a novel role of the checkpoint kinase atr in leptin signaling

Possible reasons for this include a defect in the transport of leptin across the blood–brain barrier Banks, 2004, inhibition of the in-tracellular signaling from the leptin receptor medi

Trang 1

A novel role of the checkpoint kinase ATR in leptin signaling

Bioscience, Cardiovascular and Metabolic Diseases, AstraZeneca R&D, Pepparedsleden 1, 431 83 Mölndal, Sweden

A R T I C L E I N F O

Article history:

Received 20 September 2013

Received in revised form 30 March 2015

Accepted 27 April 2015

Available online

Keywords:

Leptin

Ataxia Telangiectasia and RAD3 related

protein

Signal Transducer and Activator of

Transcription 3 protein

Suppressor of Cytokine Signaling 3

A B S T R A C T

In a world with increasing incidences of obesity, it becomes critical to understand the detailed regula-tion of appetite To identify novel regulators of the signaling mediated by one of the key hormones of energy homeostasis, leptin, we screened a set of compounds for their effect on the downstream Signal Transducer and Activator of Transcription 3 (STAT3) signaling Interestingly, cells exposed to inhibitors

of the Ataxia Telangiectasia and RAD3-related protein ATR increased their leptin dependent STAT3 ac-tivity This was due to failure of the cells to induce the negative feedback mediator Suppressor of Cytokine Signaling 3 (SOCS3), suggesting that ATR has a previously unknown role in the negative feedback reg-ulation of leptin signaling This is an important ﬁnding not only because it sheds light on additional genes involved in leptin signaling, but also because it brings forward a new potential therapeutic intervention point for increasing leptin signaling in obese individuals

BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/)

1 Introduction

Signaling mediated by the hormone leptin plays a crucial role

in regulating energy homeostasis in mammals Leptin was

discov-ered as a key component of the physiological systems that regulate

food intake, and the hormone is secreted by adipocytes in

propor-tion to body fat mass (Zhang et al., 1994) The actions mediated

through leptin receptors in brain neurons involved in regulating

energy intake and expenditure are more well-studied than the

actions mediated on peripheral leptin receptors (Morioka et al.,

2007) Leptin inhibits appetite by various mechanisms, e.g by

coun-teracting the effects of the feeding stimulant neuropeptide Y (Smith

et al., 1998) and by promoting the synthesis of Proopiomelanocortin

(POMC), a precursor for the anorectic alpha melanocyte

stimulat-ing hormone (Cowley et al., 2001) In contrast to the rapid inhibition

of appetite caused by cholecystokinin, the appetite-inhibitory effects

of leptin are long-term and help adjust the food intake over time

(Harrold et al., 2012)

The increased fat mass in obese individuals leads to a

concom-itant increase in serum leptin levels (Liu et al., 2011) Despite this,

these individuals still fail to reduce food intake over time because

of an apparent resistance to leptin (Frederich et al., 1995) The use

of leptin as a therapeutic agent has been explored with limited success due to this inability to respond to circulating levels of leptin Possible reasons for this include a defect in the transport of leptin across the blood–brain barrier (Banks, 2004), inhibition of the in-tracellular signaling from the leptin receptor mediated by increased expression of Suppressor of Cytokine signaling 3 (SOCS3) (Bjorbaek

et al., 1998; Howard et al., 2004; Liu et al., 2011; Mori et al., 2004)

or other effects on cellular signaling pathways

Leptin binding to its receptor stimulates Janus kinase 2 (JAK2)

to phosphorylate tyrosine residues on the receptor This phosphory-lation provides docking sites for proteins containing Src homology domains, like Signal Transducer and Activator of Transcription 3 (STAT3) (Ghilardi et al., 1996) Phosphorylated STAT3 dimerizes and translocates to the nucleus, where it binds the STAT3 response element and induces transcription of the appetite-suppressant POMC (Munzberg et al., 2003), the negative feedback regulator SOCS3 (Banks et al., 2000), and additional genes related to cell growth and apoptosis SOCS3 inhibits leptin signaling by interacting directly with the phosphorylated leptin receptor (Bjorbak et al., 2000) and with JAK2 (Sasaki et al., 2000)

In an effort to identify unknown genes involved in regulating the leptin signaling pathway, we took advantage of the fact that leptin-induced STAT3-response element driven luciferase production can serve as a proxy for leptin signaling We generated a HEK293 cell line expressing the leptin receptor and a STAT3-response element fused to a luciferase reporter This cell line was used in an auto-mated assay where we screened a library of small molecules for their ability to induce leptin dependent STAT3 activity Here, we present evidence that the cell cycle checkpoint protein Ataxia Telangiecta-sia and RAD3 related (ATR) has a previously unknown role in the negative feedback regulation of leptin signaling

Abbreviations: STAT3, signal transducer and activator of transcription 3; SOCS3,

suppressor of cytokine signaling 3; ATR, ataxia and telangiectasia RAD3-related.

* Corresponding author Bioscience, Cardiovascular and Metabolic Diseases,

AstraZeneca R&D, Pepparedsleden 1, 431 83 Mölndal, Sweden Tel.: +46 (0) 31 77

62471; fax: +46 (0) 31 77 637 92.

E-mail address:Elke.Ericson@astrazeneca.com (E Ericson).

1 Present address: Reagents and Assay Development, Discovery Sciences,

AstraZeneca R&D, Pepparedsleden 1, 431 83 Mölndal, Sweden.

http://dx.doi.org/10.1016/j.mce.2015.04.034

Contents lists available atScienceDirect

Molecular and Cellular Endocrinology

j o u r n a l h o m e p a g e : w w w e l s e v i e r c o m / l o c a t e / m c e

Trang 2

2 Materials and methods

2.1 Cell culture

The human embryonic kidney cell line HEK293 was obtained from

the American Type Culture Collection (ATCC) and maintained in

DMEM+ Glutamax-medium with 4.5 g/l D-glucose and pyruvate

(31966-021, Gibco) supplemented with 10% FBS (complete medium)

at 37 °C and 5% CO2 The stable, monoclonal cell line x2e (as

de-scribed inSection 2.2) was maintained under the same conditions,

with the addition of 2 μg/ml puromycin (ant-pr-1, InvivoGen) and

600 μg/ml geneticin (10131-019, Gibco) to the medium

2.2 Generation of the STAT3-luciferase reporter cell line

Two constructs were used to generate a stable cell line

express-ing the human leptin receptor and the STAT3 response

element-luciferase reporter

To generate the reporter gene construct, three repeats of a STAT3

response element containing the core part of the m67 sequence (TT

CCC GTA AAT) (Wagner et al., 1990) and a minimal promoter (MinP

sequence from pGL4.23, Promega) were subcloned into the BglII and

HindIII sites of pGL4.20 [luc2/puro]- vector (Promega) just

up-stream of the luc2 sequence The ﬁnal construct was conﬁrmed by

DNA sequencing (with ﬂanking vector sites in brackets, restriction

sites underlined, core m67-sequence in bold, and minP-sequence

in italics): [GGCCTAACTGGCCGGTACCTGAGCTCGCTAGCCTCGAGG

ATATCA]AGATCTGGTTCCCGTAAATGCATCAGGTTCCCGTAAATGCA

TCAGGTTCCCGTAAATGCATCAAAGCTTAGACACTAGAGGGTATATAATGGA

AGCTCGACTTCCAGCTT[GGCAATCCGGTACTGTTGGTAAAGCCACC]ATG.

