1. Trang chủ
  2. » Luận Văn - Báo Cáo

Báo cáo khoa học: Two CCAAT/enhancer binding protein sites in the cytochrome P4503A1 locus Potencial role in the glucocorticoid response ppt

9 427 0
Tài liệu đã được kiểm tra trùng lặp

Đang tải... (xem toàn văn)

THÔNG TIN TÀI LIỆU

Thông tin cơ bản

Tiêu đề Two ccaat/enhancer binding protein sites in the cytochrome p4503a1 locus potencial role in the glucocorticoid response
Tác giả Elsa Rodrigues, Marie-José Vilarem, Vera Ribeiro, Patrick Maurel, Maria C. Lechner
Trường học University of Lisbon
Chuyên ngành Molecular Biology
Thể loại báo cáo khoa học
Năm xuất bản 2003
Thành phố Lisbon
Định dạng
Số trang 9
Dung lượng 273,32 KB

Các công cụ chuyển đổi và chỉnh sửa cho tài liệu này

Nội dung

Our results suggest a correla-tion between transcripcorrela-tion of C/EBPa, nuclear protein function and induction of CYP3A1 by dexamethasone in the liver.. Our in vitro and the in vivo

Trang 1

Two CCAAT/enhancer binding protein sites in the cytochrome

P4503A1 locus

Potencial role in the glucocorticoid response

Elsa Rodrigues1, Marie-Jose´ Vilarem2, Vera Ribeiro1,*, Patrick Maurel2and Maria C Lechner1

1 Molecular Biology Unit, Faculty of Pharmacy, University of Lisbon, Portugal; 2 Unite´ 128 INSERM, Montpellier, France

Induction of CYP3A genes by the ligand-activated

preg-nane-X-receptor (PXR)involves the interaction of other as

yet unidentified liver transcription factors Here we show

that the CYP3A1 promoter contains two active sites

con-trolled by the CCAAT/enhancer-binding protein a (C/

EBPa), previously shown to regulate a number of liver stress

response genes We have identified two functional C/EBP

binding sites at the CYP3A1 promoter that confer luciferase

activity to C/EBPa cotransfected CHO cells When inserted

upstream of a thymidine kinase promoter, oligonucleotides

corresponding to these elements ()350/)311 and )628/

)608), increase reporter gene expression when cotransfected

with a C/EBPa expression vector Point mutations in the

most conserved nucleotides in either element prevent binding

of C/EBPa and abolish transactivation of the CYP3A1 promoter Moreover, we demonstrate that C/EBPa accu-mulates in the rat liver nuclei in response to dexamethasone, and that under these conditions C/EBPa binds to the CYP3A1promoter elements Our results suggest a correla-tion between transcripcorrela-tion of C/EBPa, nuclear protein function and induction of CYP3A1 by dexamethasone in the liver They also support the notion that C/EBPa participates

in the up-regulation of the CYP3A1 gene in response to synthetic glucocorticoids

Keywords: cytochrome P450; CYP3A1 locus; C/EBP; regu-latory elements; glucocorticoid induction

Mammalian hepatic phenotypes are controlled through the

concerted action of a number of liver-enriched transcription

factors that act in cooperation with a number of ubiquitous

and ligand-activated factors to direct the selective expression

of liver-specific genes The activity of each target gene is

modulated by dynamic arrays of counterpart transcription

factors that act upon liver differentiation and that are

stimulated by endogenous as well as by exogenous ligands [1]

Cytochrome P450 genes, members of the CYP1–4

fami-lies, are abundantly expressed in the liver and are subjected

to complex regulatory networks that depend markedly on

the ontological development, and on the hormonal and

nutritional status of the animals [2] Moreover, P450 mono-oxygenases, as major body interfaces, are adaptive enzymes highly responsive to induction and repression by environ-mental and xenobiotic agents in general

Recently, important advances have been made in under-standing the mechanism of action of prototype inducers that control the expression of hepatic P450 enzymes, namely those mediated by the nuclear receptors AhR, CAR, PPAR and PXR (reviewed, [3]) However, the role of these ligand-activated receptors can be enhanced, reduced or inhibited by the availability of other transcription factors that participate

in the organization of the transcription initiation complexes

in the native DNA context of each CYP locus Such func-tional interactions have not been fully defined, but their elu-cidation is essential to understand the molecular basis of the marked physiological variations often observed in the in vivo response of each CYP gene to common inducing agents CYP3A1has been widely investigated as a model of a xenobiotic up-regulated liver expressed gene Transcription

of CYP3A1 is virtually undetected in the adult rat liver, but markedly induced by structurally diverse agents, including the synthetic glucocorticoid agonist dexamethasone [4] and the antagonist pregnenolone 16a-carbonitrile [5] Such paradoxical behaviour of the rat CYP3A1, and of other orthologous genes, was shown to involve the pregnane X receptor (PXR)[6–8], a member of the steroid hormone receptor family The mechanism of the glucocorticoid-mediated activation of CYP3A1 relies on a dexamethasone responsive unit in the promoter region of this gene [9,10] This unit comprises elements that are targeted by the activated PXR, as well as by COUP-TFs and HNF4 [11,12] However, in vitro experiments have shown that mouse [6],

Correspondence to M C Lechner, Molecular Biology Unit,

Faculty of Pharmacy, University of Lisbon,

Av Prof Gama Pinto, 1649–003 Lisbon, Portugal.

Fax: + 351 21 7946491, Tel.: + 351 21 7946490,

E-mail: clechner@ff.ul.pt

Abbreviations: C/EBP, CCAAT/enhancer binding protein; C/EBP

cons, C/EBP consensus oligonucleotide; CYP, cytochrome P450;

PXR, pregnane-X-receptor; AhR, aryl hydrocarbon receptor; CAR,

constitutive androstane receptor; PPAR, peroxisome

proliferator-activated receptor; RXR, retinoid-X-receptor; COUP-TF, chicken

ovalbumin upstream promoter transcription factor; HNF4,

hepato-cyte nuclear factor 4; TK, thymidine kinase; EMSA, electrophoretic

mobility-shift assay.

*Present address: Biochemistry Laboratory, Chemistry Departmental

Area, Faculty of Sciences and Technology, University of Algarve,

Campus de Gambelas 8000-117 Faro, Portugal.

