Báo cáo khoa học: Substrate recognition and ®delity of strand joining by an archaeal DNA ligase docx

The enzyme is the only characterized ATP-depend-ent DNA ligase from a hyperthermophile, and allows the analysis of enzymatic DNA ligation reactions at tempera-tures above the melting poi

Substrate recognition and ®delity of strand joining by an archaeal DNA ligase

Masaru Nakatani1,2, Satoshi Ezaki1,2, Haruyuki Atomi1,2and Tadayuki Imanaka1,2

1 Department of Synthetic Chemistry and Biological Chemistry, Graduate School of Engineering, Kyoto University;

2 Core Research for Evolutional Science and Technology Program of Japan Science and Technology Corporation, Japan

We have previously identi®ed a DNA ligase (LigTk) from a

hyperthermophilic archaeon, Thermococcus kodakaraensis

KOD1 The enzyme is the only characterized

ATP-depend-ent DNA ligase from a hyperthermophile, and allows the

analysis of enzymatic DNA ligation reactions at

tempera-tures above the melting point of the substrates Here we have

focused on the interactions of LigTk with various DNA

substrates, and its speci®cities toward metal cations LigTk

could utilize Mg2+, Mn2+, Sr2+and Ca2+as a metal cation,

but not Co2+, Zn2+, Ni2+, or Cu2+ The enzyme displayed

typical Michaelis±Menten steady-state kinetics with an

apparent Kmof 1.4 lMfor nicked DNA The kcatvalue of the

enzyme was 0.11ás)1 Using various 3¢ hydroxyl group

donors (L-DNA) and 5¢ phosphate group donors

(R-DNA), we could detect ligation products as short as 16

nucleotides, the products of 7 + 9 nucleotide or 8 + 8

nucleotide combinations at 40 °C An elevation in

temper-ature led to a decrease in reaction eciency when short

oligonucleotides were used, suggesting that the formation of

a nicked, double-stranded DNA substrate preceded enzyme-substrate recognition LigTk was not inhibited by the addition of excess duplex DNA, implying that the enzyme did not bind strongly to the double-stranded ligation prod-uct after nick-sealing In terms of reaction ®delity, LigTkwas found to ligate various substrates with mismatched base-pairing at the 5¢ end of the nick, but did not show activity towards the 3¢ mismatched substrates LigTkcould not seal substrates with a 1-nucleotide or 2-nucleotide gap Small amounts of ligation products were detected with DNA substrates containing a single nucleotide insertion, relatively more with the 5¢ insertions The results revealed the impor-tance of proper base-pairing at the 3¢ hydroxyl side of the nick for the ligation reaction by LigTk

Keywords: archaea; DNA ligase; hyperthermophile; Thermococcus

DNA ligases (EC 6.5.1.1 and EC 6.5.1.2) are universally

found in bacteria, eukaryotes and archaea In addition, they

are also found in viruses and bacteriophages [1±5] DNA

ligases catalyse the phosphodiester bond formation between

adjacent 3¢ hydroxyl and 5¢ phosphate groups at a

single-strand break in double-single-stranded DNA [5,6] They are

essential enzymes for maintaining the integrity of the

genome during DNA replication [7], DNA excision repair

[8] and DNA recombination [9] DNA strand breaks are

commonly generated as reaction intermediates in these

events, and the sealing of these breaks depends solely on the

proper function of DNA ligase [2] Therefore DNA ligases

are indispensable enzymes in all organisms

DNA ligases fall into two groups, ATP-dependent DNA

ligases and NAD+-dependent DNA ligases, on the basis of

the required cofactor for ligase±adenylate formation [2,5,6]