When designing the leptin-receptor expressing construct, the

most common SNP variant of the human leptin receptor isoform 1

(also called isoform b) was identiﬁed as the NCBI reference

se-quence NM_002303 with a Q223R substitution A sese-quence-

sequence-veriﬁed construct where this variant of the leptin receptor had been

subcloned into the pIRESneo3 (Clontech) vector was used (made by

GeneArt, Life Technologies)

To generate a stable cell line expressing the human leptin

re-ceptor and the STAT3 response element-luciferase reporter, equal

amounts of the plasmids were co-transfected into HEK293 cells using

Lipofectamine (Invitrogen) following instructions from the

manu-facturer To select for cells that had integrated both constructs in

their genome, medium supplemented with 2 μg/ml puromycin

(ant-pr-1, InvivoGen) and 600 μg/ml geneticin (10131-019, Gibco) was

used Silicon-grease (85 403-1EA, Sigma-Aldrich)-secured cloning

cylinders (8 * 8 mm polystyrene cylinders; C3983-50EA,

Sigma-Aldrich) were placed on top of individual surviving clones After

adding accutase (A6964, Sigma) to detach the cell clones, they were

transferred to individual growth vessels and expanded The

result-ing cell lines were exposed to several tests aimed at validatresult-ing the

cell line as an appropriate model showing relevant physiological

re-sponses (seeSection 3.1) Based on the outcome of these tests, cell

line x2e was selected for subsequent work

2.3 Reporter gene assay

The luciferase assay was performed using a BioMek FXp

work-station (Beckman Coulter) contained within a sterile enclosure

(BigNeat Robotics Enclosure) and equipped with a Cytomat 6000

Incubator, a Cytomat Microplate Hotel for ambient storage of

microtiter plates, SAGIAN barcode readers, a Multidrop Combi

(ThermoScientiﬁc) with a Custom Solvent Selection Valve, liquid

han-dling pods (8-channel and 96-channel) and an EnVision plate reader

(PerkinElmer) On day 1, 2.5× 104cells per well were seeded to a

sterile 96-well microtiter plate (white, tissue-treated Culturplate,

6005680, PerkinElmer), in 90 μl assay medium ((0.5% (w/v) ﬁlter-sterilized BSA (A2153, Sigma) in Opti-MEM without phenol red (11058-021, Gibco)) followed by incubation at 37 °C and 5% CO2

On day 2, 10 μl Tris–HCl vehicle (20 mM Trizma hydrochloride, pH

8, T3069, Sigma) or recombinant human leptin (398-LP, R&D Systems, dissolved in 20 mM Trizma hydrochloride, pH 8, T3069, Sigma) was added to a ﬁnal leptin concentration of 4 nM, and the plate was re-turned to the incubator Twenty-four hours after leptin/vehicle addition, the plates were ﬁrst equilibrated to room temperature for

25 min Next, 100 μl Steadylite Plus (6016759, PerkinElmer) was dis-pensed into the wells followed by vigorous shaking After 15 min incubation at room temperature, the plates were read twice using

an EnVision reader (PerkinElmer) equipped with the EnVision Op-timized Luminescence Label containing the Luminescence Mirror Module (2100–4040, PerkinElmer) and Luminescence Filter (2100–

5180, PerkinElmer), to obtain the CPS (photon counts per second) The compound screen was performed as described earlier with the following modiﬁcations On day 1, the seeding volume was 80 μl

On day 2, 10 μl compound (or vehicle) was added for a final con-centration of 5 μM compound, followed by the addition of 10 μl leptin (or vehicle) for a final concentration of 4 nM leptin The final DMSO concentration was 0.5% (the x2e cell line tolerated up to 0.8% DMSO without losing viability as determined with the CellTiter 96 Aqueous One Solution Cell proliferation Assay, G3581, Promega) The STAT3 activity was measured 24 h after compound+/-leptin addi-tion When performing the concentration–response experiments, leptin or compound was serially diluted to achieve the well con-centrations indicated in the figures

2.4 Compounds

The structures of the ATR-inhibitors compound 6 and 12 are as

follows: Compound 6: 4-{4-[(3R)-3-methylmorpholin-4-yl]-6-[1-(methylsulfonyl)cyclopropyl]pyrimidin-2-yl}-1H-indole:

NH N

N N O

O O S

Compound 12:

4-{4-[1-(methylsulfonyl)cyclopropyl]-6-morpholin-4-ylpyrimidin-2-yl}-1H-indole:

NH N

N N O

O O S

As shown, the compounds only differ by a 3-(R) methyl group They were synthesized as described (Foote et al., 2013)

In the reporter gene assay, an internal library of small mole-cule compounds was used

2.5 Calculations and statistics; reporter gene assay

When we tested the leptin-responsiveness of the x2e cell line (Fig 1), the fold STAT3 activation was calculated as the lumines-cence read counts per second (CPS) obtained at each of the tested leptin concentrations over the CPS obtained with vehicle

Trang 3

To identify compounds that increase STAT3 activation, the

nor-malized CPS (nCPS) was obtained as follows in the presence or

absence of 4 nM leptin, respectively:

nCPS=average CPS compound average CPS vehicle

Each compound was analyzed in three biological replicates

(in-dependent experimental occasions) with two luminescence

measurements per replicate The log base 2 of the nCPS was taken

and compounds that signiﬁcantly (p< 0.005; stringent cut-off used

to pursue only the most signiﬁcant ﬁndings) increased the STAT3

activity were identiﬁed in Student’s t-test comparing the log nCPS

values obtained in the presence of compound to the log nCPS values

obtained in the absence of compound

2.6 siRNA transfection

siRNAs against the human versions of LEPR (s224011),

STAT3 (s744), SOCS3 (s17190 and s17191), ATR (s536 and s56825)

(Life Technologies), or negative (scrambled) control siRNA #1 (cat

no 4390843, Life Technologies) were combined with 0.15 μl

Lipofectamine RNAiMAX (Invitrogen 13778-150) in each well of a

96-well plate After a 15–20 min pre-incubation of the

transfec-tion complexes, 2.5× 104cells were plated in 80 μl assay medium

(Section 2.3) to a ﬁnal siRNA concentration of 10 nM, and the plate

was carefully mixed before incubation at 37 °C, 5% CO2 The effects

of the knockdown were assessed 48 h after transfection, using the

reporter gene assay (Section 2.3) or qPCR (Section 2.7)