(Received 30 September 2002, revised 14 November 2002,

accepted 5 December 2002)

Trang 2

rat [13] and human [8,14] PXR receptors are moderately

activated by dexamethasone This result is in contrast with

the strong in vivo transcriptional induction by this

gluco-corticoid [5,15–17], and suggests that PXR does not fully

explain the pattern of CYP3A1 induction The importance

of other transcription factors for the positive regulation by

dexamethasone is also suggested by the observation that full

CYP3A1induction can not be achieved in CV1 cells, that

lack liver-enriched transcription factors presumably needed

to elicit the response [18]

Other factors structurally unrelated to PXR have been

demonstrated to activate transcription of liver-expressed

genes, namely as potentiators of glucocorticoid responses

CCAAT/enhancer-binding proteins (C/EBP)were shown to

play a role in adipocyte differentiation, as well as in the liver

acute-phase response (review, [19]) These factors create

multiple possibilities of combinatorial gene regulation in the

liver, by strategies that involve heterodimerization with

other b-zip proteins, and cross talk interactions with other

factors, such as the glucocorticoid receptor [20] P450 genes,

namely Cyp2D5 [21,22], CYP2B [23–25], CYP2C12 [26] and

human CYP3A4 [27], have been shown to be the targets of

C/EBP factors in liver cells

In the present work we investigated the presence of

cis-acting elements in the CYP3A1 promoter Dynamic

trans-fection–transactivation assays were performed to evaluate

the potential activity of recombinant C/EBPa on the

previ-ously cloned CYP3A1 promoter region [28] Two C/EBP

binding sites were identified by proteinÆDNA gel

mobility-shift assays To assess the biological significance of these

regulatory elements in the response to glucocorticoids, the

concurrence of the CYP3A1 and the C/EBP responsiveness

was investigated in the rat liver upon synthetic glucocorticoid

administration The hypothesis of a cause–effect relationship

is suggested by the time-course analysis of C/EBPa and

CYP3A1 mRNA and protein accumulation in the liver

Our in vitro and the in vivo results indicate that C/EBPa is

an activator of the CYP3A1 gene promoter and suggest a role

for this liver enriched transcription factor in the

transcrip-tional activation of CYP3A1 by synthetic glucocorticoids

Materials and methods

Animals and treatments

Male adult Wistar rats, bred at the Gulbenkian Institute

animal house, Ociras, Portugal, were used in this

investiga-tion Rats were maintained with standard chow and water

ad libitum, until 24 h before hormone treatment

Dexameth-asone 21-phosphate (Sigma)was given intragastrically, in

aqueous solution, in a dose of 40 mg per kg body mass, and

the animals were sacrificed at different time points after drug

administration Groups of three rats were used for each

sample The livers were excised immediately after

decapi-tation and pooled for cell fractionation or RNA

extrac-tion All procedures were carried out in accordance with

European regulations concerning animal experimentation

Plasmids

Several different fragments derived from the 5¢ flanking

region of the CYP3A1 gene (GenBank accession no

X62086)[28], were previously subcloned upstream of the thymidine kinase gene [29] in the luciferase expression vector pT81Luc [30], and analysed in transient transfection experiments Constructs bearing multiple element copies were made using oligonucleotides encompassing the two distinct CYP3A1 5¢ sites 3A1-300 ()350/)331, 5¢-GTCCTTCTGTAATGGTGTG-3¢), or 3A1-600 ()629/ )608, 5¢-TGCAGGATTGCAGAAGTCTATT-3¢) These were ligated with the SmaI-digested pT81Luc vector and analysed in transient transfection experiments All con-structs were verified by DNA sequencing The pMSV/EBPa and pMSV/EBPb expression vectors were kindly provided

by S L McKnight (University of Texas South-Western Medical School, TX, USA)

Cell culture CHO cell line (hamster ovary epithelial)was maintained in Ham’s F12 medium and the COS-7 cell cultures were maintained in high glucose Dulbecco’s modified Eagle’s medium (DMEM)supplemented with 10% (w/v)heat inactivated fetal bovine serum and maintained at 37C in humidified 5% (v/v)CO2

Transactivation assays

To minimize variations in transfection efficiency, replicates were transfected in single batch suspension with FuGENE (Roche Molecular Biochemicals), according to the manu-facturer’s instructions Plates containing 150 000 cells were cotransfected with 0.5 lg of CYP3A1T81Luc plasmid and different amounts of each expression vector Cells were inoculated in 24-well plates and maintained for 48 h These cells were harvested and lysed in reporter lysis buffer (Promega, Madison, WI, USA) Cell extracts were assayed for luciferase activity and protein content (BCA reagent, Pierce, Rockfort, IL, USA) The cell extracts were normal-ized for the total amount of protein prior to performing the luciferase assay, as C/EBP expression vector was shown to severely repress the expression of b-galactosidase in the transfected CHO cell line

Site-directed mutagenesis The plasmid 0.8T81Luc served as the template for site-directed mutagenesis using the QuickChange Site Directed Mutagenesis Kit (Stratagene, CA, USA) All reactions were performed according to the protocol provided by the manufacturer The oligonucleotides used for site-directed mutagenesis of the C/EBP binding sites were as follows (mutated bases underlined): site 3A1-300: 5¢-GGAGA AAGTCCGTCTATGGTGGTGTGCAGATGACACAG TTTTGGC-3¢; site 3A1-600: 5¢-GCCTCTGCTCTGTA AGTGCAGGACCGTAGAGGTCTATTACTTATG-3¢ mRNA analysis

Total liver RNA was extracted by a modification of the LiCl/ urea method [31], and samples (20 lg)eletrophoresed on formaldehyde-agarose gels for Northern blot analysis The subsequently generated Northern blot nylon membranes were incubated with the specific oligonucleotide probes

Trang 3

CYP3A1 (5¢-TGTGCGGGTCCCAAATCCGT-3¢)and

C/EBPa

(5¢-GCACGAGACGTCTATAGACA-3¢)end-labelled with [c-32P] dATP using T4 polynucleotide kinase