ATP-dependent enzymes have been found in viruses, bacteriophages, eukaryotes, archaea and, recently, in bac-teria, whereas NAD+-dependent enzymes have been found exclusively in bacteria [2,3,5] There is high similarity among the ligases within the ATP-dependent groups [10] or NAD+-dependent groups [11,12] However, enzymes between the two groups show no similarity, with the exception of the AMP-binding site [10] It is now accepted that both ATP-dependent and NAD+-dependent DNA ligases catalyse their reactions through a common mecha-nism [13] The ligation reaction proceeds through three steps In the ®rst step, attack on ATP or NAD+by the enzyme results in release of PPi or NMN from the cofactor and formation of enzyme±adenylate through the covalent addition of AMP to the conserved AMP-binding site lysine

of the protein In the second step, the AMP is transferred from the protein to the 5¢ phosphate group of the nick on the DNA to form DNA±adenylate In the third step, the enzyme catalyses phosphodiester bond formation with concomitant release of free AMP from the DNA±adenylate [2,5,6,13]

Catalytic activity of DNA ligase is dependent on appropriate divalent cations and DNA substrates In general, DNA ligases can utilize Mg2+and several other divalent cations that belong to the fourth period of the elements [14±20] The interaction between DNA ligase and its DNA substrates has been examined from various viewpoints, such as substrate length, and activity towards substrates with gaps, mismatches, or insertions Several reports have shown that some enzymes can catalyse the

Correspondence to T Imanaka, Department of Synthetic Chemistry

and Biological Chemistry, Graduate School of Engineering, Kyoto

University, Yoshida-Honmachi, Sakyo-ku, Kyoto 606-8501, Japan.

Fax: +81 75 753 4703, Tel.: +81 75 753 5568,

E-mail: imanaka@sbchem.kyoto-u.ac.jp

Abbreviations: Lig Tk , DNA ligase from Thermococcus kodakaraensis

KOD1; L-DNA, oligonucleotide as 3¢ hydroxyl group donor;

R-DNA, oligonucleotide as 5¢ phosphate group donor; T-DNA,

complementary oligonucleotide to L-DNA and R-DNA.

Enzymes: DNA ligase (EC 6.5.1.1 and EC 6.5.1.2).

(Received 25 July 2001, revised 20 November 2001, accepted 21

November 2001)

thermophilic archaeon [3] LigTk displayed two unique

features One was that the enzyme, although belonging to

the family of ATP-dependent DNA ligases, could utilize

NAD+as a cofactor The other was the extreme

thermo-stability of LigTk: nick-sealing was observed at temperatures

up to 100 °C The thermostability of the enzyme provides a

means to examine DNA ligation reactions at temperatures

above the melting point of the DNA substrates As little is

known about DNA ligases from archaea or from

hyper-thermophiles, we have examined LigTk focusing on the

following aspects: (a) its divalent cation speci®city; (b) the

effect of temperature on the interaction between enzyme

and DNA substrate; (c) the ability of the enzyme to

discriminate gapped, inserted and mismatched ends at the

nick

M A T E R I A L S A N D M E T H O D S

Puri®cation of recombinant LigTk

The DNA ligase gene (ligTk) from T kodakaraensis KOD1

was subcloned into an expression vector, pET-21a(+)

(Novagen) [3] The resulting plasmid pET-lig was

intro-duced into Escherichia coli BL21-CodonPlus(DE3)-RIL

(Stratagene) The transformants were cultivated in Luria±

Bertani medium [28] containing 50 lgámL)1 ampicillin at

37 °C until the optical density at 660 nm reached 0.8

Isopropyl-D-thiogalactopyranoside was added at a ®nal

concentration of 1 mMto induce ligTkgene expression for

7 h

Cells were harvested by centrifugation (5000 g, 15 min,

4 °C), washed with buffer A (50 mMTris/HCl pH 7.5), and

then resuspended in buffer A The cells were disrupted by

sonication and the supernatant was obtained by

centrifu-gation (12 000 g, 30 min, 4 °C) The soluble fraction of

cell-washing with buffer B, the enzyme was eluted with a linear gradient of 0±1.0M KCl in buffer B The peak fractions containing LigTk, which eluted between 0.10 and 0.14M KCl, were concentrated by using Centricon-30 (Millipore) The enzyme solution was applied to a gel ®ltration column (Superdex 200 HR 10/30, Amersham Pharmacia Biotech) equilibrated with buffer C (50 mM Mes/KOH pH 6.0,