2.7 Quantitative real-time PCR (qPCR)

RNA was extracted in 96-well format using the ABI Prism 6100

Nucleic Acid PrepStation (Applied Biosystems) following the

in-structions from the supplier for the RNA cell method with DNase wash

after ﬁrst adding an additional 50 μl nucleic acid puriﬁcation lysis

solution to each well of the 96-well plate (4305895, Applied

Biosystems, mixed 1:1 with PBS as described by the

manufactur-er) Total RNA (~600 ng) was transcribed using the High Capacity

cDNA Reverse Transcription kit (4368813, Life Technologies) The

cDNA was diluted 10-fold, and 3 μl was used in a total qPCR reac-tion volume of 10 μl

The following validated gene expression assays from Life Technologies were used to measure the mRNA expression level of the indicated genes: Hs00374280_m1 for STAT3, Hs00174497_m1 for LEPR, Hs00985639_m1 for IL-6, Hs00174103_m1 for IL-8, Hs01013996_m1 for STAT1, Hs00967506_m1 for CHK1, Hs01922614_s1 for S1PR1, and Hs00236877_m1 for IGFBP1 The fol-lowing primers against the human genes were used: SOCS3 (NM_003955), forward 5′-GAC CAG CGC CAC TTC TTC AC-3′, reverse 5′-CTG GAT GCG CAG GTT CTTG, and RPLP0 (36B4, NM_001002.3, used as normalization control): forward 5′-CCA TTC TAT CAT CAA CGG GTA CAA-3′, reverse 5′-AGC AAG TGG GAA GGT GTA ATCC-3′ The SOCS3 FAM-labeled probe sequence was 5′-CTC AGC GTC AAG ACC CAG TCT GGGA-3′

The qPCR was performed in 384-well format using the Applied Biosystems 7900HT instrument or the Quantstudio 7 Flex instru-ment (Life Technologies) and Power SYBR Green PCR Master mix (4367659, Life Technologies) for RPLP0, and TaqMan®Gene Expres-sion Master Mix containing the FAM-dye reporter (Life Technologies, 4369542) for the remaining genes Data were analyzed using the software SDS 2.3 with the large ribosomal gene P0 (RPLP0) as the internal control For information on the number of replicates used, see the ﬁgure legends

3 Results

3.1 Generation and validation of a stable cell for compound screening

To identify potential novel genes inﬂuencing leptin-induced STAT3-activation, we generated stable, monoclonal human embry-onic kidney (HEK293) cell lines expressing the leptin receptor as well as the luciferase enzyme under the control of a STAT3 re-sponse element (for details, seeSection 2.2) The resulting cell lines were exposed to several tests with the aim to identify an appro-priate cell model responding in a physiologically relevant way We required:

(a) a low baseline signal in the reporter gene assay with limited LEPR expression change as compared to wildtype HEK293 cells (reducing the risk for any potential adverse effect on signal-ing pathways that overexpression may have), and

(b) a suﬃciently large leptin-induced reporter gene assay window, enabling the set-up of a robust assay, and

(c) the expected response (as will be described later) in the re-porter gene assay after knocking down leptin pathway components

Based on the outcome of these tests, cell line x2e was selected for subsequent work When tested using an assay medium reduced for serum and thereby leptin (Section 2.3), this cell line had a low baseline signal in the reporter gene assay, accompanied by a 25-fold increase in median LEPR mRNA expression over wildtype HEK293 cells (Supplementary Fig S1) Because the expression change introduced in clonal cell lines is often as high as 300- to 500-fold, the x2e LEPR overexpression can be considered small Impor-tantly, the selected cell line responded in a dose-dependent manner

to leptin with a 5-fold increase in STAT3-signaling (Fig 1) For further validation of the cell line, we performed knockdown experiments using siRNAs against transcripts for human genes with known roles

in leptin signaling As expected, knockdown of the leptin receptor

or of STAT3 decreased the STAT3-driven reporter gene signal rela-tive to using a scrambled control siRNA, while knockdown of the negative feedback regulator SOCS3 increased STAT3 activation (Fig 2A) The changes in STAT3-activity were accompanied by a

log10 M leptin

0

2

4

6

Fig 1 The stable monoclonal HEK293 cell line responds to leptin in a

dose-dependent manner The fold STAT3-activation at the indicated leptin dose as compared

to vehicle, with 12 nM (log10 M of –7.9) as the highest tested concentration,

dilut-ing 3-fold The standard deviation obtained with three biological replicates

(independent occasions) is indicated Curve ﬁtting was done using GraphPad Prism,

and the EC50 for leptin was 0.3 nM The dotted line indicates the selected leptin

con-centration for the compound screen (4 nM; log10 M of –8.4).

Trang 4

signiﬁcant reduction in remaining mRNA-expression for the

tar-geted genes as measured by quantitative PCR (Fig 2B) The

knockdown eﬃciency was highest with siRNA 1 against SOCS3 (19%

remaining SOCS3 mRNA) and lowest with siRNA against the

overexpressed LEPR (68% remaining LEPR mRNA) (Fig 2B) No STAT3

activation was seen in the absence of leptin with any of the siRNAs

(data not shown) Taken together, these ﬁndings demonstrate that

the x2e cell line responds in a physiologically relevant and

ex-pected way to perturbations in the leptin signaling pathway, and

therefore qualiﬁes as an appropriate model for this work

3.2 The reporter gene assay compound screen suggested a novel

regulator of leptin signaling

After conﬁrming the amenability of using the reporter cell line

to identify genes inﬂuencing leptin-mediated STAT3 signaling, we

screened an internal library of proprietary small molecule

com-pounds with the aim to identify proteins that when inhibited would

increase STAT3-signaling The compound screen was run at 5 μM

with and without the addition of 4 nM leptin Normalization and

statistical calculations were performed as described inSection 2.5

Brieﬂy, we calculated the normalized counts per second (nCPS) as

the average luciferase signal obtained with treatment over that

ob-tained with vehicle Data pertaining to the addition or omission of

leptin were calculated separately Thus, the nCPS represents the

compound-mediated fold increase in STAT3 activity over vehicle,

either in the presence or absence of leptin

Of the compounds that signiﬁcantly (p< 0.005) inﬂuenced the

STAT3-response in the presence of 4 nM leptin, an antagonist to

Ataxia Telangiectasia Rad3-related kinase (ATR) stood out because

of its pronounced augmentation of leptin-induced STAT3

activa-tion The structure of this compound has been disclosed (compound

12 inFoote et al (2013))

