hcv genomic rna activates the nlrp3 inflammasome in human myeloid cells

Human Myeloid CellsWei Chen1., Yongfen Xu1., Hua Li1, Wanyin Tao1, Yu Xiang1, Bing Huang1, Junqi Niu2, Jin Zhong1*, 1 Key Laboratory of Molecular Virology & Immunology, Institut Pasteur

Human Myeloid Cells

Wei Chen1., Yongfen Xu1., Hua Li1, Wanyin Tao1, Yu Xiang1, Bing Huang1, Junqi Niu2, Jin Zhong1*,

1 Key Laboratory of Molecular Virology & Immunology, Institut Pasteur of Shanghai, Chinese Academy of Sciences, Shanghai, China, 2 Department of Hepatology, The First Hospital of Jilin University, Changchun, China

Abstract

Background: Elevated plasma levels of IL-1b and IL-18 from patients with hepatitis C virus (HCV) infection indicate a possible activation of inflammasome by HCV

Methodology/Principal Findings:To demonstrate whether HCV infection activates the inflammasome, we investigated inflammasome activation from HCV infected hepatic Huh7 cells, or monocytic cells and THP-1 derived macrophages challenged with HCV virions, but no any inflammasome activation was detected in these cells However, when we transfected HCV genomic RNA into monocytes or macrophages, IL-1b was secreted in a dose-dependent manner We also detected ASC oligomerization and caspase-1 cleavage in HCV RNA transfected macrophages Using shRNA-mediated gene silencing or specific inhibitors, we found that HCV RNA-induced IL-1b secretion was dependent on the presence of inflammasome components such as NLRP3, ASC and caspase-1 Furthermore, we also found that RIG-I was dispensable for HCV RNA-induced NLRP3 inflammasome activation, while reactive oxygen species (ROS) production was required

Conclusions:Our results indicate that HCV RNA activates the NLRP3 inflammasome in a ROS-dependent manner, and RIG-I

is not required for this process

Citation: Chen W, Xu Y, Li H, Tao W, Xiang Y, et al (2014) HCV Genomic RNA Activates the NLRP3 Inflammasome in Human Myeloid Cells PLoS ONE 9(1): e84953 doi:10.1371/journal.pone.0084953

Editor: Fayyaz S Sutterwala, University of Iowa Carver College of Medicine, United States of America

Received May 30, 2013; Accepted November 20, 2013; Published January 6, 2014

Copyright: ß 2014 Chen et al This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits

unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This work was supported by grants from 100 Talent Program of the Chinese Academy of Sciences, Natural Science Foundation of China (91029707, 31170868), Novo Nordisk-CAS Research Foundation, SA-SIBS Scholarship Program, as well as grants from the National Key Programs on Infectious Disease (2012ZX10002007-003) The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing Interests: The authors have declared that no competing interests exist.

* E-mail: jzhong@sibs.ac.cn (JZ); gxmeng@sibs.ac.cn (GM)

These authors contributed equally to this work.

Introduction

Hepatitis C virus (HCV) infection tends to become persistent

and causes liver fibrosis and cirrhosis due to chronic inflammation

in humans [1] The 9.6-kb genome of HCV ssRNA is composed of

a 59 untranslated region (59UTR), a single open reading frame

(ORF) and a 39UTR, as well as an internal ribosome entry site

(IRES) within the 59UTR, which directs translation of a

polyprotein precursor of about 3000 amino acids that is cleaved

into mature structural and non-structural proteins [2,3] It was

reported that the HCV 59-ppp poly-U/UC RNA variants

stimulate strong retinoic acid-inducible gene I (RIG-I) activation

in vitro [4] RIG-I was also reported to detect in vitro transcribed

HCV RNA, RNA without a 59-triphosphate end, 59-triphosphate

single-stranded RNA and short double-stranded RNA for type I

interferon production [5–7]

Besides the anti-viral type I interferon response,

pro-inflamma-tory cytokines such as tumor necrosis factor (TNF)-a and

interleukin (IL)-6 can also be induced upon HCV infection [8–

10] Recently, serum IL-18 and IL-1b levels have been observed to

be clearly higher in patients with chronic HCV infection and

HCV related cirrhosis than in healthy controls, and IL-18 was

taken as marker of the acute phase of HCV infection [8,11–15] As

a special group of cytokines, the secretion of IL-1b and IL-18 involves a two step process: step 1 is the synthesis of pro-IL-1b and pro-IL-18 (signal 1); step 2 is activation of caspase-1 (signal 2) which cleaves pro-1b and pro-18 into mature 1b and

IL-18 [16–IL-18] Recently it was found that the activation of caspase-1

is mediated by the inflammasome, a protein complex composed of PRRs including AIM2 (Absent In Melanoma 2) or NLRP3 (NOD-like receptor family, pyrin domain containing 3), adaptor protein ASC (apoptosis-associated specklike protein containing a CARD)

as well as pro-caspase-1 [16,19] Other reported inflammasomes include NLRP1-, NLRC4-, NLRP6-, NLRP7- as well as RIG-I-inflammasome [20–22] Various microbes are able to activate inflammasomes [23], and the NLRP3 and RIG-I inflammasomes were reported to be activated by RNA viruses [24–27] Thus, elevated IL-1b and IL-18 levels in HCV-infected patients indicate that HCV may trigger inflammasome activation

Recently, Burdette et.al reported that HCV (JFH-1) infection induced NLRP3 inflammasome activation in the hepatoma cell line Huh7.5 [28] However, the expression of inflammasome components was found to be prominent in Kupffer cells (KC) and liver sinusoidal endothelial cells, moderate in periportal

myofibro-blasts and hepatic stellate cells, virtually absent in primary

hepatocytes [29], therefore, inflammasome activation in

hepato-cytes may not be the main origin of IL-b from HCV infected

patients Instead, HCV virions or its components such as genomic

RNA may activate the inflammasome in KC or peripheral

myeloid cells, and this should be the main origin of IL-b

Interestingly, a more recent study from Negash et al revealed that

there was no appreciable IL-1b from HCV infected hepatoma

cells or primary hepatocytes, while robust IL-1b production was

induced by HCV virions in human macrophages [30]

