1; Cat
No 558117; San Diego, CA, USA), CD8-APC H7 (BD gen; Clone SK1; Cat No 641400), CD45RA-PE (BD Pharmin-gen; Clone HI100; Cat No 555489), CCR7-PE-Cy7 (BD Pharmingen; Clone 3D12; Cat No 557648), CD28-PerCP-Cy5.5 (BD Biosciences; Clone L293; Cat No 337181; San Jose,
CA, USA), CD27-Alexa Fluor 700 (BD Pharmingen; Clone M-T271; Cat No 560611), CD95-APC (BD Pharmingen; Clone DX2; Cat No 558814) and CD127-FITC (BD Pharmingen; Clone HIL-7R-M21; Cat No 560549) Conjugated antibodies for intracellular staining included the following: IFN-c-FITC (BD Pharmingen; Clone 4S.B3; Cat No 554551), IL-2-PerCP-Cy5.5 (BD Pharmingen; Clone MQ1-17H12; Cat No 560708) and TNF-a-AlexaFluor 700 (BD Pharmingen; Clone MAb11; Cat
No 557996) To exclude dead cells, the Fixable Aqua Dead Cell Stain viability marker was used (Invitrogen; Cat No L34957; Eugene, OR, USA)
Cell-surface phenotypic and intracellular cytokine staining using flow cytometry
All conjugated antibodies were titrated, and each multicolour panel of conjugates was evaluated as previously described [14] To evaluate the frequency of CD8+T cell subsets, one million PBMCs were stained with the viability marker for 20 min in the dark at room temperature and then washed with PBS 0.001 M pH 7.4
Author Summary
Chagas disease is caused by the intracellular parasite
Trypanosoma cruzi After the onset of acute infection, all
individuals enter the chronic phase and approximately
70% of them never have symptoms However, nearly 30%
of infected individuals develop symptoms, mainly of heart
disease, even decades after the initial infection Currently,
it is unclear how the immune response controls infection
and prevents the development of heart disease in some
infected people We have characterised the memory CD8+
T cell subsets in chronic chagasic patients, including a
newly described population of cells called memory stem
cells This T cell subset seems important for replenishing
the other T cell populations The findings in this
manuscript show that chronic chagasic patients with
severe disease have the following: a) a low frequency of
memory stem cells, b) no antigen-specific memory stem
cells, and c) CD8+ T cells with less effector function
compared with asymptomatic patients These results
indicate that the lack of T cell population renewal and
the decrease in cells with multiple effector functions may
be associated with the clinical outcome of chronic Chagas
disease
Trang 3(1X PBS) (Eurobio; Les Ulis, France) Cells were stained with
antibodies against CD3, CD8, CD45RA, CCR7, CD28, CD27,
CD127 and CD95 molecules for 30 min in the dark at 4uC and
washed with 1X PBS To evaluate the cytokine production of
CD8+T cell subsets, one million PBMCs were cultured with
anti-CD28 and anti-CD49d antibodies and incubated for 6 hours in
the presence of brefeldin A (BD Biosciences, San Jose, CA, USA)
with Staphylococcal enterotoxin B (SEB) (Sigma-Aldrich; Saint
Louis, MO, USA), Trypanosoma cruzi trypomastigote lysate or
medium Parasite lysate was obtained as previously described [14]
First, cells were stained with the viability marker and then with
surface antibodies against CD3, CD8, CD45RA, CCR7 and
CD95 molecules for 30 min in the dark at 4uC Cells were washed
with 1X PBS, fixed and permeabilised with Cytofix/Cytoperm
(BD Biosciences) for staining with antibodies against IFN-c,
TNF-aand IL-2 for 30 min in the dark at 4uC, followed by washing with
1X Perm/Wash (BD Biosciences) At least 50,000 events gated on
CD3+CD8+cells were acquired on a FACS Aria II flow cytometer
Analysis was performed using FlowJo 9.3.2 (Tree Star; Ashland,
OR, USA), Pestle 1.7 (National Institutes of Health (NIH),
Bethesda, MD, USA) and SPICE 5.3 (NIH) software [15] Dead
and doublet cells were excluded from the analysis, as previously
described [14] A positive cytokine response was defined by
subtracting the cytokine background (cells cultured with medium)
from a frequency of 0.05% for each CD8+T cell subset (average
frequency of the response of CD8+T cells from HDs cultured with
parasite lysate plus 3 SD)
PCR for parasite detection
Conventional PCR (cPCR) and quantitative PCR (qPCR) were
used to assess parasite DNA in blood samples in guanidine
hydrochloride-EDTA stored at 4uC from 30 CCPs DNA from
blood was extracted using a High Pure PCR template preparation
kit (Roche, Mannheim, Germany) Afterwards, cPCR was run
using initiators of b-globin FR, as described previously [16], to
check DNA integrity and to rule out the presence of inhibitors in
the sample cPCR was performed with the S35
(AAATAATG-TACGGG(T/G)GAGATGCATGA) and the S36
(GGGT-TCGATTGGGGTTGGTGT) primers, which amplify the kDNA
variable mini-circle region from T cruzi, using PCR reaction
conditions described previously [17,18] qPCR was performed