ATR is known as a master regulator of the DNA damage

re-sponse together with the Ataxia Telangiectasia Mutated protein ATM

(Cimprich and Cortez, 2008) It controls and co-ordinates DNA

rep-lication origin ﬁring, reprep-lication fork stability, and cell cycle

checkpoints ATR responds to a wide range of DNA damage and

rep-lication interference, including the occurrence of single-stranded

DNA, cancer chemotherapies, and DNA cross links (Kim et al., 2011;

Yang et al., 2012) When triggered, ATR phosphorylates several

substrates including Chk1, which in turn triggers the activation of additional proteins involved in DNA damage responses and repair ATR has not been described in the context of leptin signaling before

3.3 Conﬁrming a dose-dependent, ATR-speciﬁc compound response

in the reporter gene assay

In an effort to validate ATR as a top hit from the compound screen,

we exposed the x2e cell line to an additional ATR inhibitor, com-pound 6 (Foote et al., 2013) To obtain EC50-values for the STAT3-induction as measured in the reporter gene assays, we performed dose–response experiments in the presence and absence of 4 nM leptin A correlation between compound concentration and the level

of STAT3-activation was observed after inhibiting ATR both with com-pound 12 (Fig 3A) and with compound 6 (Fig 3B) In the presence

of leptin, the STAT3-activation was increased (Fig 3)

To further build conﬁdence in engagement of the intended target,

we exposed our cell line to an inhibitor of Checkpoint Kinase 1 (CHK1) downstream of ATR; AZD7762 (Zabludoff et al., 2008) With AZD7762 we also observed a dose-dependent activation of STAT3, albeit lower than that seen with the ATR inhibitors (Supplementary Fig S2A) This suggests that Chk1 may be involved in the in-creased STAT3-activation observed following ATR inhibition Compound 6 was more potent than compound 12 in phosphory-lating Chk1 in colorectal adenocarcinoma cells (Foote et al., 2013) While treatment of the cells with compound 6 caused a higher maximum STAT3-activation in the reporter gene assay (nCPS of 98

vs 60 in the presence of leptin, and nCPS of 30 vs 20 in the absence

of leptin;Fig 3), the compound-mediated fold increase in signal was similar for the two compounds The EC50-values only indicated a small difference in potency, with compound 6 being about two-fold more potent than compound 12 in both the basal and stimulated conditions (Fig 3)

Compounds 6 and 12 were developed from an mTOR-assay screening hit in repeated SAR-studies, where the activity against mTOR was reduced by chemical substitutions (Foote et al., 2013) The synthesized compounds were extensively tested for their po-tential activity on other targets besides ATR When probed against

a panel of 442 kinases, compound 6 reduced the activity with>50%

of only two other kinases besides ATR; mTOR and PI3Kα Com-pound 6 was less potent against these kinases than comCom-pound 12

STA T3 si N

LEPR si N

SO C

3si RNA 1

S

CS3 siR NA 2

Con

trol R A 0.0

0.5 1.0 1.5 2.0 2.5

STA T3 si N LEPR

siRN A

SO C

3si N 1

SO C

3si NA 2

0 10 20 30 40 50 60 70 80 90 100

* *

*

STAT3 activation (nCPS) Targeted mRNA (% of ctrl)

Fig 2 siRNA-mediated knockdown of genes affected STAT3 activity in the expected way Knockdown of STAT3 or the leptin receptor (LEPR) reduced the STAT3 response,

while knockdown of the negative feedback regulator SOCS3 increased the response as measured by the reporter gene assay (A) The change in STAT3-expression was ac-companied by a varying knockdown eﬃciency for the different genes as measured by quantitative PCR, resulting in 19–68% remaining mRNA-expression for the targeted genes (B) (A) Fold change in STAT3 activation (nCPS) 2 days after transfecting HEK cells with siRNA s744 against STAT3, s224011 against LEPR, s17190 (siRNA1) or s17191 (siRNA2) against SOCS3 and non-targeting control siRNA (B) The remaining expression level of each of the targeted genes after knockdown with the indicated siRNAs at

48 h after transfecting the cells as compared to transfecting with scrambled control siRNA The standard deviation of 12 replicates (3 biological * 4 technical) is shown, and the expression levels were normalized to those of RPLP0 before calculating the percent remaining mRNA *Statistically signiﬁcant reduced (STAT3, LEPR) or increased (SOCS3) STAT3 activation (p < 0.05) in (A), and signiﬁcantly reduced mRNA expression (p < 0.05) as compared to the expression seen in control cells transfected with scrambled siRNA (B).

Trang 5

(mTOR cell IC50 of 2.4 μM vs 0.18 μM for compound 12, and PI3Kα

cell IC50 of>30 μM vs 0.94 μM for compound 12) (Foote et al., 2013)

The observation that compound 6 was not active on PI3Kα even at

the highest tested concentration suggested that the increase in

STAT3-activity observed with the ATR-inhibitors was not

medi-ated by an off-target effect on PI3Kα In contrast, the low mTOR

IC50-value reported for both compounds 6 and 12 necessitated further

investigation We therefore examined the potential effect on STAT3

activation of the highly selective mTOR-inhibitor Ku-0063794

(Garcia-Martinez et al., 2009) Independent of whether leptin was

present or not, a slight decrease rather than an increase in

STAT3-signaling was observed with Ku-0063794 (Supplementary Fig S2B)

Thus, the increase in STAT3-signaling mediated by ATR-inhibitors

compounds 6 and 12 cannot be explained by an inhibitory

off-target effect of these compounds on mTOR

3.4 Using an siRNA-approach to conﬁrm a role of ATR in

leptin signaling

To further investigate the speciﬁcity of the ATR inhibitors, we

used siRNAs against the ATR transcript As expected, knockdown

of ATR decreased ATR mRNA levels (Fig 4A) and signiﬁcantly

(p< 0.05) increased the STAT3 activation in the presence of 4 nM

leptin (Fig 4B) In the absence of leptin, knockdown of ATR did not

affect STAT3-activation (data not shown) Thus, our data suggest that

ATR is a novel negative regulator of leptin-mediated STAT3-signaling

3.5 The ATR-inhibitors stimulate leptin-dependent STAT3-signaling

by preventing the expression of SOCS3

Having conﬁrmed that ATR inﬂuences STAT3-activation in a leptin-dependent manner by using compounds and siRNAs di-rected against ATR, we next explored by what mechanism ATR causes this effect We hypothesized that ATR may stimulate the expres-sion or prevent the degradation of the known negative feedback regulator SOCS3 If this was correct, we would expect inhibition of ATR to reduce SOCS3 levels in the presence of leptin To test this,

we exposed the cells for 30 minutes to ATR inhibitors compounds

6 and 12 in the presence or absence of leptin In agreement with our hypothesis, ATR was required for normal SOCS3-induction in response to leptin (Fig 5) Interestingly, the quantitative PCR data also suggested that ATR has a leptin-independent role in maintain-ing a baseline expression of SOCS3 (Fig 5)