Nuclear extracts

Isolation of liver nuclei both from control and

dexameth-asone-treated rats was carried out [32] and nuclear extracts

were prepared as described previously [33]

Recombinant C/EBPa used in the gel mobility-shift assays

were obtained by transfecting 3.0· 106 COS-7 cells with

30 lg of pMSV/EBPa Cells were seeded in 100-mm plates

and maintained for 48 h for nuclear extract preparation [33]

Western blot analysis

Five micrograms of liver nuclear protein were

electrophore-sed on 10% SDS/polyacrylamide gels and electroblotted onto

Imobilon P (Millipore, Bedford, MA, USA) After

visua-lization of the transferred proteins by amido black staining,

the membranes were incubated with an anti-C/EBPa Ig

(14AA, Santa Cruz Biotechnology) Results were quantified

using theEAGLE-EYEsoftware package (Stratagene)

Electrophoretic mobility-shift assay (EMSA)

Double-stranded DNA probes and competitors were

gen-erated by annealing from the following complementary

single-stranded oligonucleotides: C/EBP consensus

oligo-nucleotide (C/EBPcons), 5¢-TGCAGATTCCGCAATCTG

CA-3¢ [34]; 3A1–300, 5¢-AGTCCTTCTGTAATGGTG

TG-3¢; 3A1–600, 5¢-TGCAGGATTGCAGAAGTCTA

TT-3¢; 3A1-700, 5¢-AATTTTGGTGGATAGATAT

AG-3¢; m3A1-300, 5¢-AGTCCGTCTATGGTGGTGTG-3¢;

m3 A1-600, 5¢-TGCAGGACCGTAGAGGTCTATT-3¢

(mutated bases are underlined) The oligonucleotides

3A1-300 (position )350 to )331), 3A1-600 (position )629 to

)608)and 3A1-700 (position )766 to )746)encompass

distinct CYP3A1 promoter regions DNA (6 pmol)was

end-labelled with [c-32P] dATP using T4 polynucleotide kinase,

and unincorporated nucleotides were removed by Sephadex

G50 filtration The binding reactions were performed in a

total volume of 20 lL and contained 2–5 lg of nuclear

extract, 10 mMHepes buffer, pH 8.0, 0.1 mMEDTA, 2 mM

dithiothreitol, 17.5% (v/v)glycerol, 40 mM spermidine,

40 mM MgCl2, 0.5 lg of dIdC, 1 lg salmon sperm DNA

and 0.5–2 ng of oligonucleotide probe In competition assays

excess unlabeled oligonucleotide was preincubated (30 min)

at 4C, prior to incubation with each probe for additional

20 min Supershift reactions were performed with 1 lL of

anti-C/EBP (14AA, Santa Cruz Biotechnology)which was

added to the reaction media, that were kept on ice for 30 min

before addition of the probe ProteinÆDNA complexes were

resolved on 5% (w/v)nondenaturing polyacrylamide gels

(acrylamide/bisacrylamide 29 : 1, v/v)in 0.5· Tris/borate/

ECTA buffer (45 mMTris/borate, 1 mMEDTA) The gels

were eletrophoresed for 2.5 h, at 30 mA

Statistical analysis

Statistical analyses were performed using the Student’s t-test

and the one-way test with the Tukey HSD posthoc

test for unequal N (Spjotvoll/Stoline test) All analysis were performed using the StatSoft Inc (1995) STATISTICA FOR WINDOWSsoftware

Results

Identification of C/EBP-responsive sequences

in the CYP3A1 gene promoter CYP3A1T81Luc recombinants containing the 5¢ upstream region of the CYP3A1 gene were constructed and cotrans-fected into CHO cells together with the C/EBP expression vectors pMSV/EBPa or pMSV/EBPb The CHO cell line, which is devoid of hepato-specific transcription factors, has been used previously to characterize C/EBP-dependent gene expression [26,35] We found that C/EBPa significantly

Fig 1 Transactivation of CYP3AT81Luc constructs with vectors pMSV/EBPa or pMSV/EBPb in the CHO cell line Cotransfections were carried out using 0.5 lg of CYP3AT81Luc and increasing con-centrations (0.025–0.2 lg)of C/EBP expression vectors, or empty vector (A)Diagramatic representation of the luciferase constructs containing CYP3A1 5¢-flanking DNA sequences, upstream of luci-ferase cDNA Tk, thymidine kinase promoter; lucif, luciluci-ferase cDNA (B)Cotransfection of CYP3AT81Luc with 0.15 lg of pMSV/EBPa (C)Cotransfection of p0.8T81Luc with increasing concentrations of pMSV/EBPa or pMSV/EBPb The normalized luciferase activities are expressed as mean values ± SD of duplicates for a minimum of three experiments *P < 0.05, **P < 0.01, ***P < 0.001 significant dif-ferences between cells cotransfected with pMSV and pMSV/EBPa (Student’s t-test).

Trang 4

increases the luciferase reporter gene activity of the

CYP3A1T81Luc (Fig 1B) The strongest transactivation

level (approximately sevenfold)was observed in the

pre-sence of the p0.8T81-Luc construct (Student’s t-test,

P< 0.001), which contains approximately 800 bp of the

5¢ upstream region of the CYP3A1 locus (Fig 1B) Deletion

of the DNA segment )166 to )811 severely reduced

transactivation by C/EBPa Moreover, transactivation of

the p0.8T81Luc is shown to be dose-dependent with the

C/EBPa expression vector (Fig 1C)

C/EBP-binding activity in rat liver has been described as

involving both C/EBPa and C/EBPb However, when

pMSV/EBPb was assayed in cotransfection experiments

with the CYP3A1 recombinant p0.8T81Luc no

transacti-vation was observed (Fig 1C) Moreover, C/EBPb inhibits

the C/EBPa -stimulated expression of the p0.8T81Luc (data

not shown)

Characterization of the C/EBP binding sequences

in the CYP3A1 promoter region

We used gel mobility-shift assays, with the goal of

identi-fying active C/EBPa binding sites within the CYP3A1 locus

First, oligonucleotides encompassing the putative C/EBP

responsive elements in p0.8T81Luc were synthesized These

were named 3A1-300, 3A1-600 and 3A1-700 (Fig 2A)

