Distribution of the lipolysis stimulated receptor in adult andembryonic murine tissues and lethality of LSR–/– embryos at 12.5 to 14.5 days of gestation Samir Mesli1, Sandrine Javorschi1
Trang 1Distribution of the lipolysis stimulated receptor in adult and
embryonic murine tissues and lethality of LSR–/– embryos
at 12.5 to 14.5 days of gestation
Samir Mesli1, Sandrine Javorschi1,†, Annie M Be´rard1, Marc Landry2, Helen Priddle3, David Kivlichan3, Andrew J H Smith3, Frances T Yen4, Bernard E Bihain4and Michel Darmon1
1
Laboratoire de Biochimie et de Biologie Mole´culaire, Universite´ Victor Se´galen Bordeaux 2, France;2INSERM E358, Universite´ Victor Se´galen Bordeaux 2, France;3Gene Targeting Laboratory; Center for Genome Research, University of Edinburgh, Scotland;
4
Laboratoire Me´decine et The´rapeutique Mole´culaire, Vandoeuvre-les-Nancy, France
The lipolysis stimulated receptor (LSR) recognizes
apo-lipoprotein B/E-containing apo-lipoproteins in the presence of
free fatty acids, and is thought to be involved in the clearance
of triglyceride-rich lipoproteins (TRL) The distribution of
LSR in mice was studied by Northern blots, quantitative
PCR and immunofluorescence In the adult, LSR mRNA
was detectable in all tissues tested except muscle and heart,
and was abundant in liver, lung, intestine, kidney, ovaries
and testes During embryogenesis, LSR mRNA was
detectable at 7.5 days post-coitum (E7) and increased up to
E17 in parallel to prothrombin, a liver marker In adult liver,
immunofluorescence experiments showed a staining at the
periphery of hepatocytes as well as in fetal liver at E12 and
E15 These results are in agreement with the assumption that
LSR is a plasma membrane receptor involved in the
clear-ance of lipoproteins by liver, and suggest a possible role in
steroidogenic organs, lung, intestine and kidney) To explore the role of LSR in vivo, the LSR gene was inactivated in 129/ Ola ES cells by removing a gene segment containing exons 2–5, and 129/Ola-C57BL/6 mice bearing the deletion were produced Although heterozygotes appeared normal, LSR homozygotes were not viable, with the exception of three males, while the total progeny of genotyped wild-type and heterozygote pups was 345 Mortality of the homozygote embryos was observed between days 12.5 and 15.5 of ges-tation, a time at which their liver was much smaller than that
of their littermates, indicating that the expression of LSR is critical for liver and embryonic development
Keywords: lipoprotein receptors; Northern-blot; quantita-tive PCR; immunofluorescence; gene-targetting
Lipids, absorbed exogenously by the intestine and
synthe-sized endogenously by the liver, are secreted into the
circulation as lipoproteins for their transport to tissues,
where they are used mainly for membrane synthesis,
steroidogenesis and fat storage Dietary cholesterol,
phos-pholipids, triglycerides (TG) and fat-soluble vitamins
absorbed by the intestine after a meal are transported by
chylomicrons into lymph, then into blood Lipoprotein
lipase (LPL), anchored to the surface of capillary
endothe-lium, hydrolyzes TG of chylomicrons into free fatty acids (FFA) that are taken up by the underlying muscle and adipose tissues Chylomicron remnants are then taken up by the liver [1] Transport of lipids to tissues is achieved by very low density lipoproteins (VLDL) and low density lipo-proteins (LDL) Excess cholesterol is removed from the peripheral cells by high density lipoproteins (HDL) that are able to return it to the liver for excretion via the LDL receptor (LDLR) or the scavenger receptor class BI (SR-BI) path-ways In the same way, HDL are also involved in the delivery
of cholesterol to certain tissues, mainly steroidogenic organs Apolipoprotein (apo) B and E containing-VLDL and chylomicron remnants bind with high affinity to the LDLR and the LDL receptor related protein (LRP) that mediates endocytosis of both particles However, another plasma membrane lipoprotein receptor genetically distinct from the LDLR and LRP, called the lipolysis-stimulated receptor (LSR) may also be involved in the clearance of TRL [2,3] The LSR was originally identified by its ability to bind LDL in the presence of FFAs [4] LSR polypeptides (85 and
115 kDa) were identified by ligand blotting in the presence
of oleate in fibroblasts isolated from a patient with familial hypercholesterolemia [2] Three bands of 90, 115, and
240 kDa were found when solubilized rat liver membrane proteins were used as a substrate [5] When antibodies inhibiting LSR function were used for Western blotting, the
Correspondence to Y M Darmon, Universite´ Victor Se´galen
Bor-deaux 2, Laboratoire de Biochimie et de Biologie Mole´culaire, Zone
Nord – Case 49–146, Rue Le´o Saignat, 33076 Bordeaux Cedex,
France Fax: + 33 5 57 57 1397, Tel.: + 33 5 57 57 15 79.