In an effort to explore the speciﬁcity of the SOCS3-expression change, we investigated whether additional STAT3-regulated genes besides SOCS3 change in expression following ATR inhibition Based

on literature evidence, interleukin 6 (IL-6), interleukin 8 (IL-8), insulin growth factor binding protein 1 (IGFBP1) and the spingosine-1-phosphate receptor S1PR1 all have the ability to activate STAT3-signaling (Dauer et al., 2005; Fu et al., 2015; Lee et al., 2010; Leu

et al., 2001; Leung-Pineda et al., 2006), and were tested for any potential expression change following ATR inhibition In addition,

we measured the expression of signal transducer and activator of

0 20 40 60

4 nM leptin

log10 M Compound 12

0 20 40 60 80

100

0 nM leptin

4 nM leptin

log10 M Compound 6

STAT 3activation (nCPS) STAT3 activation (nCPS)

Fig 3 STAT3-activaton following 24 h exposure to two ATR inhibitors in the presence and absence of leptin The concentration (log10 M) of the ATR- inhibitors compound

12 (A) and compound 6 (B) plotted against the average STAT3 fold change (nCPS) with the standard deviation of three biological replicates (independent occasions) indi-cated The log10 M EC50-values obtained in the absence and presence of leptin were −5.57 and −5.60 respectively for compound 12 (A), and −5.92 and −5.97 for compound

6 (B) Curve ﬁtting including retrieval of EC50-values was done using GraphPad Prism.

ATR s536 ATR s56825 Control siRNA 0.0

0.5 1.0 1.5 2.0

0 10 20 30 40 50 60

Fig 4 Knockdown of ATR resulted in an increased STAT3 activity Knockdown of ATR reduced the ATR mRNA levels (A) and increased the luciferase response (B) (A) The

expression of ATR (relative to the internal reference gene) 48 h after transfecting with the indicated siRNAs against ATR, shown as percent mRNA expression as compared

to when transfecting with scrambled control siRNA The standard deviation of 12 replicates (3 biological * 4 technical) is shown, and * indicates statistically signiﬁcant STAT3 activation (p < 0.05) (B) The fold change in Signal Transducer and Activator of Transcription 3 (STAT3) activation (nCPS) 1 day after exposing the cells to 4 nM leptin and 2 days after transfecting the cells with two different siRNAs against ATR, or with scrambled control siRNA STAT3 was not activated in the absence of leptin with any of the siRNAs (data not shown).

Trang 6

transcription 1 (STAT1), which can be repressed by STAT3 (Dauer

et al., 2005) In this case, we hypothesized that the increased

STAT3-activity observed with the ATR-inhibitors may potentiate

the repression of STAT1 The expression of each of the selected

genes was measured using the same experimental set-up as in

Fig 5 All the tested genes were expressed at low or undetectable

levels, and their expression was not affected when inhibiting ATR

with compound (~Ct of 34 for IL6, 33 for IL8, 30 for STAT1, 33 for

S1PR1, and undetectable for IGFBP1, with corresponding Ct’s of

the housekeeping gene RPLP0 of 18) While the absence of effect

in the tested genes suggests that the observed SOCS3 expression

change is not accompanied by a general expression change in

genes known to inﬂuence STAT3-signaling, a more comprehensive

genome-wide expression study would be needed to gain a deeper

understanding of all potential transcriptional effects caused by

ATR inhibition

Finally, we performed a qPCR analysis to conﬁrm that the ATR

target Chk1 was not abnormally expressed in the x2e cell line Indeed,

the expression level was low and not affected by inhibition of ATR

(data not shown) The absence of effect on CHK1 mRNA levels

fol-lowing ATR inhibition was expected, since ATR regulates CHK1 on

a post-translational level (Leung-Pineda et al., 2006)

Taken together, the reduced expression level of the negative

feedback regulator SOCS3 resulting from ATR inhibition likely

explains the increase in STAT3 activation observed in the reporter

gene assay

4 Discussion

Because of the central role for leptin in energy homeostasis and

body weight control, a detailed understanding of leptin signaling

and its regulation is important Previous studies have focused on

further exploring the roles of proteins already known to inﬂuence

this pathway, for example by showing that SOCS3 acts as a

negative feedback regulator not only in the hypothalamus, but also

in skeletal muscle (Yang et al., 2012) Other studies have

exam-ined the effect of a speciﬁc agent on leptin signaling, for example

by revealing that an extract from tea, teasaponin, enhances the an-orexigenic effect of central leptin administration (Yu et al., 2013) Instead, we took a “black box approach” and looked for novel modu-lators of leptin signaling Toward this aim, we constructed a human embryonic kidney (HEK293) cell line that reports changes in STAT3 activation downstream of leptin, and screened an internal library

of small molecules HEK cells have previously proved useful as a model cell line within neurological research, for example in a study

of K+channels in neurological disease, where all required cellular regulatory pathways were present (Moha ou Maati et al., 2011) Sim-ilarly, the HEK293 cells used here expressed the leptin receptor endogenously (Supplementary Fig S1), and responded in the ex-pected way when components of the leptin signaling pathway were knocked down (Fig 2A) The neuronal features observed in HEK293 cells are thought to be a result of the preferential transformation

by human adenovirus of cells with neuronal origin over those with kidney origin when the HEK293 cells were derived (Shaw et al.,

2002)

To the best of our knowledge, these data are the ﬁrst to dem-onstrate that ATR inﬂuences signaling mediated by leptin ATR has previously mainly been studied in the context of regulating the cel-lular responses to cell cycle perturbation and DNA damage (Cimprich and Cortez, 2008) ATR signaling can lead to G2/M arrest, allowing time for DNA repair When ATR is inhibited in cancer cells, cell cycle arrest is compromised, and accumulation of faulty DNA

eventual-ly causes cancer cells to go through apoptosis ATR has a crucial role also in the absence of DNA damage, and the fact that it is essential for survival suggests that replication stress (such as the stress ex-perienced by replication forks traveling through DNA-sequences with lesions) may be the most common signal to trigger ATR activity (Nam and Cortez, 2011) In our experiments, no reduction in cell viabil-ity was seen after ATR inhibition (data not shown) Apparently, the remaining amount of ATR activity was suﬃcient to support normal growth at least for the duration of our assay Taken together, the inhibitory effects of ATR on leptin signaling described in this paper are not readily explained by any of the known roles of ATR In ad-dition, none of the described functions of ATR have been reported

as leptin dependent

When we conﬁrmed the effect of the ATR inhibitors with siRNA, knockdown resulted in a much smaller STAT3-activation than when small molecule inhibitors were used (compare the nCPS values in