C/EBP proteins were then over-produced in COS-7 cells,

and the nuclear extracts used to characterize their binding

activities to 3A1-300, 3A1-600 or 3A1-700 by EMSA The

specificity of the complex(es)formed when a C/EBP

consensus oligonucleotide (C/EBPcons)was used, was

verified by means of a supershift assay using an anti-C/

EBPa Ig (Fig 2B; arrowhead) Both 3A1-300 and 3A1-600

oligonucleotides competed efficiently for C/EBPa binding

to the C/EBPcons preventing the formation of the complex

at a 50-fold molar excess (Fig 2B) The C/EBPconsÆ

C/EBPa complex was not competed by 3A1-700 or by an unrelated DNA sequence (Fig 2B)

Supershift assays, with an anti-C/EBPa Ig and radio-labelled oligonucleotides 3A1-600 and 3A1-300 (data not shown)confirmed the specificity of C/EBPa protein binding (Fig 2C; arrowhead) We note that the 3A1-600ÆC/EBPa complex was competed by C/EBPcons and by cold self, while a mutant form of this oligonucleotide, differing in

Fig 2 Characterization of the binding activities to sites 300,

3A1-600 and 3A1-700 in C/EBPa over-expressed COS-7 cell nuclear

extracts (A)DNA sequence of the CYP3A1 5¢-flanking region

cor-responding to construct p0.8T81Luc The oligonucleotides containing

the putative C/EBP responsive elements used in the gel mobility-shift

assays are underlined The oligonucleotide 3A1-300 corresponds to the

)350/)331 sequence of the CYP3A1 cDNA, the 3A1-600 to the )629/

)608 sequence and the 3A1-700 to nucleotides )767/)747 (B)EMSA

was performed using a radiolabeled double-stranded oligonucleotide

corresponding to the C/EBP consensus (C/EBPcons)as a probe.

Competition experiments were performed by adding a five- or 50-fold

excess of unlabelled double-stranded oligonucleotides corresponding

to cold-self, a nonspecific tubulin sequence, and 3A1-300, 3A1-600 or

3A1-700 (C)EMSA was performed using a radiolabeled

double-stranded oligonucleotide corresponding to site 3A1-600 as a probe.

Competition experiments were performed by adding a five- or 50-fold

excess of unlabelled double-stranded oligonucleotides corresponding

to C/EBPcons, cold self, mutant 3A1-600 (m3A1-600), and a

non-specific tubulin sequence Supershift experiments were performed using

an anti-C/EBPa Ig Symbol s in panel B and C denotes the position of

the C/EBP containing complex and the arrowhead ss the position of

the DNAÆprotein complex shifted by the specific antibody.

Trang 5

3 bp, did not The results suggest the presence of two

C/EBPa binding sites at positions)300 and )600 within the

CYP3A1locus

Activation of multimerized CYP3A1-C/EBP responsive

elements by C/EBPa in transfection assays

To determine whether C/EBPa binding to either site

3A1-300 or 3A1-600 resulted in transcriptional activation, we

analysed the ability of each specific site to confer C/EBP

responsiveness to the thymidine kinase promoter of the

pT81Luc recombinant We performed the cotransfection of

CHO cells with pMSV/EBPa and single recombinants

containing two or three synthetic copies of 300 or

3A1-600 oligonucleotides As shown in Fig 3, the C/EBP

elements found in the CYP3A promoter are functional

and autonomous units that confer C/EBP responsiveness to

a heterologous promoter

Functional analysis of C/EBP binding sites in CYP3A1

promoter by site directed mutagenesis

The functional relevance of sites 3A1-300 and 3A1-600 for

CYP3A1 induction by C/EBPa was investigated by

individual or combined mutagenesis of the two sites in

p0.8T81Luc, followed by cotransfection of C/EBPa

expression vector into CHO cells As shown in Fig 4,

mutation of site 3A1-300 (m300)and/or 3A1-600 (m600)

significantly reduced activation of the p0.8T81Luc by

C/EBPa to approximately 50% of the wild-type level (wt)

(ANOVA one-way test: F¼ 12.29, d.f ¼ 9, P < 0001)

The posthoc comparisons revealed that significant

differ-ences were found between the wt and each mutant (Tukey

HSD for unequal N: m300, P < 0.05; m600, P < 0.01;

dm300/600, P < 0.01) Western blot analysis of the

42 kDa C/EBPa protein in the cotransfection experiments

proved that the decrease in CYP3A1 activation is not due

to a reduction in C/EBPa expression (Fig 4B) Taken

together, these results strongly indicate that both sites

3A1-300 and 3A1-600 are functional elements of the CYP3A1

promoter

Time-course analysis of thein vivo expression

of C/EBPa upon glucocorticoid administration The time-course variation of the relative concentrations of C/EBPa mRNA and protein was monitored in the rat liver

In parallel we also followed the accumulation of the CYP3A1 mRNA, upon addition of dexamethasone (Fig 5)

C/EBPa mRNA concentration increases approximately fivefold over the control value between 0.5 and 4 h after treatment, and decreases to about fourfold of the control value by 21 h after dexamethasone administration Such an increase clearly precedes the marked induction of hepatic CYP3A1 mRNA found to occur between 4 and 21 h after treatment (Fig 5A)

We found the accumulation of both isoforms of C/EBPa (p42, of 42 kDa and p30, of 30 kDa)to occur concomit-antly with the increase in the relative abundance of the corresponding mRNA However, the two isoforms accu-mulate with different kinetic profiles (Fig 5B) Maximal induction (an increase of about 2.5-fold over the basal level)

is observed for p30 between 2 and 4 h upon dexamethasone administration, with a gradual decrease to the control value

21 h after treatment In contrast the levels of the p42 isoform increases from hour 2 onwards, reaching constant

Fig 3 Ability of multimerized CYP3A1-C/EBP responsive elements to

confer activation by C/EBPa in the CHO cell line Cotransfections were

carried out with 0.5 lg of 3A1-C/EBP-RE-T81Luc and 0.15 lg of

pMSV/EBPa expression vector, or empty vector The normalized

luciferase activities are expressed as mean values ± SD of duplicates

for a minimum of three experiments.