In our present study, no inflammasome activation was observed

in HCV infected Huh7 or Huh7.5.1 cells Moreover, we found

that HCV virions did not trigger IL-1b secretion in human

myeloid cells However, we discovered that HCV RNA

transfec-tion in monocytes or macrophages induced robust IL-1b secretransfec-tion,

which was dependent on the NLRP3 inflammasome HCV RNA

transfection triggered ASC oligomerization and caspase-1

cleav-age, suggesting that the HCV genome possesses the ability to

activate signal 2 directly In addition, we found that neither IL-1b

secretion nor caspase-1 cleavage was dependent on RIG-I

Materials and Methods

Primary Monocyte Isolation and Cell Culture

Human PBMCs were obtained from the Shanghai Blood

Center (Shanghai, China) Human monocytes were separated by

PercollTM density-gradient centrifugation (G.E Healthcare,

Bio-sciences, Sweden) from isolated PBMCs Monocyte derived

macrophages (MDM) were generated by incubation of primary

monocytes with recombinant M-CSF (20 ng/ml) for a week as

described [30] THP-1 cells were maintained in RPMI 1640

media, supplemented with 10% FBS, 100 IU/ml penicillin, 1 mg/

ml streptomycin, 0.25 mg/ml amphotericin B, non essential amino

acids, 1 mM sodium pyruvate, 10 mM HEPES buffer and 2 mM

glutamine THP-1 cells were differentiated to macrophage-like

cells with 100 nM phorbol-12-myristate-13-acetate (PMA) for 3

hours and then rested for 48 hours before experiments In some

indicated experiments, THP-1 cells were differentiated to

macro-phages by treatment with 40 nM of PMA overnight at 37uC as

described by Negash et al [30]

HCVcc Preparation, Purification and HCV RNA Generation

The methods of HCVcc preparation had been described [31]

Harvested HCVcc was purified by sucrose density gradient

centrifugation and titrated [31] To generate the full-length

genomic RNA, the 1–807 bp, 2406–3256 bp, 5626–6437 bp

and 39UTR of the HCV JFH-1 strain [32] and the pJFH-1

plasmids containing T7 promoter were linearized at the 39 of the

HCV cDNA by XbaI digestion [33], which was used as the

template for in vitro transcription (Ambion, Austin, TX, USA)

Quantification of IL-1b Secretion by ELISA

Supernatants were analyzed for cytokine IL-1b secretion by

ELISA (BD Biosciences, San Diego, CA) according to the

manufacturer’s instructions

Quantitative Real-time PCR

RNA from human monocytes or Huh7 cells were extracted

using RNA Lyzol reagent (EXcell Bio, China) cDNA was

synthesized with the Rever TraAceHqPCR RT Kit

(TOYO-BO.CO, TLD, Japan) Quantitative real-time PCR was performed

on a 7900 Fast Real-Time PCR System (AB Applied Biosystems,

USA) using SYBRH Green Realtime PCR Master Mix

(TOYO-BO.CO, TLD, Japan) The specificity of amplification was

assessed for each sample by melting curve analysis Relative quantification was performed using standard curve analysis The quantification data are presented as a ratio to the control level The Homo sapiens (hs) gene specific primers used were as follows: IFN-b, 59-GATTCATCTAGCACTGGCTGG-39 (forward) and 59- CTTCAGGTAATGCAGAATCC-39 (reverse);

RIG-I, 59-CCTACCTACATCCTGAGCTACAT-39 (forward) and 59-TCTAGGGCATCCAAAAAGCCA-39 (reverse);

IL-1b, 59-CACGATGCACCTGTACGATCA-39 (forward) and 59-GTTGCTCCATATCCTGTCCCT-39 (reverse); ASC, 59-AACCCAAGCAAGATGCGGAAG-39 (forward) and 59-TTAGGGCCTGGAGGAGCAAG-39 (reverse);

Actin, 59-AGTGTGACGTGGACATCCGCAAAG-39 (for-ward) and 59-ATCCACATCTGCTGGAAGGTGGAC-39 (re-verse);

NLRP3, 59-AAGGGCCATGGACTATTTCC-39 (forward) and 59-GACTCCACCCGATGACAGTT-39 (reverse);

Caspase-1, 59-TCCAATAATGCAAGTCAAGCC-39 (forward) and 59-GCTGTACCCCAGATTTTGTAGCA-39 (reverse)

RNA Transfection into Myeloid Cells

RNA including negative control tRNA, positive control Poly I:C, HCV 1–807 bp, 2406–3256 bp, 5626–6437 bp, HCV 39UTR, HCV full length (FL) RNA, ssRNA40, ssRNA41 and ssPolyU (Invivogen, USA) were transfected with Lipofectamine

2000 (Invitrogen, USA) diluted in OptiMEM (Invitrogen, USA) without nucleic acids according to the manufacturer’s protocol

1 mg of nucleic acid were delivered into THP-1 cells or THP-1 derived macrophages with 2.5 ml of Lipofectamine 2000 unless described otherwise

Generation of THP-1 Cells Expressing shRNAs Targeting Genes of Interest

Three human RIG-I coding sequences were selected for construction of specific shRNA: RIG-I-1, ntGTGGAATGCCTTCTCAGAT; RIG-I-2, nt GCTTCTCTTGATGCGTCAGTGATAGCAAC; RIG-I-3, nt GATAGAGGAATGCCATTACACTGTGCTTG Of them, shRNA RIG-I-3 silenced cells were applied for function experi-ments Similarly, three human AIM2 coding sequences were selected for construction of specific shRNA: AIM2-1, nt GCCTGAACAGAAACAGATG; AIM2-2, nt ATACAAGGA-GATACTCTTGCTAACAGGCC; AIM2-3 nt CCCGAAGAT-CAACACGCTTCA In this case, shRNA AIM2-1 silenced cells were applied for function experiments shRNA vectors against human NLRP3, caspase-1, ASC, and their scramble vectors are gifts from Dr Jurg Tschopp [34] Briefly, THP-1 cells stably expressing shRNA were obtained as follows: ntGATGCG-GAAGCTCTTCAGTTTCA of the human ASC coding se-quence, ntCAGGTACTATCTGTTCT of the human NLRP3 coding sequence, ntGTGAAGAGATCCTTCTGTA of the 39UTR of the human caspase-1 were inserted into pSUPER The Pol III promoter shRNA cassettes from these vectors and from a lamin A/C-specific pSUPER control construct were inserted into the lentiviral vector pAB286.1, a derivative of pHR that contains a SV40-puromycin acetyl transferase cassette for antibiotic selection Second-generation packaging plasmids pMD2-VSVG and pCMV-R8.91 [35] were used for lentivirus production