Fig 4Bwith those inFig 3) Possible explanations for this include the incomplete silencing mediated by the siRNAs (Fig 2B) or an in-suﬃcient rate of ATR protein turnover, perhaps in combination with

a time-dependency of the effect To explore the impact of the time factor, we performed additional quantitative PCR experiments The inhibitory effect on SOCS3-induction seen after 30 min (Fig 5) was

no longer observed after 24 h, likely explaining why SOCS3 expres-sion changes could not be detected following 48 h knockdown with siRNA against ATR (data not shown) This suggests that the ATR-mediated prevention of SOCS3-induction is rapid and transient We believe that the STAT-3 activation following ATR inhibition in the

24 h reporter gene assay is still reﬂective of this transient and drastic reduction in the negative feedback protein SOCS3 The large amount

of activated STAT3 boosts the expression levels of the luc2 lucifer-ase reporter, which is a stabilized protein fully functional as an enzyme when the luciferase reaction is started following 24 h exposure to compound Our data suggest that a drastic compound-induced in-hibition of ATR causes the large effects on SOCS3-expression levels (Fig 5), driving the hugely increased STAT3-activation observed with compound (Fig 3) as opposed to the smaller STAT3-activation seen with siRNA (Fig 2) These rapid expression changes need to be further investigated and if necessary taken into account when exploring dif-ferent therapeutic strategies

As shown inFig 3, the ATR-inhibitors also slightly increased the basal leptin-independent STAT3-signaling in a dose dependent way,

0.0000

0.0001

0.0002

0.0003

0.0004

0.0005

No leptin Leptin

Control

Fig 5 ATR inhibition prevents leptin-induced SOCS3-expression In the absence of

compound, 30 min exposure to leptin resulted in an increased SOCS3 expression

(“Control”) A 30 min treatment with ATR inhibitors compound 12 (3.4 μM ) or

com-pound 6 (1.2 μM) abolished the leptin-induced increase in SOCS3-mRNA expression

seen in the absence of compound The average relative expression as compared to

RPLP0 of 12 replicates (4 biological and 3 technical) and the standard deviation is

shown *Statistically signiﬁcant repression in SOCS3 expression as compared to the

control condition in the absence of leptin (p < 0.005), while ** indicates

statistical-ly signiﬁcant repression in SOCS3 expression as compared to the control condition

in the presence of leptin (p < 0.005).

Trang 7

with a similar EC50 as when leptin was present A likely reason for

this is that ATR is involved in a mechanism that maintains a basal

level of SOCS3 If so, we would expect the SOCS3 mRNA

expres-sion levels to decrease also in the non-stimulated condition upon

exposure to an ATR inhibitor This is exactly what we found (Fig 5),

which is in agreement with the small effect on STAT3-signaling

re-vealed in the absence of leptin in the reporter gene assay (Fig 3)

Importantly however, much more pronounced effects on

STAT3-signaling and SOCS3-expression were mediated in the presence of

leptin

To conclude, we identiﬁed a novel role of the checkpoint kinase

ATR in leptin signaling Cells exposed to ATR inhibitors showed

reduced basal levels of the negative feedback mediator SOCS3, and

failed to induce SOCS3 in response to leptin, leading to an

in-creased STAT3-signaling Obese individuals usually do not respond

to increased circulating levels of leptin (Frederich et al., 1995),

perhaps due to increased expression of SOCS3 (Bjorbaek et al., 1998;

Howard et al., 2004; Liu et al., 2011; Mori et al., 2004) Therefore

our ﬁnding that inhibition of ATR leads to decreased SOCS3

ex-pression may prove useful in development of new treatments within

obesity While additional experiments are required to understand

the details of how ATR and SOCS3 interact, our observation opens

up possibilities to explore the potential use of ATR inhibitors in

anti-obesity treatment

Acknowledgements

This study was funded by AstraZeneca Research &

Develop-ment Thanks to Anudharan Balendran for contributing to starting

up this project, Barbro Basta for performing cloning work and

de-signing primers for the qPCR experiments, Karin Nelander for input

on the statistics, Elisabeth Nyman for identifying the most common

sequence of the human leptin receptor isoform 1, Paul Wan, Arjan

Snijder, Niklas Larsson and other colleagues for providing

valu-able input to the manuscript, and Kevin Foote for helpful information

regarding the development of the ATR inhibitors

Appendix

The most common sequence of the human leptin receptor isoform

1, used in this work, was as follows:

NheI – BamHI human LEPR (223R) gene sequence in pIRES Neo3:

gctagcGCCACCATGATTTGTCAAAAATTCTGTGTGGTTTTGTTACATTGGG

AATTTATTTATGTGATAACTGCGTTTAACTTGTCATATCCAATTACTCCTTG

GAGATTTAAGTTGTCTTGCATGCCACCAAATTCAACCTATGACTACTTCCTT

TTGCCTGCTGGACTCTCAAAGAATACTTCAAATTCGAATGGACATTATGAG

ACAGCTGTTGAACCTAAGTTTAATTCAAGTGGTACTCACTTTTCTAACTTAT

CCAAAACAACTTTCCACTGTTGCTTTCGGAGTGAGCAAGATAGAAACTGC

TCCTTATGTGCAGACAACATTGAAGGAAAGACATTTGTTTCAACAGTAAA

TTCTTTAGTTTTTCAACAAATAGATGCAAACTGGAACATACAGTGCTGGCT

AAAAGGAGACTTAAAATTATTCATCTGTTATGTGGAGTCATTATTTAAGAA

TCTATTCAGGAATTATAACTATAAGGTCCATCTTTTATATGTTCTGCCTGAA

GTGTTAGAAGATTCACCTCTGGTTCCCCAAAAAGGCAGTTTTCAGATGGTT

CACTGCAATTGCAGTGTTCATGAATGTTGTGAATGTCTTGTGCCTGTGCCA

ACAGCCAAACTCAACGACACTCTCCTTATGTGTTTGAAAATCACATCTGGT

GGAGTAATTTTCCGGTCACCTCTAATGTCAGTTCAGCCCATAAATATGGTG

AAGCCTGATCCACCATTAGGTTTGCATATGGAAATCACAGATGATGGTAA

TTTAAAGATTTCTTGGTCCAGCCCACCATTGGTACCATTTCCACTTCAATAT

CAAGTGAAATATTCAGAGAATTCTACAACAGTTATCAGAGAAGCTGACAA

GATTGTCTCAGCTACATCCCTGCTAGTAGACAGTATACTTCCTGGGTCTTC

GTATGAGGTTCAGGTGAGGGGCAAGAGACTGGATGGCCCAGGAATCTGG

AGTGACTGGAGTACTCCTCGTGTCTTTACCACACAAGATGTCATATACTTTC

CACCTAAAATTCTGACAAGTGTTGGGTCTAATGTTTCTTTTCACTGCATCTA

TAAGAAGGAAAACAAGATTGTTCCCTCAAAAGAGATTGTTTGGTGGATGA

ATTTAGCTGAGAAAATTCCTCAAAGCCAGTATGATGTTGTGAGTGATCATG

TTAGCAAAGTTACTTTTTTCAATCTGAATGAAACCAAACCTCGAGGAAAG

TTTACCTATGATGCAGTGTACTGCTGCAATGAACATGAATGCCATCATCGC TATGCTGAATTATATGTGATTGATGTCAATATCAATATCTCATGTGAAACTG ATGGGTACTTAACTAAAATGACTTGCAGATGGTCAACCAGTACAATCCAGT CACTTGCGGAAAGCACTTTGCAATTGAGGTATCATAGGAGCAGCCTTTACT GTTCTGATATTCCATCTATTCATCCCATATCTGAGCCCAAAGATTGCTATTTG CAGAGTGATGGTTTTTATGAATGCATTTTCCAGCCAATCTTCCTATTATCTG GCTACACAATGTGGATTAGGATCAATCACTCTCTAGGTTCACTTGACTCTCC ACCAACATGTGTCCTTCCTGATTCTGTGGTGAAGCCACTGCCTCCATCCAG TGTGAAAGCAGAAATTACTATAAACATTGGATTATTGAAAATATCTTGGG AAAAGCCAGTCTTTCCAGAGAATAACCTTCAATTCCAGATTCGCTATGGTTT AAGTGGAAAAGAAGTACAATGGAAGATGTATGAGGTTTATGATGCAAAAT CAAAATCTGTCAGTCTCCCAGTTCCAGACTTGTGTGCAGTCTATGCTGTTCA GGTGCGCTGTAAGAGGCTAGATGGACTGGGATATTGGAGTAATTGGAGC AATCCAGCCTACACAGTTGTCATGGATATAAAAGTTCCTATGAGAGGACCT GAATTTTGGAGAATAATTAATGGAGATACTATGAAAAAGGAGAAAAATGT CACTTTACTTTGGAAGCCCCTGATGAAAAATGACTCATTGTGCAGTGTTCA GAGATATGTGATAAACCATCATACTTCCTGCAATGGAACATGGTCAGAAG ATGTGGGAAATCACACGAAATTCACTTTCCTGTGGACAGAGCAAGCACAT ACTGTTACGGTTCTGGCCATCAATTCAATTGGTGCTTCTGTTGCAAATTTTA ATTTAACCTTTTCATGGCCTATGAGCAAAGTAAATATCGTGCAGTCACTCA GTGCTTATCCTTTAAACAGCAGTTGTGTGATTGTTTCCTGGATACTATCACC CAGTGATTACAAGCTAATGTATTTTATTATTGAGTGGAAAAATCTTAATGAA GATGGTGAAATAAAATGGCTTAGAATCTCTTCATCTGTTAAGAAGTATTAT ATCCATGATCATTTTATCCCCATTGAGAAGTACCAGTTCAGTCTTTACCCAA TATTTATGGAAGGAGTGGGAAAACCAAAGATAATTAATAGTTTCACTCAA GATGATATTGAAAAACACCAGAGTGATGCAGGTTTATATGTAATTGTGCCA GTAATTATTTCCTCTTCCATCTTATTGCTTGGAACATTATTAATATCACACCA AAGAATGAAAAAGCTATTTTGGGAAGATGTTCCGAACCCCAAGAATTGTT CCTGGGCACAAGGACTTAATTTTCAGAAGCCAGAAACGTTTGAGCATCTTT TTATCAAGCATACAGCATCAGTGACATGTGGTCCTCTTCTTTTGGAGCCTG AAACAATTTCAGAAGATATCAGTGTTGATACATCATGGAAAAATAAAGAT GAGATGATGCCAACAACTGTGGTCTCTCTACTTTCAACAACAGATCTTGAA AAGGGTTCTGTTTGTATTAGTGACCAGTTCAACAGTGTTAACTTCTCTGAGG CTGAGGGTACTGAGGTAACCTATGAGGACGAAAGCCAGAGACAACCCTTT GTTAAATACGCCACGCTGATCAGCAACTCTAAACCAAGTGAAACTGGTGAA GAACAAGGGCTTATAAATAGTTCAGTCACCAAGTGCTTCTCTAGCAAAAA TTCTCCGTTGAAGGATTCTTTCTCTAATAGCTCATGGGAGATAGAGGCCCA GGCATTTTTTATATTATCAGATCAGCATCCCAACATAATTTCACCACACCTC ACATTCTCAGAAGGATTGGATGAACTTTTGAAATTGGAGGGAAATTTCCCT GAAGAAAATAATGATAAAAAGTCTATCTATTATTTAGGGGTCACCTCAATC AAAAAGAGAGAGAGTGGTGTGCTTTTGACTGACAAGTCAAGGGTATCGTG CCCATTCCCAGCCCCCTGTTTATTCACGGACATCAGAGTTCTCCAGGACAG TTGCTCACACTTTGTAGAAAATAATATCAACTTAGGAACTTCTAGTAAGAA GACTTTTGCATCTTACATGCCTCAATTCCAAACTTGTTCTACTCAGACTCAT AAGATCATGGAAAACAAGATGTGTGACCTAACTGTGTAAggatcc

Appendix: Supplementary material

Supplementary data to this article can be found online at

doi:10.1016/j.mce.2015.04.034

References

Banks, A.S., Davis, S.M., Bates, S.H., Myers, M.G., Jr., 2000 Activation of downstream signals by the long form of the leptin receptor J Biol Chem 275 (19), 14563– 14572.

Banks, W.A., 2004 The many lives of leptin Peptides 25 (3), 331–338.

Bjorbaek, C., Elmquist, J.K., Frantz, J.D., Shoelson, S.E., Flier, J.S., 1998 Identiﬁcation

of SOCS-3 as a potential mediator of central leptin resistance Mol Cell 1 (4), 619–625.

Bjorbak, C., Lavery, H.J., Bates, S.H., Olson, R.K., Davis, S.M., Flier, J.S., et al., 2000 SOCS3 mediates feedback inhibition of the leptin receptor via Tyr985 J Biol Chem 275 (51), 40649–40657.

Cimprich, K.A., Cortez, D., 2008 ATR: an essential regulator of genome integrity Nat Rev Mol Cell Biol 9 (8), 616–627.

Cowley, M.A., Smart, J.L., Rubinstein, M., Cerdan, M.G., Diano, S., Horvath, T.L., et al.,

2001 Leptin activates anorexigenic POMC neurons through a neural network

in the arcuate nucleus Nature 411 (6836), 480–484.

Trang 8

Dauer, D.J., Ferraro, B., Song, L., Yu, B., Mora, L., Buettner, R., et al., 2005 Stat3 regulates

genes common to both wound healing and cancer Oncogene 24 (21), 3397–3408.

Foote, K.M., Blades, K., Cronin, A., Fillery, S., Guichard, S.S., Hassall, L., et al., 2013.