Fig 4 Functional analysis of the C/EBP binding sites in the CYP3A1 promoter by cotransfection studies using the p0.8T81Luc reporter plas-mid altered by site-directed mutagenesis (A)Cotransfections were carried out using 0.5 lg of wild-type (wt)or the different mutated promoter reporter plasmids (mut300, mut600 and dm300/600)and 0.15 lg of pMSV/EBPa expression vector, or empty vector As no significant differences in the basal activity of the different mutated reporter plasmids were found, normalize luciferase activities are expressed as mean values ± S.D of fold induction of duplicates for a minimum of three experiments *P < 0.05, **P < 0.01 significant differences in transactivation due to mutation of 300 or/and

3A1-600 sites ( ANOVA one-way test: F ¼ 12.29, d.f ¼ 9, p < 0001; posthoc Tukey HSD test for unequal N: m300, P < 0.05; m600, P < 0.01; dm300/600, P < 0.01) (B) Result of a representative Western blot analysis of the 42 kDa C/EBPa protein in the cotransfection experi-ments: lanes (–)with empty vector and (+)with 0.15 lg of pMSV/ EBPa Fifty lL of total protein extract were analysed by SDS/PAGE (10%, w/v), the resolved proteins transferred to poly(vinylidene difluoride)membranes, and the membranes incubated with a specific anti-C/EBPa Ig.

Trang 6

levels of about twice the control value, which persisted 21 h

after treatment

The relative differences observed for the increase in

C/EBPa mRNA (approximately fivefold)or protein levels

(approximately twofold)is consistent with the previous

demonstration of a post-transcriptional regulation of

C/EBP protein expression Actually, a previous report has shown that the stimulatory effect of cAMP on C/EBPb mRNA levels does not result in the alteration of protein levels [36], while others have reported a discrepancy between C/EBPb protein and mRNA levels in various tissues [37] Our results demonstrate that dexamethasone is an inducer of C/EBPa, exerting a positive effect on the steady-state levels of both the mRNA and protein levels

in the liver The increase in the levels of both hepatic C/ EBPa isoforms clearly precedes induction of the CYP3A1 mRNA, suggesting that these factors may play an active role in the transcriptional activation of the CYP3A1 gene by dexamethasone

In vivo CYP3A1-C/EBPa binding activity

We investigated the presence and relative concentration of active C/EBP proteins in the hepatic cell nuclei as a function

of the animal treatment The results of the binding activities

of nuclear proteins extracted from control and from dexamethasone treated rats to site 3A1-300 are shown in Fig 6 A significant increase in the cellular C/EBP protein capable of binding to site 3A1-300 was systematically observed in the living hepatic cell nuclei 2 h after treatment with dexamethasone The anti-C/EBPa Ig displaces the majority of the complex (Fig 6; arrowhead)confirming the ability of this regulatory factor to participate in the transcriptional activation of CYP3A1 in vivo Similar results were obtained for the 3A1-600 site (data not shown) These results strongly suggest the requirement of C/EBPa for the dexamethasone induced transcriptional activation of the CYP3A1gene

Discussion

It has long been recognized that induction of hepatic CYP3Agenes by synthetic glucocorticoids differs from the physiological responses that are mediated by the glucocor-ticoid receptor [38] More recently, the identification of PXR

as the transducer of the CYP3A1 adaptive responses to xenobiotics, ligands of this novel receptor, has defined an alternative steroid regulatory pathway [39]

However, other critical transcription factors are likely to participate in the organization of the transcription initiation complex in the de novo activation of the CYP3A1 locus For instance, the observation that the full induction of CYP3A1

by glucocorticoid cannot be achieved in CV1 cells, which lack a number of hepatic transcription factors [18], illustrates the need for other partner proteins in the synthetic glucocorticoid-induced CYP3A activation in the liver

We have identified two C/EBP sites in the CYP3A1 promoter that are specifically recognized by the C/EBPa transcription factor These two cis-elements, 3A1-300 and 3A1-600, share 50% and 60% identity with the C/EBP consensus sequence Moreover, point mutations of the most conserved nucleotides in the cis-element completely preven-ted binding of C/EBPa, thereby abolishing transactivation

of the CYP3A1 promoter Accordingly, the dynamic study

of the C/EBP elements performed by transfection-transac-tivation assays, clearly demonstrated the presence of active C/EBP regulatory elements in the 5¢ upstream region of the CYP3A1gene

Fig 5 Time-course variation of rat liver CYP3A1 and C/EBPa levels

in response to dexamethasone Total RNA and nuclear extracts were

isolated from pools of control or dexamethasone-treated adult rat liver

(40 mg per kg body mass)killed at various times after dexamethasone

administration The blots shown are representative of results obtained

in three independent experiments (A)Total RNA (20 lg)was

ana-lysed by Northern blotting for CYP3A1 and C/EBPa mRNA

Pho-tographs of the ethidium bromide-stained total RNA, including the

18S and 28S ribosomal RNA bands, used to generate the Northern

blots are shown (B)Western blot analysis of C/EBPa Liver nuclear

proteins (5 lg)were analysed by SDS/PAGE (10%, w/v), transferred

to poly(vinylidene difluoride)membranes, and the membranes

incu-bated with a specific anti-C/EBPa Ig Protein loading control using

Amido Black staining of the membrane is shown in the bottom panel.

Results were quantified using the EAGLE - EYE software package

(Stratagene).