with Cruzi 1 (ASTCGGCTGATCGTTTTCGA) and Cruzi 2 (AATTCCTCCAAGCAGCGGATA) primers and the Cruzi 3 (6FAM-CACACACTGGACACCAA-BBQ) probe, which amplify
a 166-bp segment of the satellite DNA fromT cruzi [19] Each sample was run in duplicate, and the parasite load was estimated based on a standard curve The curve was constructed with different concentrations of genomic DNA mixed with blood from one uninfected donor ranging from 105–100 parasite equivalents per mL Samples were run using a LightCycler 1.5 Instrument (Roche) For both PCR methods, different controls were included: reaction (water added in the room containing the reaction mixture), grey (water added in the room where the sample was added to the reaction), negative (genomic DNA from an HD) and positive (genomic DNA ofT cruzi)
Statistical analysis
A statistical analysis was performed using the Mann-Whitney test or a one-way ANOVA non-parametric Kruskal–Wallis test with Dunn’s test for multiple comparisons Correlations between the frequencies and the absolute numbers of CD8+T cell subsets were analysed using Spearman’s rank correlation coefficient A Wilcoxon signed-rank test was performed to compare stimulated cells with 2 functions or 1 function All tests were two-tailed, and statistical significance was achieved withp,0.05 GraphPad Prism 6.0 for Mac OS X (San Diego, CA, USA) software was used for statistical analyses
Results Distribution of total CD8+T cell subsets from CCPs
T cells are a highly heterogeneous cell compartment comprising different phenotypes, functional activities, gene expression and survival capacities Recently, CD45RA (or CD45R0), CCR7, CD28 and CD95 were proposed as canonical markers to identify
T cell subsets using multiparametric flow cytometry [1] In addition, CD127 and CD27 were included to accurately define T stem cell memory (TSCM) cells as described previously [2] To compare the frequencies of total CD8+T cell subsets among CCPs with different degrees of disease severity and HDs, PBMCs isolated from 32 CCPs and 9 HDs were labelled with a panel of conjugated antibodies as described in the Materials and Methods
Table 1 Characteristics of study participants
-Age (years), median (range) 43 (26–64)### 50 (38–67)# 70 (55–80) 65 (45–76) - 0.0005++
LVEF, median (range) 60 (50–65) 60 (48–65) 30 (15–50)* 20 (10–35)** - 0.0001 ++
CCPs, chronic chagasic patients; HDs, healthy donors; LVEF, left ventricular ejection fraction.
#
Clinical characteristics of CCPs are described in Materials and Methods.
+
Mann-Whitney test, CCP svs HDs.
++ One-way ANOVA non-parametric Kruskal–Wallis test with Dunn’s test.
*p,0.05 (A vs C, B vs C),
**p,0.001 (A vs D, B vs D).
###
p,0.0001 (A vs C),
#
p,0.05 (B vs C).
doi:10.1371/journal.pntd.0003432.t001
Trang 4Representative contour plots depicting the ex vivo selection of
CD8+T cell subsets based on differential expression of CD45RA,
CCR7, CD28, CD27, CD95 and CD127 are shown in Fig 1A
On the basis of previous data, CD8+T cell subsets were defined as
TSCMcells (CD45RA+CCR7+CD28+CD27+CD95+CD127+),
cen-tral memory (TCM) cells (CD45RA2CCR7+CD28+CD27+CD
95+CD127+), transitional memory (TTM) cells (CD45
RA2CCR72CD28+CD27+CD95+CD127+), effector memory
(TEM) cells (CD45RA2CCR72CD282CD27+CD95+CD1272)
and terminal effector (TTE) cells (CD45RA+CCR72CD
282CD272CD95+CD1272) [1] The frequencies of CD8+T cell
subsets were similar for group A and B patients and for HDs A
significant difference was observed when the frequencies of TSCM
and TTEcells were compared between CCPs with severe and mild
forms of the disease (Fig 1B) No significant differences were
observed for TCM, TTMand TEMfrequencies between CCPs and
HDs Given that we found significant differences in the frequencies
of TSCM and TTE cells from CCPs, we evaluated whether the
reduced frequency of TSCMcells was associated with changes in
the frequency of TTE cells Indeed, in CCPs, the frequency of
TSCMcells correlated negatively with the frequency of TTEcells
(Spearman r = 20.7204, p,0.0001) (Fig 1C) In addition, we
found a negative trend in the frequency of TSCM cells and a
positive trend in the frequency of TEMand TTEcells in CCPs with
various degrees of disease severity (S1 Fig.), as has been shown in
previous reports [9] As variations in the numbers of CD8+T cells
could consequently affect the absolute values of the studied subsets,
absolute cell numbers were compared The absolute numbers for
CD8+T cell subsets demonstrated a trend similar to that for the
frequencies of CD8+T cell subsets observed in CCPs and HDs A
correlation analysis of the absolute numbers of TSCMand TTEcells
from all CCPs showed that TSCMcells also correlated negatively
with TTEcells from CCPs (Spearman r = 20.4240,p = 0.0156, S2
Fig.)