Discovery of 4-{4-[(3R)-3-Methylmorpholin-4-yl]-6-[1-(methylsulfonyl)

cyclopropyl]pyrimidin-2-y l}-1H-indole (AZ20): a potent and selective inhibitor

of ATR protein kinase with monotherapy in vivo antitumor activity J Med Chem.

56 (5), 2125–2138.

Frederich, R.C., Hamann, A., Anderson, S., Lollmann, B., Lowell, B.B., Flier, J.S., 1995.

Leptin levels reﬂect body lipid content in mice: evidence for diet-induced

resistance to leptin action Nat Med 1 (12), 1311–1314.

Fu, X.T., Dai, Z., Song, K., Zhang, Z.J., Zhou, Z.J., Zhou, S.L., et al., 2015

Macrophage-secreted IL-8 induces epithelial-mesenchymal transition in hepatocellular

carcinoma cells by activating the JAK2/STAT3/Snail pathway Int J Oncol 46 (2),

587–596.

Garcia-Martinez, J.M., Moran, J., Clarke, R.G., Gray, A., Cosulich, S.C., Chresta, C.M.,

et al., 2009 Ku-0063794 is a speciﬁc inhibitor of the mammalian target of

rapamycin (mTOR) Biochem J 421 (1), 29–42.

Ghilardi, N., Ziegler, S., Wiestner, A., Stoffel, R., Heim, M.H., Skoda, R.C., 1996 Defective

STAT signaling by the leptin receptor in diabetic mice Proc Natl Acad Sci U.S.A.

93 (13), 6231–6235.

Harrold, J.A., Dovey, T.M., Blundell, J.E., Halford, J.C., 2012 CNS regulation of appetite.

Neuropharmacology 63 (1), 3–17.

Howard, J.K., Cave, B.J., Oksanen, L.J., Tzameli, I., Bjorbaek, C., Flier, J.S., 2004 Enhanced

leptin sensitivity and attenuation of diet-induced obesity in mice with

haploinsuﬃciency of Socs3 Nat Med 10 (7), 734–738.

Kim, Y.M., Lee, Y.M., Park, S.Y., Pyo, H., 2011 Ataxia telangiectasia and Rad3-related

overexpressing cancer cells induce prolonged G arrest and develop resistance

to ionizing radiation DNA Cell Biol 30 (4), 219–227.

Lee, H., Deng, J., Kujawski, M., Yang, C., Liu, Y., Herrmann, A., et al., 2010

STAT3-induced S1PR1 expression is crucial for persistent STAT3 activation in tumors.

Nat Med 16 (12), 1421–1428.

Leu, J.I., Crissey, M.A., Leu, J.P., Ciliberto, G., Taub, R., 2001 Interleukin-6-induced STAT3

and AP-1 amplify hepatocyte nuclear factor 1-mediated transactivation of hepatic

genes, an adaptive response to liver injury Mol Cell Biol 21 (2), 414–424.

Leung-Pineda, V., Ryan, C.E., Piwnica-Worms, H., 2006 Phosphorylation of Chk1 by

ATR is antagonized by a Chk1-regulated protein phosphatase 2A circuit Mol Cell.

Biol 26 (20), 7529–7538.

Liu, Z.J., Bian, J., Zhao, Y.L., Zhang, X., Zou, N., Li, D., 2011 Lentiviral vector-mediated

knockdown of SOCS3 in the hypothalamus protects against the development of

diet-induced obesity in rats Diabetes Obes Metab 13 (10), 885–892.

Moha ou Maati, H., Peyronnet, R., Devader, C., Veyssiere, J., Labbal, F., Gandin, C., et al.,

2011 A human TREK-1/HEK cell line: a highly eﬃcient screening tool for drug development in neurological diseases PLoS ONE 6 (10), e25602.

Mori, H., Hanada, R., Hanada, T., Aki, D., Mashima, R., Nishinakamura, H., et al., 2004 Socs3 deﬁciency in the brain elevates leptin sensitivity and confers resistance

to diet-induced obesity Nat Med 10 (7), 739–743.

Morioka, T., Asilmaz, E., Hu, J., Dishinger, J.F., Kurpad, A.J., Elias, C.F., et al., 2007 Disruption of leptin receptor expression in the pancreas directly affects beta cell growth and function in mice J Clin Invest 117 (10), 2860–2868.

Munzberg, H., Huo, L., Nillni, E.A., Hollenberg, A.N., Bjorbaek, C., 2003 Role of signal transducer and activator of transcription 3 in regulation of hypothalamic proopiomelanocortin gene expression by leptin Endocrinology 144 (5), 2121– 2131.

Nam, E.A., Cortez, D., 2011 ATR signalling: more than meeting at the fork Biochem.

J 436 (3), 527–536.

Sasaki, A., Yasukawa, H., Shouda, T., Kitamura, T., Dikic, I., Yoshimura, A., 2000 CIS3/SOCS-3 suppresses erythropoietin (EPO) signaling by binding the EPO receptor and JAK2 J Biol Chem 275 (38), 29338–29347.

Shaw, G., Morse, S., Ararat, M., Graham, F.L., 2002 Preferential transformation of human neuronal cells by human adenoviruses and the origin of HEK 293 cells FASEB J 16 (8), 869–871.

Smith, F.J., Campﬁeld, L.A., Moschera, J.A., Bailon, P.S., Burn, P., 1998 Brain administration of OB protein (leptin) inhibits neuropeptide-Y-induced feeding

in ob/ob mice Regul Pept 75–76, 433–439.

Wagner, B.J., Hayes, T.E., Hoban, C.J., Cochran, B.H., 1990 The SIF binding element confers sis/PDGF inducibility onto the c-fos promoter EMBO J 9 (13), 4477– 4484.

Yang, Z., Hulver, M., McMillan, R.P., Cai, L., Kershaw, E.E., Yu, L., et al., 2012 Regulation

of insulin and leptin signaling by muscle suppressor of cytokine signaling 3 (SOCS3) PLoS ONE 7 (10), e47493.

Yu, Y., Wu, Y., Szabo, A., Wu, Z., Wang, H., Li, D., et al., 2013 Teasaponin reduces inﬂammation and central leptin resistance in diet-induced obese male mice Endocrinology 154 (9), 3130–3140.

Zabludoff, S.D., Deng, C., Grondine, M.R., Sheehy, A.M., Ashwell, S., Caleb, B.L., et al.,

2008 AZD7762, a novel checkpoint kinase inhibitor, drives checkpoint abrogation and potentiates DNA-targeted therapies Mol Cancer Ther 7 (9), 2955– 2966.

Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., Friedman, J.M., 1994 Positional cloning of the mouse obese gene and its human homologue Nature

372 (6505), 425–432.

Định dạng
Số trang	8
Dung lượng	391,72 KB