E-mail: darmon@u-bordeaux2.fr
Abbreviations: apo, apolipoprotein; FFA, free fatty acids; GAPDH,
glyceraldehyde-3-phosphate dehydrogenase; HDL, high density
proteins; LDL, low density lipoproteins; LDLR, low density
lipo-protein receptor; LRP, low density lipolipo-protein receptor related
protein; LSR, lipolysis stimulated receptor; SR-BI, scavenger receptor
BI; TG, triglycerides; TRL, triglyceride-rich lipoproteins; VLDL, very
low density lipoproteins.
Present address: Invitrogen Corp 1610 Faraday Avenue, Carlsbad,
CA 92008, USA.
(Received 1 April 2004, revised 6 May 2004, accepted 19 May 2004)
Trang 2same three bands were detected Molecular cloning of the
LSR allowed the authors to identify putative translation
products of 58.3, 63.8, and 65.8 kDa The combination of
various techniques suggested that the receptor was a
multimer of subunits associated through disulfide bridges
[5] Several characteristics of LSR suggest that it might
represent a significant element for the clearance of TRL: (a)
LSR is able to bind lipoproteins containing apoB and apoE;
(b) LSR displays high affinity for TRL; (c) LSR binding is
inhibited by lactoferrin, receptor associated protein (RAP),
and apoCIII, all reported to have a hyperlipemic effect in
animals [2,3] [6,7]; (d) the apparent number of LSR binding
sites expressed at the surface of hepatocytes correlates
negatively with plasma triglyceride levels measured in the
postprandial stage [3]
The present work was undertaken to determine the
distribution of LSR mRNA and protein in murine organs,
and whether this distribution was compatible with the
alleged role of this new receptor as a lipoprotein receptor It
was found that LSR was not only expressed in liver (adult
and fetal), but also in steroidogenic organs (ovaries, testes,
and adrenal glands), lung, intestine, kidney and brain To
explore further the role of LSR, the gene was inactivated in
ES cells and a strain of transgenic LSR knockout mice was
established However, from a total progeny of 345 mice
derived from intercrossing LSR heterozygote (LSR+/–)
animals, only three viable homozygote (LSR–/–) animals
were obtained, so that a comprehensive description of their
phenotypic defects was impossible to produce Most
LSR–/–mutants die in utero between embryonic days 12.5
(E12.5) and E15.5 At E14.5, LSR–/– mutant mice livers
were found to be much smaller than that of their littermates
Therefore, inactivation of LSR appears to be lethal at the
embryonic stage, probably secondary to liver involution
Materials and methods
Animals used for expression studies
Normal C57Bl/6, 129/Sv, and MF1 mice were obtained
from CERJ (Le Genest Saint-Isle, France) They were
housed in a specific pathogen-free animal facility on a 12-h
light : 12-h dark cycle, with free access to food and water
The research protocol was in accordance with French
Ministry of Agriculture, section of Health and Animal
Protection (approval 04476)
Northern blots
Mouse embryo and adult multiple tissue Northern blots were
performed with nylon membranes blotted to gels loaded with
2 lg mRNA per lane (Clontech, Saint-Quentin en Yvelines,
France) They were prehybridized for 30 min at 68C in
Express Hyb TM hybridization solution (Clontech) and then
hybridized for 2 h at 68C with the same solution
supple-mented with the appropriate radiolabeled cDNA probes
The glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
probe (500 bp fragment) was prepared by NotI and EcoRI
digestion of the murine cDNA inserted in PT7T3d plasmid
(IMAGE clone 113843, UK HGMP Resource Centre,
Cambridge, UK) The LSR probe (full length 2 kb insert)
was prepared by EcoRI digestion of the murine cDNA
inserted in pGEMT-easy 5Zf(–) (a gift from Genset, La Jolla,