Distribution of T cruzi-specific CD8+T cell subsets from
CCPs
We next compared the frequencies ofT cruzi-specific CD8+T
cells bearing different T cell phenotypes in CCPs with various
degrees of disease severity To evaluate the frequency of
antigen-specific CD8+T cell subsets, PBMCs from CCPs were stimulated
with parasite lysate and labelled with a panel of conjugated
antibodies to assess the cytokine production of CD8+ T cell
subsets Assessment of antigen-specific CD8+T cells was carried
out for cytokine production in response to parasite lysate as
described in the Materials and Methods Representative density
plots for the selection ofT cruzi-specific CD8+T cells producing
IFN-c, TNF-aand IL-2 are shown in Fig 2A An increased
frequency of antigen-specific TEMcells was observed in all CCPs
(Fig 2B) CCPs with severe disease demonstrated a low frequency
of antigen-specific TCM cells and a high frequency of
antigen-specific TTE cells compared with patients with mild disease
Interestingly, we did not detect antigen-specific CD8+TSCMcells
in patients from group D, who had the most severe form of the
disease (Fig 2C)
Functional activity profiles of T cruzi-specific CD8+T cell
subsets from CCPs
Using the panel described above, we assessed the functional
profiles ofT cruzi-specific CD8+T cell subsets in CCPs and HDs
in cultures with medium, SEB and parasite lysate When
comparing the frequencies of TSCM, TCM, TEM and TTE cells
from CCPs with one or two functions in lysate-stimulated cells, we
observed a high frequency of CD8+ T cell subsets with one function compared with cells with two functions (p = 0.0210,
p = 0.0008, p = 0.0353 and p = 0.0006, respectively) However, among SEB-stimulated cells, there was a higher frequency of CD8+ T cell subsets with two functions than of cells with one function in all CCPs (S3 Fig.) As expected, in SEB-stimulated cells, we observed TSCM, TCM, TEM and TTE cells with three functions from CCPs in all groups, similar to those observed in HDs In contrast, we observed an absence of cells with three functions among lysate-stimulated TSCM, TEM and TTE cells; however, patients from groups A and B had TCMcells with three functions, which was not observed in patients from groups C and
D In lysate-stimulated cells in group D patients, there were no
TSCMcells with one, two or three functions among SEB-stimulated cells from both CCPs and HDs (Fig 3) These findings were also observed in the proportion of cells because the patients from group
D are composed of cells producing a single cytokine (Fig 4) The most prevalent population in lysate-stimulated cells with two functions consisted of IFN-c+TNF-a+-producing cells in CCPs with mild forms of the disease, and monofunctional cells were predominantly IFN-c+or TNF-a+in patients from group D Of note, IL-2-producing cells were not detected in any CCPs (Fig 5)
To further investigate the associations between CD8+ T cell subsets and parasitaemia in CCPs, cPCR and qPCR were performed to assess the presence of parasites in peripheral blood
as described in the Materials and Methods Both PCR methods permitted the identification of 12 out of 30 (40%) CCPs with detectable parasitaemia (7 by cPCR and 9 by qPCR) (Table 2) Notably, we detected parasitaemia in 3 of 9 patients from group C;
in contrast, in patients from groups A, B and D, the parasitaemia load was below the detection limit of qPCR Due to the low numbers of individuals, there were no associations between CD8+
T cell subsets and parasitaemia; however, this finding demon-strated the presence of circulating parasites in all CCP groups, even those with the most severe forms of disease
Discussion
Immunity aimed at antigen clearance or the control of disease progression has been shown to be directly related to the quality of the memory T cell response [20] However, the study of memory
T cells depends on technical approaches to describe the complex T cell compartment In viral chronic infections, CD8+T cell subsets have been extensively studied, but they have rarely been studied in infections caused by intracellular protozoans such asT cruzi In this study, we compared the total and antigen-specific circulating CD8+T cell subsets among CCPs demonstrating different degrees
of disease severity Changes in the distribution of CD8+ T cell subsets could highlight the behaviour of cellular immunity during the natural history of infection and the pathogenesis of CD