Immunoblotting

For immunoblotting, cells were lysed with buffer (10 mM Tris

pH 7.5, 1% NP-40, 150 mM NaCl, and protease inhibitor

cocktail) Proteins were separated on sodium dodecyl

sulphate-polyacrylamide gels and then transferred onto polyvinylidene

difluoride membranes The membranes were blocked with 5%

milk in 1 X TBS with 0.5% Tween-20 and then probed with

primary antibodies as follows: rabbit anti-human mature (17 kDa)

IL-1b (D116, Cell Signaling, USA), goat anti-human pro-IL-1b

(31 kDa) (sc-1250, Santa Cruz, USA), rabbit anti-human

caspase-1 (sc-5caspase-15, Santa Cruz, USA), and monoclonal mouse anti-human

b-actin (KM9001, Tianjin Sungene Biotech, China) Appropriate

HRP-conjugated secondary antibodies were used and signals were

detected using ECL reagent (Amersham, USA)

Statistical Analysis

Data were analyzed for statistical significance by the two-tailed

student’s t test and values were shown as mean 6 standard

deviation (SD) if not described otherwise Differences in P values

#0.05 were considered as statistically significant

Results

HCV Infection does not Induce IL-1b Secretion in Huh7

Cells

To demonstrate the possible production of IL-1b from

HCV-infected hepatoma cells, cellular lysates and the supernatants (SNs)

from HCV virion-incubated Huh7 cells were collected at indicated

time points for analysis (Figure 1A–C) We found that the level of

IL-1b mRNA was not elevated in HCV (JFH-1) infected Huh7

cells (Figure 1A), nor was the IL-1b protein being detected in SNs

from these cells at day 1, day 2 or day 4 after virus infection

(Figure 1B), although the infection efficiency was found normal as

indicated by HCV RNA replication (Figure 1C) Moreover, in

another hepatoma cell line Huh7.5.1 cells, 4 days after HCV

infection, no IL-1b was detected either (Figure S1) To examine

the potential low level activation of the inflammasome in Huh7

cells, we treated the cells with LPS and ATP, but IL-1b production

was still not detected (Figure 1D–E) We next detected the

expression levels of the inflammasome components in HCV

JFH-1-infected Huh7 cells, and found that there was nearly no

inflammasome components expressed (Figure 1F), which was

similar to a previous report [29] Therefore, we did not detect any

IL-1b secretion in HCV infected hepatoma cell lines

HCV Particles do not Induce IL-1b Secretion from Human

Monocytes and Macrophages

Since clinical reports have shown that IL-1b and IL-18 were

up-regulated in HCV infected patients [8,11–15] and there exists

abundant expression of inflammasome components in monocytes

and macrophages [17], we speculated that HCV virion and/or its

components may activate the inflammasome in myeloid cells

However, when we treated THP-1 monocytes (Figure 2A), THP-1

derived macrophages (Figure 2B), human primary monocytes

(Figure 2C) and macrophages (either unprimed or LPS primed)

(Figure 2D–E) with purified HCV virions at a multiplicity of

infection (MOI) from 0.001 to 2 as indicated, no any IL-1b

secretion was detected Therefore, our results indicated that the

phagocytosis of HCV by monocytes or macrophages may not be

sufficient to activate the inflammasome However, Negash et al

found that HCV virions induced robust IL-1b secretion from

macrophages [30] We speculated that the THP-1 differentiation

procedures between Negash’s and ours were different However,

when we applied the exact same differentiation procedure, we still

could not detect any IL-1b in HCV treated macrophages (Figure

S2) Perhaps other differences in cell culture condition accounted

for the different observation

HCV RNA Induces IL-1b Secretion in Macrophages

Although we found that HCV virions did not activate the inflammasome in hepatoma cell lines or myeloid cells, we believe that some components instead of the HCV virion particle itself could activate the inflammasome, because several reports showed high plasma levels of IL-18 and IL-1b in HCV infected patients [8,11–15] Since HCV RNA is a well known PAMP in vivo and

in vitro [4,32,36], we evaluated the ability of HCV RNA in triggering inflammasome activation in THP-1 derived macro-phages We transfected HCV RNA obtained from in vitro transcription into macrophages, followed with IL-1b assay In this experiment, clear IL-1b mRNA up-regulation and IL-1b protein secretion was observed (Figure 3A–B) In addition, HCV RNA induced IL-1b production in a dose dependent manner (Figure 3C) In a time kinetics test, IL-1b secretion was increased from 3 h to 6 h post HCV RNA transfection and remained at a steady level till 24 h after transfection (Figure 3D) Moreover, genomic RNA extracted from purified HCV virions exhibited similar induction of IL-1b (Figure 3E) To exclude the possibility of contamination in the RNA preparation, we applied the unrelated ApoE transcript as a control, which led to only background level of IL-1b secretion compared with HCV RNA (Figure 3E) To further exclude the possibility that some contamination might have caused IL-1b induction, we digested the HCV RNA with RNase The result showed that it was the HCV RNA itself that accounted for the IL-1b induction from myeloid cells, as RNase treated HCV RNA lost the ability to induce IL-1b release (Figure 3F) Moreover, we went a step further to demonstrate which part of the HCV genome might have been accounting for the IL-1b induction in macrophages When different fragments of the HCV genomic RNA was transfected under the same molar concentra-tion (0.3 pM), we found that only the 39UTR contained the crucial motif for IL-1b induction, although it was not as potent as the full-length HCV genomic RNA (Figure 3G) It had been reported that transfection with EMCV RNA fails to stimulate IL-1b secretion [37], while uridine-rich single-stranded RNA40 (ssRNA40) from the HIV-1 long terminal repeat is able to induce IL-1b production [26] Our study and others also confirmed that ssRNA40 but not ssRNA41 nor Poly U was able to induce IL-1b secretion (Figure 3H) [38] These data suggest that not all virus RNA is able to activate macrophages and certain specific sequence or structure is critical for HCV RNA-induced IL-1b secretion