CA, USA) Probes were labeled by decanucleotide-mediated incorporation of [32P]dCTP[aP] (Ambion, Montrouge, France) Blots were rinsed three times with 2· NaCl/Cit, 0.05% SDS at room temperature for 30 min and washed twice with 0.1· NaCl/Cit, 0.1% SDS at 50 C for 40 min with agitation Autoradiography was performed by expo-sure for 2 h in a PhosphorImager (Molecular Dynamics, Amersham–Pharmacia–Biotech, Orsay, France)
Real-time RT-PCR Mouse tissues were pooled from 4 to 5 mice on a standard diet Samples were immediately put into Trizol (Gibco BRL, Cergy-Pontoise, France) and stored at )80 C pending RNA isolation Total RNAs were isolated accord-ing to the manufacturer’s instructions The amount of RNA was determined by measuring absorption at 260 nm The quality of the isolated RNA was controlled by the 260/
280 nm ratio (1.8–2.0)
cDNAs were obtained by reverse-transcription of 1 lg total RNAs prepared from C57BL/6 mouse tissues RNAs were first treated by RQ1 RNase-Free DNase (Promega, Charbonnie`res, France) First strand cDNA synthesis was performed in a 20 lL mixture using the GeneAmp RNA PCR kit (Applied Biosystems, Courtaboeuf, France) For some tissues, total cDNAs were also obtained from Clontech Specific primers and TaqMan probes were designed using thePRIMER EXPRESS1.0 software (Applied Biosystems) and synthesized by Genset (Paris, France) Each probe was double-labeled with the fluorescent reporter dye, 6-carb-oxyfluorescein (FAM), covalently linked to the 5¢-end of the probe and the quencher dye, 6-carboxytetramethylrhodam-ine (TAMRA), attached to the 3¢-end Quantitative PCR was performed in 96-well reaction plates with optical caps Fluorescence was followed continuously for each reaction Real-time quantitative RT-PCR analyses were performed in
an ABI PRISM 5700 sequence detection system instrument (Applied Biosystems) The reaction mixture contained an amount of cDNA corresponding to 100 ng of reverse-transcribed total RNA, 300 nMsense and antisense primers (except for GAPDH, 120 nMof each) and 200 nMprobe in a final volume of 25 lL using the TaqMan PCR mix (Applied Biosystems) Relative quantitation of a given gene was calculated after normalization to 18S ribosomal RNA amount for tissues from which RNAs were isolated (liver, ovaries, adrenal glands, testes, intestine, brain, muscle), or GAPDHamount for tissues for which total cDNA were purchased (liver, lung, kidney, heart) Individual CTvalues are means of duplicate measurements Delta CT were converted to arbitrary values with the formula: arbitrary units¼ 2)dCT· 106assuming an efficiency of amplification
of 100% Results are expressed as the mean of two experiments The complete list of gene-specific primers and probes can be found in Table 1 It must be noted that the quantitative PCR was designed to detect the sum of all transcripts of LSR
Antibodies and immunocytochemistry The anti-LSR Ig used for this study was a gift from Genset (La Jolla, CA, USA) [5] The antiserum raised in New
Trang 3Zealand rabbits was able to inhibit the in vitro binding of
LDL to LSR preparations In Western blots or
immuno-precipitations it recognized the same bands that were
identified by ligand blotting (90, 115 and 240 kDa) and
by Western blotting Negative controls were prepared by
substituting the anti-LSR serum by nonimmunized or
irrelevant rabbit sera In some experiments, tissues from
surviving male homozygous LSR knockout mice were
included as negative controls
Adult mouse tissues and post implantation embryos
(E12.5 and E15.5) were fixed in 4% paraformaldehyde
overnight, freezed in Tissue-Tek (Labonord, Templemars,
France) and sectioned with a cryotome (10 lm sections)