We observed a decreased frequency in total TSCM cells along with an increased frequency of TTE cells in CCPs with severe forms of disease Interestingly, IFN-c-, TNF-a- and IL-2-producing antigen-specific TSCM cells were not detectable in CCPs with severe forms of the disease These changes observed for the TSCMand TTEsubsets indicated a negative correlation both in the frequency and the absolute numbers of CD8+T cells in all CCPs analysed Conversely, when we studied the functional profiles of CD8+T cell subsets among CCPs, a higher frequency of monofunctional antigen-specific CD8+ T cells was observed in CCPs with severe forms of disease However, in SEB-stimulated cells, we observed cells with three functions among CD8+T cell subsets from CCPs with all degrees of disease severity, similar to that observed in HDs (Fig 6)
Trang 5The T cell compartment is composed of different memory cells
subsets, which are generated in response to antigen recognition
The recently identified TSCMcells are characterised by their high
proliferative and self-renewing capacities and their ability to
differentiate into TCM and TEM cells [2] In this study, we
described the absence of antigen-specific TSCMcells in CCPs with
severe disease Although TSCM cells have not previously been described in CCPs, our findings are consistent with previous reports showing that the frequency of early differentiated CD8+T cells decreases as the disease becomes more severe and the proportion of fully differentiated memory CD8+T cells increases [9,21] Additionally, in a mouse model, it was observed that
Fig 1 Distribution of total CD8+T cell subsets from CCPs and HDs (A) Representative contour plot of the ex vivo selection of CD8+T cell subsets based on the differential expression of CD45RA, CCR7, CD28, CD27, CD95 and CD127 (B) Frequency of CD8+T SCM , T CM , T TM , T EM and T TE cells from CCPs with different degrees of disease severity and HDs Box and whiskers indicate the median frequency and range of the total CD8+T cell subsets (25–75 percentile) The p values were calculated using a one-way ANOVA non-parametric Kruskal–Wallis test (*p,0.05, **p,0.01, ***p, 0.001) (C) The correlations between the frequencies of CD8+T SCM cells and CD8+T TE cells from CCPs were calculated with Spearman’s rank correlation coefficient CCPs were grouped according to the disease severity as described in Materials and Methods (A = 10, B = 8, C = 9 and D = 5) Additionally, nine HDs were included.
doi:10.1371/journal.pntd.0003432.g001
Trang 6antigen-specific CD8+T cells maintain a TEMphenotype during
persistentT cruzi infection [22]
Recently, TSCM cells have been associated with an improved
prognosis in chronic HIV-infected patients because the frequency of
CD8+ TSCM cells decreased in all individuals with chronic HIV
infection, but the frequency of these cells was restored in treated
HIV-infected patients Interestingly, these findings are in accordance with our results demonstrating that the frequency of CD8+ TSCM cells decreased in CCPs with severe forms of disease [23] In addition, TSCM
cells appeared to be progenitors for TTE cells as these two compartments were inversely correlated Taking into account that disease progression may last several years, it is difficult to know if this
Fig 2 Distribution ofT cruzi-specific CD8+T cell subsets from CCPs (A) Representative density plot of the selection of T cruzi-specific CD8+
T cells producing IFN-c, TNF-a or IL-2 following cultivation with parasite lysate A positive cytokine response was defined as described in Materials and Methods (B) The proportions of T cruzi-specific CD8+T SCM , T CM , T EM and T TE cells were expressed as percentages of total cytokine-producing CD8+T cells The p values were calculated using a one-way ANOVA non-parametric Kruskal–Wallis test (**p,0.01, ****p,0.0001) (C) Frequencies of antigen-specific CD8+T SCM , T CM , T EM and T TE cells among CCPs with differing degrees of disease severity The p values were calculated using the Mann-Whitney test (***p,0.001) Box and whiskers indicate the median frequency and range of the T cruzi-specific CD8+T cell subsets (25–75 percentile) CCPs were grouped according to their disease severity as described in Materials and Methods (A = 8, B = 6, C = 6 and D = 4).