Trang 7

While all C/EBP proteins can interact with the same

DNA target sequences, C/EBPa but not C/EBPb

specifi-cally transactivates the CYP3A1 promoter by binding to the

3A1-300 and 3A1-600 promoter elements Replacement of

one C/EBP factor by another has been proposed as a

modulation mechanism of particular genes at different

stages of proliferation and differentiation [40,41] Multiple

homodimeric or heterodimeric combinations can occur

in vivo to control the biogenesis of a variety of proteins

displaying distinct physiological properties The differential

occupancy of the C/EBP promoter element in a particular

gene may be dictated by the relative abundance and affinity

of the different homo- or heterodimers, as well as by

interactions of the different C/EBP proteins with other factors binding to neighbouring regulatory sites The in vivo observations of the induction of C/EBPa mRNA and protein preceding the accumulation of CYP3A1 mRNA in rat liver suggest the importance of the characterized C/EBPa promoter elements in the up-regulation of this gene This is consistent with the previously described threefold increase of the C/EBPa mRNA concentration in rat hepatoma cells H4IIE within 4 h of dexamethasone treatment [36] Transcriptional induction of C/EBP genes by dexamethasone has also been shown in the rat intestinal epithelial crypt cell line IEC-6, in which a rapid (30 min) increase of C/EBPa and C/EBPb mRNA was observed [42] Others have shown that induction of C/EBPb mRNA by dexamethasone begins 30 min after treatment [43,44] Dexamethasone transiently reduces the levels of C/EBPa

in 3T3L1 adipocytes, as well as in the white adipose tissue [45], while it does not affect the C/EBPa levels in the rat intestinal epithelium crypt IEC-6 cell line [42], indicating that the effect of glucocorticoids on C/EBPa expression may

be cell type-specific

Liver differentiation and development is under the physiological control of glucocorticoid hormones that induce the expression of several transcription factors in the hepatocyte C/EBP concentration was recently shown to vary as a function of the differentiation of long-term human primary hepatocytes in culture [46] The requirement of C/EBP isoforms for the mediation of hormone-induced expression as been reported for hepatic genes [25], namely P450 genes [47,48] Synergy in glucocorticoid responsiveness has been well characterized in the case of the phosphoenol-pyruvate carboxykinase gene promoter [49] Several other hormone responses have also been demonstrated to depend

on C/EBP proteins, particularly the a-isoform [50] The presence of glucocorticoid responsive elements that require C/EBPa for maximal hormone activation has been des-cribed for the gene encoding carbamoylphosphate synthe-tase I as well as other liver expressed genes [35]

The role of C/EBPa in regulating CYP3A gene expres-sion has been previously investigated C/EBPa, along with D-element binding protein, was shown to increase expres-sion of a construct containing the )169 bp to +11 bp fragment of the CYP3A4 promoter [27] The present results first point to the importance of C/EBPa for the CYP3A1 induction by dexamethasone and suggest a cause–effect relationship between the variation of C/EBPa and CYP3A1 mRNA in rat liver This casual link is further supported by the net increase of the functional C/EBPa proteins found in the liver nuclei of the dexamethasone pretreated animals that display the characteristic induction of CYP3A1 Actually, the C/EBPa protein that accumulates in the liver nuclei is capable of recognizing the two cis-acting elements 3A1-300 and 3A1-600 of the CYP3A1 gene promoter as shown here using DNAÆprotein binding assays

The link between dexamethasone treatment, C/EBP induction and CYP3A1 transcriptional activation should nevertheless be unequivocally demonstrated not to be merely a phenomena association The in vivo and in vitro evidences here described are consistent with two alternative hypotheses for an active role of C/EBPa in the CYP3A1 dexamethasone-responsiveness Induction of the CYP3A1 could be driven by functional cross-talk interactions of the

Fig 6 In vivo CYP3A1-C/EBP binding activity EMSA of 5 lg liver

nuclear extract proteins from dexamethasone-treated rats using as a

probe a radiolabeled double-stranded oligonucleotide corresponding

to site 3A1-300 Supershift experiments were performed with a specific

anti-C/EBPa Ig The (s)symbol denotes the position of the C/EBP

containing complex and the arrowhead (ss)the position of the

DNA-protein shifted by the specific antibody.

Trang 8

activated PXR with C/EBPa, necessary for the CYP3A1

locus full response Similarly, the glucocorticoid-induced

activation of the CYP3A1 promoter has already been

shown to primarily reflect the increase in the levels of other

transcription factors, namely RXRa [18,51]

An alternative pathway operating for the positive

modulation of CYP3A1 expression by glucocorticoids can

also be considered based on our results Such a pathway

has been recently proposed by other authors based on the

effect of a mutation within the promoter region of the

Human CYP3A4, which interrupts a putative complex

binding site for both C/EBPa and HNF-3 [48] The

described mutation interferes with the ability of the

CYP3A4 promoter to respond to glucocorticoids but does

not affect the response to the potent CYP3A4 inducer and

PXR-ligand, rifampicin

The nature of a C/EBP mediated response or the putative

interactions between PXR and C/EBPa should be further

investigated at a molecular level, namely through dynamic

transfection–transactivation assay as well as by in vivo

footprinting analysis These studies are necessary for a more

complete definition of the transduction pathway triggered

by the synthethic glucocorticoids in the hepatic cell that

directly modulate the expression of the CYP3A genes

Acknowledgements

Supported by Fundac¸a˜o para a Cieˆncia e Tecnologia – grant PRAXIS

4/4.1/BD/2999 (E.R); project PRAXIS XXI 2/2.1/BIA/234/94 – and by

the Franco-Portuguese Scientific Cooperation Program INSERM/

ICCTI.

References

1 Zaret, K.S (1996)Molecular genetics of early liver development.

Annu Rev Physiol 58, 231–251.

2 Gonzalez, F.J & Lee, Y.H (1996)Constitutive expression of

hepatic cytochrome P450 genes Faseb J 10, 1112–1117.

3 Waxman, D.J (1999)P450 gene induction by structurally diverse

xenochemicals: central role of nuclear receptors CAR, PXR,

PPAR Arch Biochem Biophys 369, 11–23.

4 Pereira, T.M & Lechner, M.C (1995)Differential regulation

of the cytochrome P450 3A1 gene transcription by

dexa-methasone in immature and adult rat liver Eur J Biochem 229,

171–177.

5 Gonzalez, F.J., Song, B.J & Hardwick, J.P (1986) Pregnenolone

16a-carbonitrile-inducible P-450 gene family: gene conversion and

differential regulation Mol Cell Biol 6, 2969–2976.

6 Kliewer, S.A., Moore, J.T., Wade, L., Staudinger, J.L., Watson,

M.A., Jones, S.A., McKee, D.D., Oliver, B.B., Willson, T.M.,

Zetterstrom, R.H., Perlmann, T & Lehmann, J.M (1998)An

orphan nuclear receptor activated by pregnanes defines a novel

steroid signaling pathway Cell 92, 73–82.