onto Superfrost coated slides (Labonord)
Tissues were incubated for 30 min in phosphate-buffered
saline (NaCl/Pi) containing 0.5% bovine serum albumin
(BSA), washed 3· with NaCl/Piand incubated in anti-LSR
serum (1 : 10 in NaCl/Pi/BSA) for 2 h at 37C The sections
were washed in NaCl/Pi and incubated with
fluorescein-conjugated goat anti-rabbit IgG (Molecular
Probes/Inter-chim, Montluc¸on, France) 1 : 200 in NaCl/Pi-BSA for 1 h at
37C The sections were then washed 3· in NaCl/Pibefore
mounting in ProlongTMAntifade (Molecular
Probes/Inter-chim) Slides were examined with a Leica photomicroscope
using appropriate filter systems Photographs were taken on
Kodak films (Amersham–Pharmacia–Biotech)
Gene targeting of theLSR gene and generation
of LSR deficient mice
The murine (C57BL/6) LSR gene contains 10 coding exons
with an open reading frame of 1782 nuclotide long encoding
a peptide of 594 amino acids (F T Yen & B E Bihain,
unpublished results) A129/Ola mouse genomic lambda
2001 library was screened with a full length LSR cDNA
probe to isolate cloned DNA for the targeting vector
construction Several overlapping phage clones, which
together covered the most part of the gene, were isolated and inserts sequenced This sequence (GenBank AY376636) contained the first eight exons and ends 19 bp before the end of exon 9 of the LSR gene; it lacks all of intron 9 and exon 10 Altogether this sequence lacks the portion coding for the last 17 amino acids of LSR A replacement targeting vector (map, Fig 1) was designed subsequently to create
a null allele by deletion of an internal region of the gene between the 5¢-end of exon 2 and the 3¢-end of exon 5 and its substitution with a reporter (b-galactosidase) and selection marker (neomycin resistance) This vector was comprised
of left and right homology arms, which consisted of 2.65 kb
of cloned genomic DNA sequence containing the 5¢-part of exon 2, intron 1, exon 1 and its 5¢-flanking noncoding sequence, and 2.7 kb of sequence containing the 3¢-part of exon 5 and 3¢-flanking intron 5 sequence, respectively These were inserted into a pBluescript plasmid, with the exon 2 and 5 sequences joined via a BamHI linker The reporter/selection cassette TAG3/IRES lacz/ SV40pA/MC1neo/pA [8] was inserted into the BamHI linker site A MC1-tk dimer cassette [9] was appended to the end of the 5¢-homology arm at a SalI site for negative selection [10] The vector was linearized with NotI, and E14TG2a embryonic stem cells cultured according to standard conditions [11] were electroporated and selected
in G418 and ganciclovir Resistant ES cell clones were picked into 96-well plates, and replica plated subsequently for freezing and DNA preparation ES cell clone DNAs were screened by Southern blot analysis using HindIII digestion and hybridization with probes flanking and external to the vector homology arms (Fig 1) Clones targeted correctly at both 5¢- and 3¢-sides were detected at a frequency of 12% Targeted ES cells were injected into C57BL/6 blastocysts and the resulting male chimeras subsequently test-crossed with C57BL/6 females Germline transmission from chimeras derived with two independent targeted clones was confirmed in agouti coat colored
Table 1 Sequences of primers and probes used for real-time PCR with the TaqMan system NC, sequences not communicated by Perkin Elmer mRNA Upstream primer (5¢fi3¢) Probe (5¢fi3¢) Downstream primer (5¢fi3¢) Amplicon size (bp)
(exons 6–7) LDLR
X64414
ctgtccccccaagacgtg caagtgcatctccccgcagtttgtgt ccatctaggcaatctcggtctc 102
(430–531of 4467) LRP
AF074265
gtcccattggctttgagctc tcgaggagagcggatatcagacgcatatc gccacattgttgttgtttgtttc 124
(1926–2049 of 5521) SRB1
U37799
(520–650 of 1785) ApoB
M35186