doi:10.1371/journal.pntd.0003432.g002
Trang 7progress is due to the loss of TSCMcells or if the loss of this subset is the
result of a more severe infection However, due to their capacities to
generate all memory and effector T cell subsets, we hypothesized that
the absence or a very low frequency ofT cruzi-specific TSCMcells may
be a contributing factor to failure to control the parasite during the
symptomatic phase of the disease in T cruzi chronic infection In
Listeria monocytogenes-infected mice, the adoptive transfer of cells
expressing high amounts of IL-7R a-chain (CD127) helped to control
infection due to the expansion of effector cell populations responsible
for the rapid clearance of bacteria from the spleen and liver [24] It is
noteworthy that TSCMcells express high levels of CD127 and other
molecules associated with early differentiation [2] The adoptive
transfer of TSCMcells in murine tumour models was shown to mediate
potent tumour regression even better than TCMand TEMcells, and
thus it has been proposed that these cells may be used for adoptive
immunotherapy [2,25] However, TSCMcell adoptive transfer has not
been studied in chronic infections; thus, it would be interesting to
evaluate the role of this cell population in the outcome of chronic
infection
In the present study, we included healthy donors from non-endemic
areas as uninfected controls However, it may be a different scenario
when compared with healthy individuals exposed toT cruzi in areas of
endemic Chagas disease, who can haveT cruzi-specific T cells capable
of producing IFN-c even with negative conventional antibody testing
forT cruzi [26] It is possible that repetitive exposure to T cruzi in endemic areas may provide a persistent source of antigens that affect the proportion or function of CD8+memory T cell subsets in healthy individuals, or some of the immune responses elicited byT cruzi antigens in vitro may be induced by other protozoan parasites circulating in endemic areas [27,28]
The polyfunctionality of CD8+T cells has been proposed to be an immune correlate of protection in viral chronic infections [20] Non-progressor patients chronically infected with human immunodeficiency virus (HIV) demonstrated a high frequency of polyfunctional CD8+T cells compared with progressor patients [29] Antigenic persistence in chronic infections is implicated in the impaired cellular immune response due to excessive activation of the immune system [30] In the peripheral blood of CCPs, a high frequency of TTEcells in patients with severe disease and a low frequency or absence of antigen-specific cells with one, two or three functions as assessed by cytokine production were observed This phenomenon could be attributable to the high frequency of cells with a late differentiated stage, as these cells have decreased polyfunctional capacities Indeed, we observed a significant decrease in the frequency of polyfunctional CD8+T cells in patients with severe disease and an increase in inhibitory receptors on CD8+T cells from CCPs (Lasso, P, et al, manuscript in preparation) However,
it has been shown inT cruzi-infected mice that perforin-producing cells may contribute to cardiomyocyte lesions and heart dysfunction
Fig 3 Functional activity profiles ofT cruzi-specific CD8+T cell subsets from CCPs with different degrees of disease severity (A) Frequencies of CD8+T SCM , T CM , T EM and T TE cells with one, two and three functions among CD8+T cells stimulated with Staphylococcal enterotoxin B (SEB) (B) Frequencies of CD8+T SCM , T CM , T EM and T TE cells with one, two and three functions among CD8+T cells stimulated with parasite lysate Box and whiskers indicate the median frequency and range of the CD8+T cell subsets (25–75 percentile) CCPs were grouped according to their disease severity as described in Materials and Methods (A = 8, B = 6, C = 6 and D = 4) Additionally, nine HDs were included.
doi:10.1371/journal.pntd.0003432.g003
Trang 8during chronic T cruzi infection [31] We observed an increased
frequency of TTEcells and a higher frequency of perforin-producing
cells in CCPs with severe forms of the disease (Lasso, P, et al,
manuscript in preparation) Because TTEcells have a greater cytotoxic
capacity than early differentiated cells, we suggest that a high frequency
of TTEcells may be associated with the heart damage observed in CCPs due to a high frequency of perforin-producing cells observed in these patients
Fig 4 Proportions of functional activity profiles forT cruzi-specific CD8+T cell subsets from CCPs Functional profiles of CD8+T cell subsets stimulated with Staphylococcal enterotoxin B (SEB) and parasite lysate are color-coded according to the number of functions and summarised in the pie charts Each pie slice corresponds to the mean production of one (dark grey), two (light grey) and three (red) functions The white pie corresponds to the absence of a response when IFN-c, TNF-a and IL-2 production were observed CCPs were grouped according to their disease severity as described in Materials and Methods (A = 8, B = 6, C = 6 and D = 4).