7 Lehmann, J.M., McKee, D.D., Watson, M.A., Willson, T.M.,

Moore, J.T & Kliewer, S.A (1998)The human orphan nuclear

receptor PXR is activated by compounds that regulate CYP3A4

gene expression and cause drug interactions J Clin Invest 102,

1016–1023.

8 Blumberg, B., Sabbagh, W Jr., Juguilon, H., Bolado, J Jr., van

Meter, C.M., Ong, E.S & Evans, R.M (1998) SXR, a novel

steroid and xenobiotic-sensing nuclear receptor Genes Dev 12,

3195–3205.

9 Huss, J.M., Wang, S.I., Astrom, A., McQuiddy, P & Kasper,

C.B (1996)Dexamethasone responsiveness of a major

gluco-corticoid-inducible CYP3A gene is mediated by elements unrelated to a glucocorticoid receptor binding motif Proc Natl Acad Sci U S A 93, 4666–4670.

10 Quattrochi, L.C., Mills, A.S., Barwick, J.L., Yockey, C.B & Guzelian, P.S (1995)A novel cis-acting element in a liver cytochrome P450, 3A gene confers synergistic induction by glucocorticoids plus antiglucocorticoids J Biol Chem 270, 28917–28923.

11 Huss, J.M & Kasper, C.B (1998)Nuclear receptor involvement in the regulation of rat cytochrome P450 3A23 expression J Biol Chem 273, 16155–16162.

12 Ogino, M., Nagata, K., Miyata, M & Yamazoe, Y (1999) Hepatocyte nuclear factor 4-mediated activation of rat CYP3A1 gene and its modes of modulation by apolipoprotein AI regulatory protein I and v-ErbA-related protein 3 Arch Biochem Biophys.

362, 32–37.

13 Jones, S.A., Moore, L.B., Shenk, J.L., Wisely, G.B., Hamilton, G.A., McKee, D.D., Tomkinson, N.C., LeCluyse, E.L., Lambert, M.H., Willson, T.M., Kliewer, S.A & Moore, J.T (2000)The pregnane X receptor: a promiscuous xenobiotic receptor that has diverged during evolution Mol Endocrinol 14, 27–39.

14 Bertilsson, G., Heidrich, J., Svensson, K., Asman, M., Jendeberg, L., Sydow-Backman, M., Ohlsson, R., Postlind, H., Blomquist, P.

& Berkenstam, A (1998)Identification of a human nuclear receptor defines a new signaling pathway for CYP3A induction Proc N atl Acad Sci USA 95, 12208–12213.

15 Yanagimoto, T., Itoh, S., Sawada, M & Kamataki, T (1997) Mouse cytochrome P450 (Cyp3a11): predominant expression in liver and capacity to activate aflatoxin B1, Arch Biochem Biophys 340, 215–218.

16 Wrighton, S.A., Schuetz, E.G., Watkins, P.B., Maurel, P., Barwick, J., Bailey, B.S., Hartle, H.T., Young, B & Guzelian, P (1985)Demonstration in multiple species of inducible hepatic cytochromes P-450 and their mRNAs related to the glucocorti-coid-inducible cytochrome P-450 of the rat Mol Pharmacol 28, 312–321.

17 Watkins, P.B., Murray, S.A., Winkelman, L.G., Heuman, D.M., Wrighton, S.A & Guzelian, P.S (1989)Erythromycin breath test

as an assay of glucocorticoid-inducible liver cytochromes P-450 Studies in rats and patients J Clin Invest 83, 688–697.

18 Huss, J.M & Kasper, C.B (2000)Two-stage glucocorticoid induction of CYP3A23 through both the glucocorticoid and pregnane X receptors Mol Pharmacol 58, 48–57.

19 Lekstrom-Himes, J & Xanthopoulos, K.G (1998)Biological role

of the CCAAT/enhancer-binding protein family of transcription factors J Biol Chem 273, 28545–28548.

20 Nishio, Y., Isshiki, H., Kishimoto, T & Akira, S (1993)A nuclear factor for interleukin-6 expression (NF-IL6)and the glucocorti-coid receptor synergistically activate transcription of the rat a1-acid glycoprotein gene via direct protein–protein interaction Mol Cell Biol 13, 1854–1862.

21 Lee, Y.H., Yano, M., Liu, S.Y., Matsunaga, E., Johnson, P.F & Gonzalez, F.J (1994)A novel cis-acting element controlling the rat CYP2D5 gene and requiring cooperativity between C/EBPb and an Sp1 factor Mol Cell Biol 14, 1383–1394.

22 Lee, Y.H., Williams, S.C., Baer, M., Sterneck, E., Gonzalez, F.J & Johnson, P.F (1997)The ability of C/EBP beta but not C/EBP alpha to synergize with an Sp1 protein is specified by the leucine zipper and activation domain Mol Cell Biol 17, 2038–2047.

23 Luc, P.V., Adesnik, M., Ganguly, S & Shaw, P.M (1996)Tran-scriptional regulation of the CYP2B1 and CYP2B2 genes by C/EBP-related proteins Biochem Pharmacol 51, 345–356.

24 Park, Y & Kemper, B (1996)The CYP2B1 proximal promoter contains a functional C/EBP regulatory element DNA Cell Biol.

15, 693–701.

Trang 9

25 Cassel, T.N., Gustafsson, J.A & Nord, M (2000)CYP2B1 is

regulated by C/EBPa and C/EBPd inlung epithelial cells Mol Cell

Biol Res Commun 3, 42–47.

26 Tollet, P., Lahuna, O., Ahlgren, R., Mode, A & Gustafsson, J.A.

(1995)CCAAT/enhancer-binding protein-alpha-dependent

trans-activation of CYP2C12 in rat hepatocytes Mol Endocrinol 9,

1771–1781.

27 Ourlin, J.C., Jounaidi, Y., Maurel, P & Vilarem, M.J (1997)Role

of the liver-enriched transcription factors C/EBPa and DBP in

the expression of human CYP3A4 and CYP3A7 J Hepatol 26,

54–62.

28 Telhada, M.B., Pereira, T.M & Lechner, M.C (1992)Effect of

dexamethasone and phenobarbital on run-on transcription rate

and CYP3A mRNA concentration in rat liver: changes during

development Arch Biochem Biophys 298, 715–725.