HCV RNA Transfection Activates the Inflammasome Through NLRP3 but not RIG-I

The robust IL-1b induction by HCV RNA from macrophages mentioned above implied an activation of inflammasome The IL-1b mRNA and protein induction by HCV RNA indicated that HCV RNA could provide both signal 1 and signal 2 for inflammasome activation (Figure 3) Indeed, in LPS-primed macrophages, HCV RNA induced as much IL-1b secretion as exogenous ATP (Figure S3) As more direct evidence for inflammasome activation [39], the cleavage of caspase-1 and oligomerization of ASC in HCV RNA transfected cells was examined We found that HCV RNA triggered the cleavage of caspase-1 and oligomerization of ASC as much as LPS+ATP in macrophages (Figure 4A–B), indicating a typical activation of inflammasome [40]

To further demonstrate the specificity of inflammasome activation by HCV RNA, we transfected the HCV RNA into macrophages derived from THP-1 cells with shRNA mediated silencing for ASC, caspase-1, NLRP3 or AIM2 genes ([41,42] and Figure S4A) It was found that IL-1b secretion induced by HCV RNA was dependent on ASC, caspase-1 and NLRP3, but not

AIM2 (Figure 4C) Similarly, ASC, caspase-1 and NLRP3 were all

required for caspase-1 activation induced by HCV RNA

(Figure 4D) Interestingly, the ASC oligomerization induced by

HCV RNA required the presence of NLRP3 and ASC, but

caspase-1 was dispensable (Figure 4D), which confirmed the recent

observation that caspase-1 is dispensable for ASC oligomerization

in murine cells [43] These results thus indicated that HCV RNA

activated the NLRP3 inflammasome

Mechanism Underlying NLRP3 Inflammasome Activation

Induced by HCV RNA

More and more studies reveal that NLRP3 may not be a direct

sensor for any PAMP [38,44] HCV RNA was reported to be

recognized by RIG-I to activate IFN regulatory factor 3 and

NF-kB in HCV infected Huh7 cells [5,45–47] We thus tested whether

RIG-I was involved in inflammasome activation upon HCV RNA

transfection We generated shRNA targeting RIG-I in THP-1 cells

and confirmed that the knock-down efficiency was significant

(Figure S4B) However, when HCV RNA was transfected into

such cell derived macrophages, IL-1b mRNA expression and

protein secretion were not reduced in comparison with the control

(Figure 5A–B) Moreover, caspase-1 cleavage was also normal in

RIG-I silenced cells compared with the control upon either HCV RNA transfection or LPS stimulation (Figure 5C), while the expression of type I interferon was clearly decreased in the absence

of RIG-I (Figure S5) These results indicated that in HCV RNA transfected myeloid cells, neither pro-IL-1b synthesis nor

caspase-1 activation was dependent on RIG-I [25]

It is generally known that NLRP3 inflammasome-mediated cytokine release requires two signals: signal 1 activation leads to the synthesis of pro-IL-1b, pro-IL-18 and up-regulation of NLRP3 expression via NF-kB activity [48,49]; while signal 2 can be triggered by agents or pathogens that cause potassium efflux, mitochondria damage, mtDNA release, Reactive oxygen species (ROS) production, intracellular calcium increase and cellular cyclic AMP reduction [50–55], which induces activation of caspase-1 and cleavage of pro-IL-1b as well as pro-IL-18 In order to explore the mechanism of NLRP3 inflammasome activation by HCV RNA, we investigated whether ROS was involved in this process In this experiment, we pretreated THP-1 derived macrophages with ROS inhibitor diphenyliodonium (DPI) for 30 minutes, then transfected the HCV RNA into the cells before conducting the IL-1b secretion assay 6 hours later As expected, DPI reduced HCV RNA-induced IL-1b release in a dose dependent manner (Figure 5D) LPS treatment in parallel

Figure 1 HCV infection does not induce IL-1b secretion in Huh7 cells Huh7 cells were incubated with HCV virions (MOI = 1) for 1, 2 or 4 days Total RNA was extracted for Q-PCR analysis (A, C, F) and supernatants were harvested for IL-1b ELISA testing (B) THP-1 derived macrophages and Huh7 cells were incubated with LPS (200 ng/ml for 6 hours) followed by ATP pulsing (5 mM) for 30 minutes, the cells were then collected for IL-1b mRNA detection by Q-PCR (D), and supernatants were harvested for IL-1b ELISA (E) Data shown here represent at least three independent experiments performed with internal triplicates.

doi:10.1371/journal.pone.0084953.g001

served as a positive control (Figure 5E) These results thus reveal

that HCV RNA-induced activation of the NLRP3 inflammasome

was ROS-dependent

Discussion

In the current study, we found that HCV RNA but not whole

virions activated the NLRP3 inflammasome in human myeloid

cells but not in hepatocytes Recently, many studies on

inflamma-some activation mediated by viruses have been reported [24,56–

58] Most viruses activate the inflammasome by infecting immune

cells such as macrophages and dendritic cells where inflammasome

components are well expressed [56] Although some studies

indicated that NLRP3 is expressed in non-immune cells such as

keratinocytes and lung epithelial cells [59,60], its expression has

not been detected in primary hepatocytes [29] We also found that

the expression level of NLRP3 in Huh7 cells was low, and was not

upregulated by HCV infection It is interesting that Burdette et al

found that HCV infection induced NLRP3 inflammasome

activation in Huh7.5 cells [28] However, that result could not

be reproduced in our experimental system, nor in the study from

Negash et al [30] Burdette et al performed their study in Huh7.5 cells that are RIG-I deficient [28] However, Negash et al did not find appreciable IL-1b levels in HCV infected hepatoma cells and primary hepatocytes (PH5CH8, IHH, Huh7 and Huh7.5 cells) [30] Although we conducted our study in Huh7 and Huh7.5.1 cells instead of Huh7.5 cells, these Huh7.5.1 cells were also RIG-I deficient hepatoma cells alike Huh7.5 cells [30] Some unknown factor(s) in the Huh7.5 cells used by Burdette et al may account for their different findings in comparison with ours and that from Negash et al