100 mMKCl) and eluted with the same buffer The active fractions were dialysed with buffer A and used as puri®ed LigTkin following experiments The protein concentration was determined with the Bio-Rad protein assay system with BSA as a standard

DNA substrates DNA ligase activity measurements were carried out with synthesized oligonucleotides The substrate used in most activity measurements was composed of two oligonucleo-tides (L-DNA and R-DNA) and a complementary oligonucleotide (T-DNA) A phosphate group was present

at the 5¢ terminus of R-DNA Deletions, insertions and mutations were introduced to the L-DNA(40), R-DNA(30)andT-DNA(80)when necessary.Thesequences

of the oligonucleotides are listed in Fig 1 In addition, a complete duplex DNA added to the reaction in Fig 3B consists of 50-mer DNA-A (5¢-CCACTCGACGAGC TTCTTGCCTTCACAGACGAGGACTTGGGAAGCT CACG-3¢) and 50-mer DNA-B (5¢-CGTGAGCTTCCCA AGTCCTCGTCTGTGAAGGCAAGAAGCTCGTCGA GTGG-3¢)

Radiolabelling of oligonucleotides

In the case of DNA ligase assays with labelled substrates, R-DNA was radiolabelled A nonphosphorylated R-DNA

Fig 1 Schematic representation of oligonucleotides used for DNA ligase assays The 5¢ phosphate at the nick is indicated by P The hyphens in T-DNA were inserted in the sequence solely for alignment DNA ligation reactions were performed using these oligonucleotides or their derivatives indicated in the respective ®gures.

was synthesized and phosphorylated at its 5¢ terminus using

[c-32P]ATP The oligonucleotide (10 pmol) was

phosphor-ylated and radiolabelled by incubation with 1.85 MBq

[c-32P]ATP (Amersham Pharmacia Biotech) and 10 U T4

polynucleotide kinase (MEGALABELTM, Takara Shuzo,

Kyoto, Japan) at 37 °C for 30 min The reaction product

was puri®ed by centrifugation through a CENTRI-SEP

Spin Column (Perkin-Elmer Applied Biosystems)

DNA ligase assays

Ligation activity was measured by using the DNA

sub-strates described above Unless otherwise stated, ligation

reaction mixtures (20 lL) contained 20 mM Bicine/KOH

pH 8.0, 15 mM MgCl2, 20 mM KCl, 1 mM ATP, 10 lM

L-DNA, 10 lMR-DNA, 5 lMT-DNA, and 200 nMLigTk

The enzyme and other constituents of the reaction mixture

were incubated separately at the desired temperature, and

reactions were initiated by mixing the two solutions

Standard reactions were carried out at 80 °C for 2 h or at

40 °C for 4 h The reactions were stopped by addition of

30 lL loading buffer [98% (v/v) formamide, 10 mMEDTA,

0.05% (w/v) xylene cyanol FF] and cooling in ice water The

products (12 lL) were heated at 95 °C for 3 min and then

electrophoresed on a denaturing 6% polyacrylamide/7M

urea gel Super Reading DNA Sequence PreMix Solution

(6%) (Toyobo, Osaka, Japan) and Gel-Mix Running Mate

Tris/borate/EDTA buffer (Gibco BRL) were used for

electrophoresis The gel was stained with ethidium bromide

In experiments determining the kinetic parameters of LigTk,

ligation reaction mixtures (20 lL) contained 20 mMBicine/

KOH pH 8.0, 15 mMMgCl2, 20 mMKCl, 1 mMATP, and

50 nM LigTk DNA substrate [L-DNA(40), R-DNA(30),

and T-DNA(80)] were added at various concentrations in

the range 0.5±4 lM

With radiolabelled DNA substrates, 0.1 lM L-DNA,

0.1 lM T-DNA and 0.1 lM labelled R-DNA were used

After electrophoresis, the gel was dried and labelled

oligonu-cleotides were detected by autoradiography The ligation

products were quanti®ed by densitometric analysis and

QUANTITYONEsoftware(pdi,HuntingtonStation,NY,USA)