29 Pereira, T.M., Carlstedt-Duke, J., Lechner, M.C & Gustafsson,

J.A (1998)Identification of a functional glucocorticoid response

element in the CYP3A1/IGC2 gene DNA Cell Biol 17, 39–49.

30 Nordeen, S.K (1988)Luciferase reporter gene vectors for analysis

of promoters and enhancers Biotechniques 6, 454–458.

31 Auffray, C & Rougeon, F (1980)Purification of mouse

immunoglobulin heavy-chain messenger RNAs from total

myeloma tumor RNA Eur J Biochem 107, 303–314.

32 Hattori, M., Tugores, A., Veloz, L., Karin, M & Brenner, D.A.

(1990)A simplified method for the preparation of transcriptionally

active liver nuclear extracts DNA Cell Biol 9, 777–781.

33 Schreiber, E., Matthias, P., Muller, M.M & Schaffner, W (1989)

Rapid detection of octamer binding proteins with mini-extracts,

prepared from a small number of cells Nucleic Acids Res 17, 6419.

34 Johnson, P.F (1993)Identification of C/EBP basic region residues

involved in DNA sequence recognition and half-site spacing

preference Mol Cell Biol 13, 6919–6930.

35 Christoffels, V.M., Grange, T., Kaestner, K.H., Cole, T.J.,

Darlington, G.J., Croniger, C.M & Lamers, W.H

(1998)Gluco-corticoid receptor, C/EBP, HNF3, and protein kinase A

coordi-nately activate the glucocorticoid response unit of the

carbamoylphosphate synthetase I Gene, Mol Cell Biol 18, 6305–

6315.

36 Crosson, S.M., Davies, G.F & Roesler, W.J (1997)Hepatic

expression of CCAAT/enhancer binding protein a: hormonal and

metabolic regulation in rats Diabetologia 40, 1117–1124.

37 Descombes, P., Chojkier, M., Lichtsteiner, S., Falvey, E &

Schi-bler, U (1990)LAP, a novel member of the C/EBP gene family,

encodes a liver-enriched transcriptional activator protein, Genes

Dev 4, 1541–1551.

38 Schuetz, E.G., Wrighton, S.A., Barwick, J.L & Guzelian, P.S.

(1984)Induction of cytochrome P-450 by glucocorticoids in rat

liver I Evidence that glucocorticoids and pregnenolone

16a-car-bonitrile regulate de novo synthesis of a common form of

cyto-chrome P-450 in cultures of adult rat hepatocytes and in the liver

in vivo J Biol Chem 259, 1999–2006.

39 Kliewer, S.A., Lehmann, J.M & Willson, T.M (1999)Orphan

nuclear receptors: shifting endocrinology into reverse Science 284,

757–760.

40 Cao, Z., Umek, R.M & McKnight, S.L (1991)Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells Genes Dev 5, 1538–1552.

41 Poli, V., Mancini, F.P & Cortese, R (1990)IL-6DBP, a nuclear protein involved in interleukin-6 signal transduction, defines a new family of leucine zipper proteins related to C/EBP Cell 63, 643– 653.

42 Boudreau, F., Blais, S & Asselin, C (1996)Regulation of CCAAT/enhancer binding protein isoforms by serum and gluco-corticoids in the rat intestinal epithelial crypt cell line IEC-6 Exp Cell Res 222, 1–9.

43 Matsuno, F., Chowdhury, S., Gotoh, T., Iwase, K., Matsuzaki, H., Takatsuki, K., Mori, M & Takiguchi, M (1996)Induction of the C/EBPb gene by dexamethasone and glucagon in primary-cultured rat hepatocytes J Biochem (Tokyo) 119, 524–532.

44 Gotoh, T., Chowdhury, S., Takiguchi, M & Mori, M (1997)The glucocorticoid-responsive gene cascade Activation of the rat arginase gene through induction of C/EBPb J Biol Chem 272, 3694–3698.

45 MacDougald, O.A., Cornelius, P., Lin, F.T., Chen, S.S & Lane, M.D (1994)Glucocorticoids reciprocally regulate expression of the CCAAT/enhancer- binding protein a and d genes in 3T3-L1 adipocytes and white adipose tissue J Biol Chem 269, 19041– 19047.

46 Ferrini, J.B., Rodrigues, E., Dulic, V., Pichard-Garcia, L., Fabr, J.M., Blanc, P & Maurel, P (2001) Expression and DNA-binding activity of C/EBPa and C/EBPb in human liver and differentiated primary hepatocytes J Hepatol 35, 170–177.

47 Yamada, K., Duong, D.T., Scott, D.K., Wang, J.C & Granner, D.K (1999)CCAAT/enhancer-binding protein beta is an acces-sory factor for the glucocorticoid response from the cAMP response element in the rat phosphoenolpyruvate carboxykinase gene promoter J Biol Chem 274, 5880–5887.

48 El-Sankary, W., Bombail, V., Gibson, G.G & Plant, N (2002) Glucocorticoid-mediated induction of CYP3A4 is decreased by disruption of a protein:DNA interaction distinct from the preg-nane X receptor response element Drug Metab Dispos 30, 1029– 1034.

49 Croniger, C., Leahy, P., Reshef, L & Hanson, R.W (1998) C/EBP and the control of phosphoenolpyruvate carboxykinase gene transcription in the liver J Biol Chem 273, 31629–31632.

50 Crosson, S.M & Roesler, W.J (2000)Hormonal regulation of the phosphoenolpyruvate carboxykinase gene Role specific CCAAT/enhancer-binding protein isoforms J Biol Chem 275, 5804–5809.

51 Pascussi, J.M., Drocourt, L., Fabre, J.M., Maurel, P & Vilarem, M.J (2000)Dexamethasone induces pregnane X receptor and retinoid X receptor-a expression in human hepatocytes: synergistic increase of CYP3A4 induction by pregnane X receptor activators Mol Pharmacol 58, 361–372.

Ngày đăng: 17/03/2014, 09:20

TỪ KHÓA LIÊN QUAN

TÀI LIỆU CÙNG NGƯỜI DÙNG

TÀI LIỆU LIÊN QUAN

🧩 Sản phẩm bạn có thể quan tâm