Although a number of clinical discoveries provided clues that HCV infection may activate the inflammasome [8,11–15], the fact that HCV cannot infect macrophages or dendritic cells, and the lack of availability of human primary hepatocytes or liver Kupffer cells made the investigation rather difficult to perform Nonethe-less, Negash et al found that HCV virions activate the NLRP3 inflammasome in macrophages upon phagocytosis and HCV RNA was only responsible for pro-IL-1b synthesis, but not caspase-1 activation [30]; while in our study, HCV virions could not activate the inflammasome Instead, we demonstrated that

Figure 2 HCV virion treatment does not trigger IL-1b secretion in human myeloid cells THP-1 cells (A), THP-1 derived macrophages (B), human primary monocytes (C), human primary unprimed (D) and LPS primed (E) macrophages were treated with purified HCV virions at different MOI for 12 hours and the supernatants were harvested for IL-1b ELISA testing Data shown here represent the mean 6 SD of at least three independent experiments performed with internal triplicates.

doi:10.1371/journal.pone.0084953.g002

Figure 3 HCV RNA induces IL-1b production in macrophages THP-1 derived macrophages were stimulated with 2 mg/ml of yeast tRNA, poly (I:C) and HCV genomic RNA for 6 hours, cells and supernatants were collected for IL-1b mRNA and protein detection by Q-PCR and ELISA, respectively (A, B) Macrophages were stimulated with different doses of HCV RNA for 6 hours (C), or with 2 mg/ml HCV RNA for different time periods (D), and then the supernatants were harvested for IL-1b ELISA E, Macrophages were stimulated for 6 hours with different doses of in vitro transcribed HCV RNA and HCV RNA extracted from purified HCV virions through a sucrose cushion, and the supernatants were harvested for IL-1b ELISA; ApoE served

as a negative control and LPS+ATP was set as a positive control HCV RNA digested with RNase (F), different motifs of HCV RNA (G) and ssRNA40, ssRNA41, polyU (H) were transfected into THP-1 derived macrophages, 6 hours later the supernatants were harvested for IL-1b ELISA Data presented are mean 6 SD of one representative of three independent experiments B, ***represents P,0.001, **represents P,0.01 and *represents P,0.05 in comparison with control during statistical analysis.

doi:10.1371/journal.pone.0084953.g003

transfection of HCV RNA was able to activate the NLRP3

inflammasome in human myeloid cells Our direct evidence for

HCV RNA induced NLRP3 inflammasome includes the

forma-tion of the ASC pyroptosome and the cleavage of caspase-1 in

macrophages Furthermore, we found this process was dependent

on NLRP3, ASC and caspase-1

Although we demonstrated that HCV RNA was responsible for

NLRP3 inflammasome activation by in vitro transfection, it would

be interesting to investigate how this happens in physiological

conditions HCV RNA can be delivered into monocytes and/or

macrophages via the following routes Firstly, HCV RNA was

reported to be delivered into human pDCs by exosomes when

HCV subgenome replicon cells or JFH-1 infected Huh7 cells are

co-cultured with pDCs [61], and it can be transmitted between

human hepatoma Huh7.5 cells [62], which suggest that it could also be transferred into monocytes or macrophages Secondly, non-neutralizing antibody may help macrophages engulf HCV virions to promote HCV RNA delivery and recognition in vivo [63,64]

Negash and colleagues demonstrated that HCV RNA is sensed

by TLR7 and induces the synthesis of pro-IL-1b through MyD88-mediated NF-kB activation, while VISA is not involved in this process We have not investigated the possible role of TLR7 in HCV RNA induced IL-1b production, and we identified that HCV RNA induced pro-IL-1b synthesis was not RIG-I depen-dent At present we could not exclude the possible involvement of TLR7 in HCV RNA triggered IL-1b production, and whether

Figure 4 HCV RNA induces NLRP3 inflammasome activation THP-1 derived macrophages were stimulated with HCV RNA for 6 hours, or LPS (200 ng/ml) for 6 hours followed by 5 mM ATP pulsing for 30 minutes, then the whole cell lysates were harvested for immunoblotting (A, B) C, THP-1 cells expressing specific shRNAs targeting AIM2, NLRP3, ASC, or Caspase-1 genes were differentiated into macrophages, followed by stimulation with

2 mg/ml HCV RNA for 6 hours, and then the supernatants were harvested for IL-1b ELISA D, Cells as in (A) were stimulated with HCV RNA for 6 hours, and the supernatant and whole cell lysates were harvested for ASC specific immunoblotting Data in C represent the means 6 SD of at least three independent experiments performed with internal triplicates A, B, D is one representative experimental result of at least three repeats, respectively.

***represents P,0.001 and **represents P,0.01 in comparison with controls during statistical analysis.

doi:10.1371/journal.pone.0084953.g004

Figure 5 Mechanisms underlying NLRP3 inflammasome activation triggered by HCV RNA 2 mg/ml HCV RNA was transfected in RIG-I silenced THP-1 cells, 6 hours later cells were harvested for IL1-b mRNA expression by Q-PCR (A), the supernatants were harvested for IL-1b ELISA (B) C, Cells were stimulated with HCV RNA for 6 hours, and the supernatant and whole cell lysates were harvested for immunoblotting D–E, THP-1 derived macrophages were pretreated with ROS inhibitor DPI for half an hour, then challenged with HCV RNA (2 mg/ml) or LPS (1 mg/ml), 6 hours later the supernatants were harvested for IL-1b ELISA Data presented are the mean 6 SD of one representative figure out of three independent experiments.