R E S U L T S A N D D I S C U S S I O N

In our previous study, we identi®ed an ATP-dependent

DNA ligase (LigTk) from a hyperthermophilic archaeon,

T kodakaraensis KOD1 [3] It was shown that LigTkwas able to: (a) catalyse DNA nick-sealing at temperatures up to

100 °C; (b) utilize NAD+as a cofactor; and (c) form an

Fig 3 Turnover of Lig Tk The reactions were performed with nonla-belled oligonucleotides as described in Materials and methods (A) The relationship between template DNA concentration and the production

of 70-mer DNA Reaction mixtures (20 lL) containing 20 m M Bicine/ KOH pH 8.0, 15 m M MgCl 2 , 20 m M KCl, 1 m M ATP, 5 l M

L-DNA(40), 5 l M R-DNA(30), 200 n M Lig Tk and the indicated amount of T-DNA(80) were incubated at 80 °C for 2 h (B) The e€ects

of addition of excess duplex DNA on the ligation reaction Reaction mixtures (20 lL) contained 20 m M Bicine/KOH pH 8.0, 15 m M

MgCl 2 , 20 m M KCl, 1 m M ATP, 10 l M L-DNA(40), 10 l M

R-DNA(30), 5 l M T-DNA(80) and 200 n M Lig Tk , with (right side) or without (left side) excess duplex DNA The duplex DNA was a mixture

of 10 l M of 50-mer DNA-A and 10 l M of 50-mer DNA-B These mixtures were incubated at 80 °C and then the products were sampled

at 5, 15, 30, 60 and 120 min after the start of the reaction.

Fig 2 Divalent cation speci®city of Lig Tk Ligation reactions were

performed with di€erent divalent cations Reaction mixtures (20 lL)

containing 20 m M Bicine/KOH pH 8.0, 1 m M ATP, 0.1 l M

L-DNA(40), 0.1 l M T-DNA(80), 0.1 l M labelled R-DNA(30), 200 n M

Lig Tk and 15 m M of the indicated divalent cation were incubated at

80 °C for 2 h.

ligase activity of LigTk [3] Here, we substituted various

divalent metal cations for Mg2+ at a concentration of

15 mM (Fig 2) In comparison to Mg2+ (100%), LigTk

could use Mn2+(65%) and Sr2+(40%) as an alternative

cation cofactor to support ligase activity The enzyme was

less active with Ca2+(9%), whereas Co2+and Zn2+failed

to support ligation The optimal cation concentration for

Mg2+was 15 mM[3], and those for Mn2+, Sr2+and Ca2+

were 25 mM, 25 mM and 5 mM, respectively (data not

shown) As little difference was found in activity levels

between concentrations of 5 mM and 25 mM, the data in

Fig 2 accurately re¯ect the cation preference of LigTk We

observed inhibitory effects on activity only in the case of

Ca2+at concentrations above 40 mM LigTkcould not use

Ni2+and Cu2+, which have been reported not to support

activity in previously reported DNA ligases (data not

shown) [15±20] The results suggest that LigTk preferred

alkaline earth metal ions as a cation cofactor

All previously reported DNA ligases have been shown to

use Mg2+ and Mn2+ [14±20] Utilization of Ca2+ and

Co2+differ among DNA ligases It has been reported that

the enzyme from Thermus thermophilus [20] used Ca2+, but

not Co2+, that the enzymes from Chlorella virus PBCV-1

[16], Vaccinia virus [15] and M thermoautotrophicum [18]