doi:10.1371/journal.pntd.0003432.g004
Fig 5 Cytokine combinations produced byT cruzi-specific CD8+T cells from CCPs Frequencies of CD8+T cells with one and two functions among CD8+T cells stimulated with parasite lysate Box and whiskers indicate the median frequency and range of the T cruzi-specific CD8+T cell subsets (25–75 percentile) CCPs were grouped according to their disease severity as described in Materials and Methods (A = 8, B = 6, C = 6 and D = 4) doi:10.1371/journal.pntd.0003432.g005
Trang 9Based on functional CD8+T cell responses, it was previously
reported thatT cruzi-specific CD8+T cells from chronicT
cruzi-infected individuals display a functional profile with T cells
secreting IFN-c alone as the predominant pattern and a very low
prevalence of single IL-2-secreting cells [32] However, inT
cruzi-infected mice, parasite persistence has been associated with the
phenotype of CD8+T cells because the absence of antigenic load is correlated with an increased frequency of early differentiated cells [33] The findings of the present study with parasite persistence in CCPs could be associated with the changes observed both in the frequencies and functional activities of CD8+T cell subsets, as has been described for other chronic infections [34,35]
In chronicT cruzi infection, the parasitaemia load is low [36]
In our study, parasite DNA was detectable in peripheral blood in 40% of patients This result is similar to findings in other studies that identified parasitaemia in CCPs, where detection by PCR is between 40–50% of confirmed positive samples [37,38] However,
in positive blood donors detected by other tests for T cruzi infection, it has been reported that PCR is positive in only 13% [39] In addition, a lack of association between blood-based detection of parasite DNA and cardiac damage has been reported [40] We find parasite DNA even in the most severe forms of disease but the lack of association is most likely due to low parasitism in blood and tissue, the anatomical location of parasites
in CCPs and parasite variability [40]
In summary, IFN-c-, TNF-a- and IL-2-producingT cruzi-specific CD8+TSCMcells and polyfunctionality were not detectable in CCPs with severe forms of disease In the context of chronic T cruzi infection, we hypothesized that CCPs with mild disease would be able
to control infection and prevent the progression of the disease via
TSCMcells and polyfunctional cells at early differentiation stages For unknown reasons, some infected individuals lost the ability to regenerate antigen-specific CD8+ TSCM cells to create enough polyfunctional cells to control the infection Memory cells can differentiate into TTEcells with only one function and probably with high expression of inhibitory receptors Overall, these findings related
to changes in the distribution of CD8+T cell subsets, functional activity of CD8+T cells and parasite persistence in CCPs may be associated with the immune response to and outcome of CD However, it is still important to evaluate the role of CD8+TSCMcells
in parasite control of the infection
Supporting Information S1 Fig Trend analysis of total CD8+T cell subsets from CCPs Frequency of CD8+TSCM, TCM, TTM, TEMand TTEcells from CCPs with different degrees of disease severity Thep values were calculated using a simple linear regression CCPs were grouped according to the disease severity as described in Materials and Methods (A = 10, B = 8, C = 9 and D = 5)
(TIFF)
S2 Fig Correlation analysis of absolute numbers of TSCM
and TTE cells from CCPs Correlations between the absolute numbers of CD8+TSCMcells and CD8+TTEcells from CCPs were
Table 2 CCPs with parasitaemia detectable by cPCR and qPCR
CCPs, chronic chagasic patients.
1
The amplified PCR regions are described in Materials and Methods.
#
Clinical characteristics of CCPs are described in Materials and Methods.
+ Only three of nine patients from group C had quantifiable parasite load in terms of parasite equivalents per mL; median (range): 3 (1–6).
doi:10.1371/journal.pntd.0003432.t002
Fig 6 Proportions of total and T cruzi-specific CD8+ T cell
subsets from CCPs Representation of the proportions of CD8+T SCM ,
T CM , T TM +T EM and T TE cells from CCPs with different degrees of disease
severity The black bars represent the functional activities evaluated for
parasite lysate-stimulated cells from CCPs for antigen-specific CD8+T
cell subsets.
doi:10.1371/journal.pntd.0003432.g006
Trang 10calculated with Spearman’s rank correlation coefficient CCPs were
grouped according to the disease severity as described in Materials
and Methods (A = 10, B = 8, C = 9 and D = 5)
(TIFF)
S3 Fig Functional activity profiles ofT cruzi-specific CD8+
T cell subsets from CCPs (A) Frequencies of CD8+TSCM, TCM,
TEMand TTEcells with one, two and three functions among CD8+T
cells stimulated with Staphylococcal enterotoxin B (SEB) (B)
Frequencies of CD8+TSCM, TCM, TEMand TTEcells with one, two
and three functions among CD8+T cells stimulated with parasite
lysate Box and whiskers indicate the median frequency and range of
the CD8+ T cell subsets (25–75 percentile) The p values were
calculated using a Wilcoxon signed-rank test (*p,0.05, **p,0.01,
***p,0.001, ****p,0.0001)
(TIFF)
Acknowledgments
We are grateful to the Programa de Jo´venes Investigadores e Innovadores
by the Departamento Administrativo de Ciencia, Tecnologı´a e Innovacio´n, Colciencias, Bogota´, Colombia We thank Zulma Cucunuba´ of the Instituto Nacional de Salud for his participation in the recruitment and medical examination of CCPs.