***represents P,0.001, **represents P,0.01 and *represents P,0.05 in comparison with controls during statistical analysis.

doi:10.1371/journal.pone.0084953.g005

VISA plays a role during the inflammasome activation process

awaits further study

VISA was recently reported to promote NLRP3 inflammasome

activation, but the role of RIG-I was not included in that work

[65] Interestingly, in our study HCV RNA did not activate

caspase-1 through RIG-I It was reported that even different

strains of VSV appeared to be different in the activation of the

RIG-I inflammasome [25,56] It could be that RIG-I

inflamma-some activation is specific for murine cells only upon certain virus

infection

We have not elucidated the reason why HCV virions could not

induce inflammasome activation in our hands, a possible reason

could be that the macrophages in our hands are not as sensitive as

the cells in the study by Negash et al It could also be due to some

yet unknown difference between the virions produced from these

two labs As for the question of why phagocytosis of HCV virions

could not activate the inflammasome while transfection of HCV

RNA could, we speculate that in our system, the macrophages

require a larger amount of HCV RNA for inflammasome

activation, which can only be fulfilled through transfection

Phagocytosis of virions might not provide sufficient amount of

HCV RNA for activation However, this recognition of HCV

RNA may happen in physiologic conditions through

exosome-mediated delivery or non-neutralizing antibody-exosome-mediated

engulf-ment

Interestingly, we demonstrated that only certain portions of the

HCV RNA, which includes the 39UTR, could activate the

NLRP3 inflammasome efficiently The other portions tested (1–

807 bp, 2406–3256 bp, 5626–6437 bp) were not able to do so

However, the 39UTR was still not as potent as the full length HCV

genomic RNA in activating the inflammasome, indicating how

other motifs may also involved in the activation process Negash

et al speculated that transient production of p7 and other HCV

proteins might provide stimuli (such as signal 2) for inflammasome

activation [30], and during the revision of our study, Shrivastava

et al published their observation that HCV P7 RNA induced

IL-1b secretion in macrophages in a way slightly weaker than HCV

genomic RNA [26] It would be interesting to test whether there is

any synergistic effect when 39UTR and P7 RNA are

co-transfected

We verified that ROS was involved in HCV RNA-induced

inflammasome activation, and HCV RNA was able to activate

both signal 1 and signal 2 in human myeloid cells as many other

PAMPs and microbes do [41] We have not studied whether other

mechanisms such as potassium efflux, calcium influx and

mitochondrial mtDNA release are related to HCV RNA-induced

NLRP3 inflammasome activation [50–55], which deserves further

investigation

In summary, we have identified that HCV RNA but not virions

could activate the NLRP3 inflammasome RIG-I was not required

for the activation, while ROS production was involved in this

process Our study thus provided a novel route of inflammation

observed in HCV infected patients

Supporting Information Figure S1 HCV infection does not induce IL-1b secretion from Huh7.5.1 cells Huh7.5.1 cells were incubated with HCV virions (MOI = 1) for 4 days, then supernatants were harvested for IL-1b ELISA LPS treated THP-1 mococytic cells was set as positive control Data are mean 6 SD of one representative out of three independent experiments

(TIF)

Figure S2 HCV infection does not induce IL-1b produc-tion from THP-1 derived macrophages THP-1 cells were differentiated to macrophages by treatment with 40 nM of PMA overnight at 37uC as described by Negash et al [30] These macrophages were incubated with purified HCV virions with indicated MOI for 12 hours and the supernatants were harvested for IL-1b ELISA Data presented are mean 6 SD of one representative out of three independent experiments

(TIF)

Figure S3 HCV RNA induces IL-1b from LPS-primed macrophages THP-1 derived macrophages primed or non-primed with 100 ng/ml LPS for 6 hours were stimulated with

1 ug/ml LPS or transfected 2 mg/ml HCV RNA for 6 hours or

5 mM ATP for half an hour and the supernatants were harvested for IL-1b ELISA Data presented are mean 6 SD of one representative out of three independent experiments

(TIF)

Figure S4 The knock-down efficiency of AIM2 and RIG-I

in respective THP-1 cells Q-PCR was applied to monitor the expression of AIM2 or RIG-I in shRNA transfected THP-1 cells,AIM2-1 and RIG-I-3 were used for experiments in our study (TIF)

Figure S5 IFN-b induction by HCV RNA is dependent on RIG-I 2 mg/ml HCV RNA was transfected into macrophages derived from THP-1 cells silenced for RIG-I, 6 hours later the cells were harvested for IFN-b mRNA expression by Q-PCR The values represent mean value 6 SD of three independent experiments **represents P,0.01 in comparison with control in statistic analysis

(TIF)

Acknowledgments

We would like to thank Dr Jurg Tschopp for providing the shRNA constructs against NLRP3, Caspase-1, ASC and scramble We thank Andy Tsun for help with preparation of this manuscript.

Author Contributions Conceived and designed the experiments: GM JZ Performed the experiments: WC YX HL Analyzed the data: YX JZ GM Contributed reagents/materials/analysis tools: WT YX BH JN Wrote the paper: YX

WC JZ GM.

References

1 Pawlotsky JM (2004) Pathophysiology of hepatitis C virus infection and related

liver disease Trends Microbiol 12: 96–102.

2 Bartenschlager R, Lohmann V (2000) Replication of hepatitis C virus J Gen

Virol 81: 1631–1648.

3 Blight KJ, Kolykhalov AA, Rice CM (2000) Efficient initiation of HCV RNA

replication in cell culture Science 290: 1972–1974.

4 Schnell G, Loo YM, Marcotrigiano J, Gale M Jr (2012) Uridine composition of

the poly-U/UC tract of HCV RNA defines non-self recognition by RIG-I PLoS

Pathog 8: e1002839.

5 Sumpter R Jr, Loo YM, Foy E, Li K, Yoneyama M, et al (2005) Regulating intracellular antiviral defense and permissiveness to hepatitis C virus RNA replication through a cellular RNA helicase, RIG-I J Virol 79: 2689–2699.

6 Kato H, Takeuchi O, Mikamo-Satoh E, Hirai R, Kawai T, et al (2008) Length-dependent recognition of double-stranded ribonucleic acids by retinoic acid-inducible gene-I and melanoma differentiation-associated gene 5 J Exp Med 205: 1601–1610.

7 Kato H, Takeuchi O, Sato S, Yoneyama M, Yamamoto M, et al (2006) Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses Nature 441: 101–105.

8 Lapinski TW (2001) The levels of IL-1beta, IL-4 and IL-6 in the serum and the

liver tissue of chronic HCV-infected patients Arch Immunol Ther Exp (Warsz)

49: 311–316.

9 Nishitsuji H, Funami K, Shimizu Y, Ujino S, Sugiyama K, et al (2013) HCV

infection induces inflammatory cytokines and chemokines mediated by the

cross-talk between hepatocytes and stellate cells J Virol.