could use Co2+, but not Ca2+, and that the enzymes from

Haemophilus in¯uenzae [17] and Aquifex aeolicus [19] could

use neither Ca2+nor Co2+ There seems to be no common

tendency among DNA ligases in terms of divalent cation

speci®city The use of Sr2+has not been examined for other

enzymes

Interaction between LigTkand DNA substrates

We have reported previously that LigTk displayed DNA

ligase activity at temperatures up to 100 °C [3] However, we

observed that the ligation reaction ceased before the

complete consumption of the substrates, raising the

possi-bility that LigTk could not turnover We addressed this

possibility by examining the ligation reaction by LigTkwith

various amounts of template DNA As shown in Fig 3A,

the amount of the ligation product produced by LigTk

depended strictly on the amount of T-DNA(80) in the

reaction mixture When T-DNA(80) was present in the

reaction mixture at a concentration of 20 lM, the substrates,

L-DNA(40) and R-DNA(30), were consumed almost

completely and ligated by 0.2 lMof LigTk The

concentra-tions of L-DNA(40) and R-DNA(30) were 5 lMeach and

considerably higher than that of LigTk, indicating that LigTk

turned over We further performed a kinetic analysis of

LigTk using various concentrations of L-DNA(40),

R-DNA(30) and T-DNA(80) as substrates The enzyme

displayed typical Michaelis±Menten steady-state kinetics

with an apparent Kmof 1.4 lMfor nicked DNA The kcat

value of the enzyme was 0.11ás)1 The Kmvalue of LigTkwas

the DNA ligases from P haloplanktis (0.0337ás ), E coli (0.0212ás)1) and T scotoductus (0.0613ás)1) [29]

We further investigated the effects of adding duplex DNA

to the reaction mixture The duplex DNA added to the reaction mixtures did not include nicks and were not complementary to any of the substrate oligonucleotides No inhibition of the ligase reaction could be observed in the presence of duplex DNA (Fig 3B) Our results support the theory that LigTkdoes not bind strongly to double-stranded DNA and therefore after joining DNA substrates, the enzyme would promptly separate from the duplex DNA produced

Length of oligonucleotides recognized as DNA substrates

We investigated the length of oligonucleotides recognized by LigTk as DNA substrates At 80 °C, LigTk could ligate oligonucleotides of nine nucleotides or more as L-DNA with an R-DNA of 30 nucleotides, and an R-DNA of eight nucleotides or more with an L-DNA of 30 nucleotides (Fig 4A,B) When we performed the same experiments at

40 °C, the enzyme could ligate L-DNA and R-DNA of six

or more nucleotides (Fig 4C) The results of Fig 4B,C indicate that an elevation in temperature led to a decrease in ligation products when 6-nucleotide or 7-nucleotide sub-strates were examined As the activity of LigTkitself is higher

at 80 °C, it is likely that formation of a nicked, duplex DNA substrate, which is temperature-dependent, is necessary for recognition by LigTk and subsequent initiation of the reaction

It has been reported that bacteriophage T7 DNA ligase, which represents one of the smallest known DNA ligases, binds asymmetrically to DNA nicks, extending 3±5 nucle-otides on the 3¢ hydroxyl side of the nick and 7±9 nucleotides on the 5¢ phosphate side [31] Nick sealing was observed for oligonucleotides of six nucleotides on the 3¢ side to those of nine nucleotides on the 5¢ side [32] The enzyme from T thermophilus could not join oligonucleo-tides of six or fewer nucleooligonucleo-tides on the 3¢ side to an oligonucleotide of nine nucleotides on the 5¢ side [32] In the case of LigTk at 40 °C, we could detect ligation products as short as 16 nucleotides, the products of a (7 + 9 nucleotide) or (eight nucleotide + 8 nucleotide) combination (Fig 4D)

We had observed previously that LigTkcould ligate DNA fragments at temperatures above their melting point [3], and the results shown above with the use of short oligonucleo-tides, con®rmed this property The former results tempted

us to speculate that LigTkcould enhance the formation and/

or stability of duplex DNA substrate at high temperature [3] However the results of this study indicate otherwise Fig 4B,C suggest that an enzyme-independent formation of

a nicked duplex DNA substrate was necessary for recog-nition by LigTk Furthermore, experiments shown in