Author Contributions Conceived and designed the experiments: JM PL JMG CJP AC Performed the experiments: JM PL PP Analyzed the data: JM PL JMG CJP AC Contributed reagents/materials/analysis tools: CJP AC Wrote the paper:
JM PL JMG CJP AC Diagnosis of patients: FR NR CAVH Obtained informed consent from patients: JM PL FR NR CAVH Sample collections: JM PL FR NR CAVH.
References
1 Mahnke YD, Brodie TM, Sallusto F, Roederer M, Lugli E (2013) The who’s
who of T-cell differentiation: Human memory T-cell subsets Eur J Immunol 43:
2797–2809.
2 Gattinoni L, Lugli E, Ji Y, Pos Z, Paulos CM, et al (2011) A human memory T
cell subset with stem cell-like properties Nat Med 17: 1290–1297.
3 Lugli E, Dominguez MH, Gattinoni L, Chattopadhyay PK, Bolton DL, et al.
(2013) Superior T memory stem cell persistence supports long-lived T cell
memory J Clin Invest 123: 594–599.
4 WHO (2012) Chagas disease (American trypanosomiasis) - fact sheet (revised in
August 2012) 519–522 p.
5 Perez-Molina JA, Norman F, Lopez-Velez R (2012) Chagas disease in
non-endemic countries: epidemiology, clinical presentation and treatment Curr
Infect Dis Rep 14: 263–274.
6 Rassi AJ, Rassi A, Marin-Neto JA (2010) Chagas disease Lancet 375: 1388–1402.
7 Rottenberg ME, Bakhiet M, Olsson T, Kristensson K, Mak T, et al (1993)
Differential susceptibilities of mice genomically deleted of CD4 + and CD8 + to
infections with Trypanosoma cruzi or Trypanosoma brucei Infect Immun 61:
5129–5133.
8 Tzelepis F, de Alencar BC, Penido ML, Gazzinelli RT, Persechini PM, et al.
(2006) Distinct kinetics of effector CD8+cytotoxic T cells after infection with
Trypanosoma cruzi in naive or vaccinated mice Infect Immun 74: 2477–2481.
9 Albareda MC, Laucella SA, Alvarez MG, Armenti AH, Bertochi G, et al (2006)
Trypanosoma cruzi modulates the profile of memory CD8+T cells in chronic
Chagas’ disease patients Int Immunol 18: 465–471.
10 Laucella SA, Postan M, Martin D, Hubby Fralish B, Albareda MC, et al (2004)
Frequency of interferon-gamma-producing T cells specific for Trypanosoma
cruzi inversely correlates with disease severity in chronic human Chagas disease.
J Infect Dis 189: 909–918.
11 Giraldo NA, Bolanos NI, Cuellar A, Guzman F, Uribe AM, et al (2011)
Increased CD4+/CD8+ double-positive T cells in chronic Chagasic patients.
PLoS Negl Trop Dis 5: e1294.
12 Giraldo NA, Bolanos NI, Cuellar A, Roa N, Cucunuba Z, et al (2013) T
lymphocytes from chagasic patients are activated but lack proliferative capacity
and down-regulate CD28 and CD3zeta PLoS Negl Trop Dis 7: e2038.
13 Bern C, Montgomery SP, Herwaldt BL, Rassi AJ, Marin-Neto JA, et al (2007)
Evaluation and treatment of chagas disease in the United States: a systematic
review JAMA 298: 2171–2181.
14 Mateus J, Lasso P, Gonzalez JM, Puerta CJ, Cue´llar A (2013) [Design of a
multicolor panel to assess intracellular and surface molecules by flow cytometry].
Biome´dica 33: 660–672.
15 Roederer M, Nozzi JL, Nason MC (2011) SPICE: exploration and analysis of
post-cytometric complex multivariate datasets Cytometry A 79: 167–174.
16 Virreira M, Torrico F, Truyens C, Alonso-Vega C, Solano M, et al (2005)
[Comparison of PCR methods for the diagnosis of congenital Trypanosoma cruzi
infection] Rev Soc Bras Med Trop 38: 65–67.
17 Barrera YK, Guevara JM, Pavia PX, Montilla M, Nicholls RS, et al (2008)
[Evaluation of TcH2AF-R and S35-S36 primers in PCR tests for the detection
of Trypanosoma cruzi in mouse cardiac tissue] Biomedica 28: 616–626.
18 Sturm NR, Degrave W, Morel C, Simpson L (1989) Sensitive detection and
schizodeme classification of Trypanosoma cruzi cells by amplification of
kinetoplast minicircle DNA sequences: use in diagnosis of Chagas’ disease.
Mol Biochem Parasitol 33: 205–214.
19 Piron M, Fisa R, Casamitjana N, Lopez-Chejade P, Puig L, et al (2007)
Development of a real-time PCR assay for Trypanosoma cruzi detection in blood
samples Acta Trop 103: 195–200.