10 Aroucha DC, do Carmo RF, Moura P, Silva JL, Vasconcelos LR, et al (2013)

High tumor necrosis factor-alpha/interleukin-10 ratio is associated with

hepatocellular carcinoma in patients with chronic hepatitis C Cytokine 62:

421–425.

11 Vecchiet J, Falasca K, Cacciatore P, Zingariello P, Dalessandro M, et al (2005)

Association between plasma interleukin-18 levels and liver injury in chronic

hepatitis C virus infection and non-alcoholic fatty liver disease Ann Clin Lab Sci

35: 415–422.

12 Ghany MG, Strader DB, Thomas DL, Seeff LB, American Association for the

Study of Liver D (2009) Diagnosis, management, and treatment of hepatitis C:

an update Hepatology 49: 1335–1374.

13 Sharma A, Chakraborti A, Das A, Dhiman RK, Chawla Y (2009) Elevation of

interleukin-18 in chronic hepatitis C: implications for hepatitis C virus

pathogenesis Immunology 128: e514–522.

14 Yoneda S, Umemura T, Katsuyama Y, Kamijo A, Joshita S, et al (2011)

Association of serum cytokine levels with treatment response to pegylated

interferon and ribavirin therapy in genotype 1 chronic hepatitis C patients.

J Infect Dis 203: 1087–1095.

15 Chattergoon MA, Levine JS, Latanich R, Osburn WO, Thomas DL, et al.

(2011) High plasma interleukin-18 levels mark the acute phase of hepatitis C

virus infection J Infect Dis 204: 1730–1740.

16 Schroder K, Tschopp J (2010) The inflammasomes Cell 140: 821–832.

17 van de Veerdonk FL, Netea MG, Dinarello CA, Joosten LA (2011)

Inflammasome activation and IL-1beta and IL-18 processing during infection.

Trends Immunol 32: 110–116.

18 Dinarello CA (2009) Immunological and inflammatory functions of the

interleukin-1 family Annu Rev Immunol 27: 519–550.

19 Franchi L, Munoz-Planillo R, Nunez G (2012) Sensing and reacting to microbes

through the inflammasomes Nat Immunol 13: 325–332.

20 Strowig T, Henao-Mejia J, Elinav E, Flavell R (2012) Inflammasomes in health

and disease Nature 481: 278–286.

21 Franchi L, Eigenbrod T, Munoz-Planillo R, Nunez G (2009) The

inflamma-some: a caspase-1-activation platform that regulates immune responses and

disease pathogenesis Nat Immunol 10: 241–247.

22 Kinoshita T, Wang Y, Hasegawa M, Imamura R, Suda T (2005) PYPAF3, a

PYRIN-containing APAF-1-like protein, is a feedback regulator of

caspase-1-dependent interleukin-1beta secretion J Biol Chem 280: 21720–21725.

23 Kanneganti TD (2010) Central roles of NLRs and inflammasomes in viral

infection Nat Rev Immunol 10: 688–698.

24 Ichinohe T, Pang IK, Iwasaki A (2010) Influenza virus activates inflammasomes

via its intracellular M2 ion channel Nat Immunol 11: 404–410.

25 Poeck H, Bscheider M, Gross O, Finger K, Roth S, et al (2010) Recognition of

RNA virus by RIG-I results in activation of CARD9 and inflammasome

signaling for interleukin 1 beta production Nat Immunol 11: 63–69.

26 Shrivastava S, Mukherjee A, Ray R, Ray RB (2013) Hepatitis C Virus Induces

IL-1beta/IL-18 IN Circulatory and Resident Liver Macrophages J Virol.

27 Thomas PG, Dash P, Aldridge JR Jr, Ellebedy AH, Reynolds C, et al (2009)

The intracellular sensor NLRP3 mediates key innate and healing responses to

influenza A virus via the regulation of caspase-1 Immunity 30: 566–575.

28 Burdette D, Haskett A, Presser L, McRae S, Iqbal J, et al (2012) Hepatitis C

virus activates interleukin-1beta via caspase-1-inflammasome complex J Gen

Virol 93: 235–246.

29 Boaru SG, Borkham-Kamphorst E, Tihaa L, Haas U, Weiskirchen R (2012)

Expression analysis of inflammasomes in experimental models of inflammatory

and fibrotic liver disease J Inflamm (Lond) 9: 49.

30 Negash AA, Ramos HJ, Crochet N, Lau DT, Doehle B, et al (2013) IL-1beta

production through the NLRP3 inflammasome by hepatic macrophages links

hepatitis C virus infection with liver inflammation and disease PLoS Pathog 9:

e1003330.

31 Zhong J, Gastaminza P, Cheng G, Kapadia S, Kato T, et al (2005) Robust

hepatitis C virus infection in vitro Proc Natl Acad Sci U S A 102: 9294–9299.

32 Saito T, Owen DM, Jiang F, Marcotrigiano J, Gale M Jr (2008) Innate

immunity induced by composition-dependent RIG-I recognition of hepatitis C

virus RNA Nature 454: 523–527.

33 Kato T, Date T, Miyamoto M, Furusaka A, Tokushige K, et al (2003) Efficient

replication of the genotype 2a hepatitis C virus subgenomic replicon.

Gastroenterology 125: 1808–1817.

34 Petrilli V, Papin S, Dostert C, Mayor A, Martinon F, et al (2007) Activation of

the NALP3 inflammasome is triggered by low intracellular potassium

concentration Cell Death Differ 14: 1583–1589.

35 Naldini L, Blomer U, Gallay P, Ory D, Mulligan R, et al (1996) In vivo gene

delivery and stable transduction of nondividing cells by a lentiviral vector.

Science 272: 263–267.

36 Dental C, Florentin J, Aouar B, Gondois-Rey F, Durantel D, et al (2012)

Hepatitis C virus fails to activate NF-kappaB signaling in plasmacytoid dendritic

cells J Virol 86: 1090–1096.

37 Ito M, Yanagi Y, Ichinohe T (2012) Encephalomyocarditis virus viroporin 2B activates NLRP3 inflammasome PLoS Pathog 8: e1002857.