Fig 3B indicated that LigTk did not display af®nity

towards double-stranded DNA, and deny a stabilization

effect of duplex DNA by LigTk Among the various steps in

the reaction mechanism of LigTk, we have clari®ed the

following: (a) substrate (nicked, duplex DNA) formation

precedes recognition by LigTk; (b) adenylation of the

enzyme can occur before enzyme±DNA binding [3]; and

(c) after nick-sealing, LigTk promptly detaches from the

ligation product

Effect of single base mismatches at the nick

on the ligation reaction

A mismatched base pair is structurally distinct from a matched one Therefore, a 3¢ or 5¢ mismatch at the nick may have drastic effects against the ligation reaction We investigated the effect of single base mismatches at the nick

of DNA substrates on the ligation reaction In the case of 3¢ mismatched substrates (Fig 5A), LigTkef®ciently ligated

Fig 4 Length of oligonucleotides recognized by Lig Tk as DNA substrates The oligonucleotides used in the ligation reactions are described in Fig 1 The reactions were performed with nonlabelled oligonucleotides as described in Materials and methods (A,B) Ligation of various oligonucleotides

by Lig Tk at 80 °C Reaction mixtures were incubated at 80 °C for 2 h Lengths of the oligonucleotides are indicated above the gels (C,D) Ligation

of various oligonucleotides by Lig Tk at 40 °C The reaction mixtures were incubated at 40 °C for 4 h Lengths of the oligonucleotides are indicated above the gels The bands indicated by  15-mer in (D) represent the forefront of migration during electrophoresis and correspond to all oligonucleotides of 15 bases or fewer.

Fig 5 Ligation of mismatched substrates by Lig Tk DNA substrates used in this experiment were derivatives of L-DNA(40), R-DNA(30) and T-DNA(80) The reactions were performed with labelled oligonucleotides as described in Materials and methods (A) Ligation of 3¢ matched and 3¢ mismatched substrates The substrates used are indicated at the top (B) Ligation of 5¢ matched and 5¢ mismatched substrates The substrates used are indicated at the top.

only the matched substrates LigTk was more tolerant

towards 5¢ mismatched substrates (Fig 5B) Ef®cient

liga-tion was observed with the mismatches, 5¢-T : T, 5¢-G : T,

5¢-T : G, 5¢-A : C, and 5¢-T : C These results indicated that

proper base pairing at the 3¢ side of the nick was necessary

for ef®cient ligation by LigTk

The ability to discriminate mismatched ends has been

investigated for DNA ligases from several organisms using

synthetic duplex DNA substrates containing 3¢ or 5¢

mis-matches at their nicks [15,19,23±27] LigTk could not

ef®ciently ligate 3¢ mismatched substrates and was more

tolerant towards 5¢ mismatched substrates This tendency

has been observed in all previously reported enzymes

[15,19,23,26]

Ligation of gapped or inserted DNA substrates by LigTk

One- or 2-nucleotide gapped substrates were formed by

deleting one or two nucleotides from the 3¢ side of

and H in¯uenzae [17], but not by those from Vaccinia virus [15], T thermophilus [20], A aeolicus [19] and Saccharomyces cerevisiae [25], while no ligation was detectable with 2-nucleotide gapped substrates for all enzymes [15,16,19,20,22]

As for the 1-nucleotide insert ligation, LigTk was able

to catalyse the ligation reaction under several conditions (Fig 6) However, as expected, activities were small compared to the case of matched substrates Ligation products were detected in all 5¢ insert ligations, whereas 3¢ insertions tended to inhibit the ligation reaction except when the overlapped nucleotides were identical (X ˆ Y), thereby equivalent to a 5¢ insertion A cytosine at location X also allowed the ligation reaction to proceed These results also support that the proper base pairing at the 3¢ end of the nick is important for nick-sealing by LigTk It was not clear why reaction activities were detected in the case that residue X was cytosine Ligation

of 1-nucleotide insert substrates has been partially investigated for T thermophilus and A aeolicus DNA ligases and displayed the same tendencies as LigTk [19,20] Our results with mismatched and inserted DNA substrates display the importance of proper base pairing

at the 3¢ hydroxyl side of the nick for the ligation reaction to proceed

DNA metabolism, which includes the replication, repair and recombination of DNA, has been well examined in eukaryotes and bacteria As DNA ligase plays an important role in all of these events, many studies have been performed

on the enzyme from various organisms However, in the case of archaea, knowledge on the mechanisms of DNA metabolism and the individual proteins involved, has yet to accumulate Our biochemical studies on LigTk, along with future studies of the enzyme in vivo, should contribute to a better understanding of the mechanisms of DNA metabo-lism in archaea