20 Seder RA, Darrah PA, Roederer M (2008) T-cell quality in memory and
protection: implications for vaccine design Nat Rev Immunol 8: 247–258.
21 Fiuza JA, Fujiwara RT, Gomes JA, Rocha MO, Chaves AT, et al (2009) Profile
of central and effector memory T cells in the progression of chronic human
chagas disease PLoS Negl Trop Dis 3: e512.
22 Martin DL, Tarleton RL (2005) Antigen-specific T cells maintain an effector memory phenotype during persistent Trypanosoma cruzi infection J Immunol 174: 1594–1601.
23 Ribeiro SP, Milush JM, Cunha-Neto E, Kallas EG, Kalil J, et al (2014) The CD8+memory stem T cell (T SCM ) subset is associated with improved prognosis
in chronic HIV-1 infection J Virol 88: 13836–13844.
24 Kaech SM, Tan JT, Wherry EJ, Konieczny BT, Surh CD, et al (2003) Selective expression of the interleukin 7 receptor identifies effector CD8+T cells that give rise to long-lived memory cells Nat Immunol 4: 1191–1198.
25 Gattinoni L, Restifo NP (2013) Moving T memory stem cells to the clinic Blood 121: 567–568.
26 Olivera GC, Albareda MC, Alvarez MG, De Rissio AM, Fichera LE, et al (2010) Trypanosoma cruzi-specific immune responses in subjects from endemic areas of Chagas disease of Argentina Microbes Infect 12: 359–363.
27 Carvalho EM, Reed SG, Johnson WD, Jr (1987) Cross reactivity between Trypanosoma cruzi and Leishmania antigens in the lymphocyte blastogenesis assay Trans R Soc Trop Med Hyg 81: 82–84.
28 Chiller TM, Samudio MA, Zoulek G (1990) IgG antibody reactivity with Trypanosoma cruzi and Leishmania antigens in sera of patients with Chagas’ disease and leishmaniasis Am J Trop Med Hyg 43: 650–656.
29 Betts MR, Nason MC, West SM, De Rosa SC, Migueles SA, et al (2006) HIV nonprogressors preferentially maintain highly functional HIV-specific CD8+T cells Blood 107: 4781–4789.
30 Wherry EJ (2011) T cell exhaustion Nat Immunol 12: 492–499.
31 Silverio JC, Pereira IR, Cipitelli Mda C, Vinagre NF, Rodrigues MM, et al (2012) CD8 + T-cells expressing interferon gamma or perforin play antagonistic roles in heart injury in experimental Trypanosoma cruzi-elicited cardiomyopa-thy PLoS Pathog 8: e1002645.
32 Alvarez MG, Postan M, Weatherly DB, Albareda MC, Sidney J, et al (2008) HLA Class I-T cell epitopes from trans-sialidase proteins reveal functionally distinct subsets of CD8+T cells in chronic Chagas disease PLoS Negl Trop Dis 2: e288.
33 Bustamante JM, Bixby LM, Tarleton RL (2008) Drug-induced cure drives conversion to a stable and protective CD8+ T central memory response in chronic Chagas disease Nat Med 14: 542–550.
34 Bengsch B, Seigel B, Ruhl M, Timm J, Kuntz M, et al (2010) Coexpression of PD-1, 2B4, CD160 and KLRG1 on exhausted HCV-specific CD8+T cells is linked to antigen recognition and T cell differentiation PLoS Pathog 6: e1000947.
35 Day CL, Kaufmann DE, Kiepiela P, Brown JA, Moodley ES, et al (2006) PD-1 expression on HIV-specific T cells is associated with T-cell exhaustion and disease progression Nature 443: 350–354.
36 Britto CC (2009) Usefulness of PCR-based assays to assess drug efficacy in Chagas disease chemotherapy: value and limitations Mem Inst Oswaldo Cruz 104: 122–135.
37 Duarte LF, Florez O, Rincon G, Gonzalez CI (2014) Comparison of seven diagnostic tests to detect Trypanosoma cruzi infection in patients in chronic phase of Chagas disease Colomb Med (Cali) 45: 61–66.
38 Gil J, Pavia P, Montilla M, Florez AC, Quintero C, et al (2007) [Comparison of
a PCR test based on the histone H2A/SIRE genes with classical serological tests for the diagnosis of chronic Chagas disease in Colombian patients] Biomedica 27: 83–91.
39 Castro E (2009) Chagas’ disease: lessons from routine donation testing Transfus Med 19: 16–23.
40 Norman FF, Perez-Ayala A, Perez-Molina JA, Flores-Chavez M, Canavate C, et
al (2011) Lack of association between blood-based detection of Trypanosoma cruzi DNA and cardiac involvement in a non-endemic area Ann Trop Med Parasitol 105: 425–430.