38 Mitoma H, Hanabuchi S, Kim T, Bao M, Zhang Z, et al (2013) The DHX33 RNA helicase senses cytosolic RNA and activates the NLRP3 inflammasome Immunity 39: 123–135.

39 Wang H, Mao L, Meng G (2013) The NLRP3 inflammasome activation in human or mouse cells, sensitivity causes puzzle Protein Cell 4: 565–568.

40 Fernandes-Alnemri T, Wu J, Yu JW, Datta P, Miller B, et al (2007) The pyroptosome: a supramolecular assembly of ASC dimers mediating inflamma-tory cell death via caspase-1 activation Cell Death and Differentiation 14: 1590– 1604.

41 Lei G, Chen M, Li H, Niu JL, Wu S, et al (2013) Biofilm from a clinical strain of Cryptococcus neoformans activates the NLRP3 inflammasome Cell Res.

42 Li H, Wu S, Mao L, Lei G, Zhang L, et al (2013) Human pathogenic fungus Trichophyton schoenleinii activates the NLRP3 inflammasome Protein Cell 4: 529–538.

43 Mao K, Chen S, Chen M, Ma Y, Wang Y, et al (2013) Nitric oxide suppresses NLRP3 inflammasome activation and protects against LPS-induced septic shock Cell Res 23: 201–212.

44 Meng G, Strober W (2010) New insights into the nature of autoinflammatory diseases from mice with Nlrp3 mutations Eur J Immunol 40: 649–653.

45 Meylan E, Curran J, Hofmann K, Moradpour D, Binder M, et al (2005) Cardif

is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis

C virus Nature 437: 1167–1172.

46 Foy E, Li K, Sumpter R Jr, Loo YM, Johnson CL, et al (2005) Control of antiviral defenses through hepatitis C virus disruption of retinoic acid-inducible gene-I signaling Proc Natl Acad Sci U S A 102: 2986–2991.

47 Yoneyama M, Kikuchi M, Natsukawa T, Shinobu N, Imaizumi T, et al (2004) The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses Nat Immunol 5: 730–737.

48 Creagh EM, O’Neill LA (2006) TLRs, NLRs and RLRs: a trinity of pathogen sensors that co-operate in innate immunity Trends Immunol 27: 352–357.

49 Poeck H, Ruland J (2012) From virus to inflammation: mechanisms of RIG-I-induced IL-1beta production Eur J Cell Biol 91: 59–64.

50 Nakahira K, Haspel JA, Rathinam VA, Lee SJ, Dolinay T, et al (2011) Autophagy proteins regulate innate immune responses by inhibiting the release

of mitochondrial DNA mediated by the NALP3 inflammasome Nat Immunol 12: 222–230.

51 Shimada K, Crother TR, Karlin J, Dagvadorj J, Chiba N, et al (2012) Oxidized mitochondrial DNA activates the NLRP3 inflammasome during apoptosis Immunity 36: 401–414.

52 Zhou R, Yazdi AS, Menu P, Tschopp J (2011) A role for mitochondria in NLRP3 inflammasome activation Nature 469: 221–225.

53 Lee GS, Subramanian N, Kim AI, Aksentijevich I, Goldbach-Mansky R, et al (2012) The calcium-sensing receptor regulates the NLRP3 inflammasome through Ca2+ and cAMP Nature 492: 123–127.

54 Murakami T, Ockinger J, Yu J, Byles V, McColl A, et al (2012) Critical role for calcium mobilization in activation of the NLRP3 inflammasome Proc Natl Acad Sci U S A 109: 11282–11287.

55 Rossol M, Pierer M, Raulien N, Quandt D, Meusch U, et al (2012) Extracellular Ca(2+) is a danger signal activating the NLRP3 inflammasome through G protein-coupled calcium sensing receptors Nat Commun 3: 1329.

56 Rajan JV, Rodriguez D, Miao EA, Aderem A (2011) The NLRP3 inflamma-some detects encephalomyocarditis virus and vesicular stomatitis virus infection.

J Virol 85: 4167–4172.

57 Barlan AU, Griffin TM, McGuire KA, Wiethoff CM (2011) Adenovirus membrane penetration activates the NLRP3 inflammasome J Virol 85: 146– 155.

58 Lawrence TM, Hudacek AW, de Zoete MR, Flavell RA, Schnell MJ (2013) Rabies Virus Is Recognized by the NLRP3 Inflammasome and Activates Interleukin-1beta Release in Murine Dendritic Cells J Virol 87: 5848–5857.

59 Watanabe H, Gaide O, Petrilli V, Martinon F, Contassot E, et al (2007) Activation of the IL-1beta-processing inflammasome is involved in contact hypersensitivity J Invest Dermatol 127: 1956–1963.

60 Hirota JA, Hirota SA, Warner SM, Stefanowicz D, Shaheen F, et al (2012) The airway epithelium nucleotide-binding domain and leucine-rich repeat protein 3 inflammasome is activated by urban particulate matter J Allergy Clin Immunol 129: 1116–1125 e1116.

61 Dreux M, Garaigorta U, Boyd B, Decembre E, Chung J, et al (2012) Short-range exosomal transfer of viral RNA from infected cells to plasmacytoid dendritic cells triggers innate immunity Cell Host Microbe 12: 558–570.

62 Ramakrishnaiah V, Thumann C, Fofana I, Habersetzer F, Pan Q, et al (2013) Exosome-mediated transmission of hepatitis C virus between human hepatoma Huh7.5 cells Proc Natl Acad Sci U S A 110: 13109–13113.

63 Halstead SB, O’Rourke EJ (1977) Dengue viruses and mononuclear phagocytes.

I Infection enhancement by non-neutralizing antibody J Exp Med 146: 201– 217.

64 Mady BJ, Kurane I, Erbe DV, Fanger MW, Ennis FA (1993) Neuraminidase augments Fc gamma receptor II-mediated antibody-dependent enhancement of dengue virus infection J Gen Virol 74 (Pt 5): 839–844.

65 Subramanian N, Natarajan K, Clatworthy MR, Wang Z, Germain RN (2013) The Adaptor MAVS Promotes NLRP3 Mitochondrial Localization and Inflammasome Activation Cell 153: 348–361.