R E F E R E N C E S

1 Lindahl, T & Barnes, D.E (1992) Mammalian DNA ligases Annu Rev Biochem 61, 251±281.

2 Timson, D.J., Singleton, M.R & Wigley, D.B (2000) DNA ligases in the repair and replication of DNA Mutat Res 460, 301±318.

3 Nakatani, M., Ezaki, S., Atomi, H & Imanaka, T (2000) A DNA ligase from a hyperthermophilic archaeon with unique cofactor speci®city J Bacteriol 182, 6424±6433.

4 Tomkinson, A.E & Mackey, Z.B (1998) Structure and function

of mammalian DNA ligases Mutat Res 407, 1±9.

5 Wilkinson, A., Day, J & Bowater, R (2001) Bacterial DNA lig-ases Mol Microbiol 40, 1241±1248.

6 Lehman, I.R (1974) DNA ligase: structure, mechanism, and function Science 186, 790±797.

7 Li, J.J & Kelly, T.J (1984) Simian virus 40 DNA replication

in vitro Proc Natl Acad Sci USA 81, 6973±6977.

Fig 6 Ligation of substrates with 1-nucleotide insertions by Lig Tk

DNA substrates used in this experiment were derivatives of

L-DNA(40), R-DNA(30) and T-DNA(80) The reactions were

per-formed with labelled oligonucleotides as described in Materials and

methods The substrates used are indicated at the top and the activity

of each reaction was normalized to the speci®c activity observed with

substrates without insertions (de®ned as 100%).

8 Wood, R.D., Robins, P & Lindahl, T (1988) Complementation

of the xeroderma pigmentosum DNA repair defect in cell-free

extracts Cell 53, 97±106.

9 Jessberger, R & Berg, P (1991) Repair of deletions and

double-strand gaps by homologous recombination in a mammalian

in vitro system Mol Cell Biol 11, 445±457.

10 Kletzin, A (1992) Molecular characterisation of a DNA ligase

gene of the extremely thermophilic archaeon Desulfurolobus

ambivalens shows close phylogenetic relationship to eukaryotic

ligases Nucleic Acids Res 20, 5389±5396.

11 Kaczmarek, F.S., Zaniewski, R.P., Gootz, T.D., Danley, D.E.,

Mansour, M.N., Gri€or, M., Kamath, A.V., Cronan, M.,

Mueller, J., Sun, D., Martin, P.K., Benton, B., McDowell, L.,

Biek, D & Schmid, M.B (2001) Cloning and functional

charac-terization of an NAD + -dependent DNA ligase from

Staphylo-coccus aureus J Bacteriol 183, 3016±3024.

12 Thorbjarnardottir, S.H., Jonsson, Z.O., Andresson, O.S.,

Kristjansson, J.K., Eggertsson, G & Palsdottir, A (1995) Cloning

and sequence analysis of the DNA ligase-encoding gene of

Rho-dothermus marinus, and overproduction, puri®cation and

charac-terization of two thermophilic DNA ligases Gene 161, 1±6.

13 Doherty, A.J., Ashford, S.R., Subramanya, H.S & Wigley, D.B.

(1996) Bacteriophage T7 DNA ligase Overexpression,

puri®ca-tion, crystallizapuri®ca-tion, and characterization J Biol Chem 271,

11083±11089.