cgtgggctccagcattcta ccaatggtcgggcactgctcaa tcatttctgcctttgcgtcc 65
(771–835 of 2354) ApoE
D00466
attacctgcgctgggtgc tgaccaggtccaggaagagctgca gtcagttcttgtgtgacttgggag 79
(134–212 of 936 CDS) Apo A1
X64262
gacactctgggttcaaccgttagt ctgcaggaacggctgggccc ttcctctaggtccttgttcatctcc 126
(268–393 of 924) Prothrombin
X52308
tacatagacgggcgcatcg agggctgggacgctgagaagggtat aaaaagcatcacctgccagg 72
(1084–1155 of 2031) Ubiquitin
X51703
ggtggctattaattattcggctg attcccagtgggcagtgatggcattac gggcaagtggctagagtgca 75
(1010–1084 of 1172)
Trang 4test-cross offspring by Southern blot analysis of DNA
obtained from tail biopsy Male and female test-cross
offspring heterozygous for the null allele were intercrossed
to obtain formal proof of the creation of the null allele and
for preliminary phenotypic assessment The LSR deficient
strain was maintained by back-crossing heterozygous males
with C57BL/6, 129/Sv and MF1 females at each generation
Mice at back-cross generation 1–6 were intercrossed to
provide the homozygous null, heterozygous null and
wild-type mice used in the analyses described herein
Animal breeding and experiments were carried out in
accordance with the European Communities Council
Directive of 24 November 1986
Genotyping ofLSR and neo genes by PCR For PCR, genomic DNA from embryos and adult mouse tails was extracted by proteinase K digestion, isolated using the Genomic DNA Purification Kit (Promega, Charbonnie`-res, France) and precipitated with ethanol PCR primers were selected to generate a product specific for either the wild-type or the mutant LSR allele The wild-type LSR allele was diagnosed by a 773-bp PCR product generated by
a forward primer located in exon 4 (5¢-CAGGACC TCAGAAGCCCCTGA-3) and a reverse primer located
in exon 5 (5¢-AACAGCACTTGTCTGGGCAGC-3¢) This region of the LSR gene is deleted in the mutant allele The
Fig 1 Generation of the LSR null allele (A) Structure of the mouse LSR gene (top), the linearized LSR targeting vector (middle) and the targeted allele (bottom) resulting from replacement recombination The null allele was created by deletion of a 9.8 kb internal region of the gene from the beginning of exon 2 to the end of exon 5 and its substitution with a b-galactosidase/neomycin phosphotransferase reporter/selection cassette Dashed crosses indicate the recombination cross-over positions between homologous vector and chromosomal sequence Chromosomal and cloned genomic DNA sequence is shown by a thick black line (for intron and flanking noncoding sequence) and by black rectangles (for exon sequence), the reporter/positive selection cassette by IRESlaczpA and grey (loxP/MC1neopA loxP)1) rectangles, the HSV thymidine kinase negative selection cassette (MC1tk dimer) by a rectangle and pBluescript plasmid sequence by a thin black line Sites for HindIII restriction enzyme (H) are indicated
by small arrows and the sizes of relevant restriction fragments in the wild-type and targeted allele are shown by dotted lines The targeted allele was identified by HindIII digestion and hybridization with the 5¢- and 3¢-flanking probe fragments (striped rectangles) to detect the indicated size fragments (B) Southern blot analysis of HindIII-digested genomic DNA prepared from 96-well plates of G418+ Gancyclovir resistant ES cell clones derived from transfection with the LSR targeting vector The digested DNA and a kHindIII marker was resolved on a 0.6% agarose gel, blotted to positively charged nylon membrane and hybridized with 25 ng of 3¢-probe and 25 ng of kHindIII marker The hybridized blots were exposed to Kodak XOMAT film overnight at )80 C The 3¢-probe detects a 10.5 kb HindIII fragment for the wild-type allele and a 13 kb fragment in a targeted allele.