14 Takahashi, M., Yamaguchi, E & Uchida, T (1984) Thermophilic

DNA ligase Puri®cation and properties of the enzyme from

Thermus thermophilus HB8 J Biol Chem 259, 10041±10047.

15 Shuman, S (1995) Vaccinia virus DNA ligase: speci®city, ®delity,

and inhibition Biochemistry 34, 16138±16147.

16 Ho, C.K., Van Etten, J.L & Shuman, S (1997) Characterization

of an ATP-dependent DNA ligase encoded by Chlorella virus

PBCV-1 J Virol 71, 1931±1937.

17 Cheng, C & Shuman, S (1997) Characterization of an

ATP-dependent DNA ligase encoded by Haemophilus in¯uenzae.

Nucleic Acids Res 25, 1369±1374.

18 Sriskanda, V., Kelman, Z., Hurwitz, J & Shuman, S (2000)

Characterization of an ATP-dependent DNA ligase from the

thermophilic archaeon Methanobacterium thermoautotrophicum.

Nucleic Acids Res 28, 2221±2228.

19 Tong, J., Barany, F & Cao, W (2000) Ligation reaction

speci-®cities of an NAD + -dependent DNA ligase from the

hyperther-mophile Aquifex aeolicus Nucleic Acids Res 28, 1447±1454.

20 Tong, J., Cao, W & Barany, F (1999) Biochemical properties of a high ®delity DNA ligase from Thermus species AK16D Nucleic Acids Res 27, 788±794.

21 Gon, C., Bailly, V & Verly, W.G (1987) Nicks 3¢ or 5¢ to AP sites or to mispaired bases, and one-nucleotide gaps can be sealed

by T4 DNA ligase Nucleic Acids Res 15, 8755±8771.

22 Pearson, M.N & Rohrmann, G.F (1998) Characterization of a baculovirus-encoded ATP-dependent DNA ligase J Virol 72, 9142±9149.

23 Sriskanda, V & Shuman, S (1998) Speci®city and ®delity of strand joining by Chlorella virus DNA ligase Nucleic Acids Res.

26, 3536±3541.

24 Bhagwat, A.S., Sanderson, R.J & Lindahl, T (1999) Delayed DNA joining at 3¢ mismatches by human DNA ligases Nucleic Acids Res 27, 4028±4033.

25 Tomkinson, A.E., Tappe, N.J & Friedberg, E.C (1992) DNA ligase I from Saccharomyces cerevisiae: physical and biochemical characterization of the CDC9 gene product Biochemistry 31, 11762±11771.

26 Luo, J., Bergstrom, D.E & Barany, F (1996) Improving the

®delity of Thermus thermophilus DNA ligase Nucleic Acids Res.

24, 3071±3078.

27 Husain, I., Tomkinson, A.E., Burkhart, W.A., Moyer, M.B., Ramos, W., Mackey, Z.B., Besterman, J.M & Chen, J (1995) Puri®cation and characterization of DNA ligase III from bovine testes Homology with DNA ligase II and vaccinia DNA ligase.

J Biol Chem 270, 9683±9690.

28 Sambrook, J & Russell, D.W., eds (2001) Molecular Cloning: A Laboratory Manual, 3rd edn Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

29 Georlette, D., JoÂnsson, Z.O., Van Petegem, F., Chessa, J.-P., Van Beeumen, J., HuÈbscher, U & Gerday, C (2000) A DNA ligase from the psychrophile Pseudoalteromonas haloplanktis gives insights into the adaptation of proteins to low temperatures Eur.

J Biochem 267, 3502±3512.

30 Matsuda, S., Sakaguchi, K., Tsukada, K & Teraoka, H (1996) Characterization of DNA ligase from the fungus Coprinus cine-reus Eur J Biochem 237, 691±697.

31 Doherty, A.J & Da€orn, T.R (2000) Nick recognition by DNA ligases J Mol Biol 296, 43±56.

32 Pritchard, C.E & Southern, E.M (1997) E€ects of base mis-matches on joining of short oligodeoxynucleotides by DNA ligases Nucleic Acids Res 25, 3403±3407.