Trang 5targeted mutant allele was detected by the presence of the
neogene Two couples of neo primers have been used during
the course of this work: (forward: 5¢-GGCGCCCGG
TTCTTTTTGTCA-3¢ and reverse: 5¢-TTGGTGGTCG
AATGGGCAGGT-3¢ giving a product of 281 bp) and
(forward: 5¢-GAGGATCTCGTCGTGACCCATG-3¢ and
reverse: 5¢-GAGGAAGCGGTCAGCCCATT-3¢ giving a
product of 179 bp) For the wild-type LSR gene, conditions
were (94C for 30 s, 63 C for 1 min, 72 C for 30 s; 35
cycles For the neo gene, PCR conditions were: 95C for
30 s, 68C for 1 min, and 72 C for 30 s; 33 cycles In both
cases, PCR cycles were preceded by 10 min at 95C and
ended by 7 min at 72C
Results
To obtain insight on the possible function(s) of LSR, we
first determined the tissue distribution of its mRNA in
organs of adult mice in comparison with that of mRNA of
other lipoprotein receptors or apolipoproteins We also
determined the amount of LSR mRNA at different time
points of embryonic development
Northern blots
Figure 2A shows a Northern blot of selected adult murine
tissues hybridized with an LSR probe As expected from
results obtained in the rat [5], a 2.1 kb band was observed
in liver A faint but clean band was also observed in testis
and kidney Hybridization with a GAPDH probe showed
unequal loading of the commercial membrane and
partic-ularly that the liver lane was overloaded Quantitation of the
amount of LSR mRNA was thus performed after
normal-ization of the radioactivity of the LSR bands to that of the 1.35 kb GAPDH band Data showed that testes and kidney contained, respectively, 63% and 48% of the signal present
in liver Figure 2B shows a Northern blot containing mRNA from whole embryos at stages E7, E11, E15, and E17 hybridized with an LSR probe and reprobed with a GAPDHcDNA The 2.1 kb LSR band was detected at all stages Again, loading of the lanes was unequal making direct quantification difficult As in the case of adult tissues,
we normalized LSR bands to the corresponding 1.35kb GAPDH bands Ratios were approximately equal at all stages, indicating that the LSR expression level was of the same order of magnitude between E7 and E17
Real-time quantitative RT-PCR
In a first selection of tissues (liver, ovaries, adrenal glands, testes, intestine, brain and muscle), LSR mRNA was extracted as described in Materials and methods Results obtained by real-time quantitative RT-PCR were normal-ized to the amount of 18S ribosomal RNA (Fig 3A and Table 2) Quantitative PCR was also performed on lung, kidney and heart samples, but in that case the starting material was commercially available total cDNA For those tissues, data were normalized to the amount of GAPDH mRNA (Fig 3B and Table 3)
Liver cDNAs were obtained from both the mRNA extracted in our laboratory and from the commercial source
in order to allow us to compare the two sets of experiments Figure 3A and Table 2 show that LSR mRNA is very abundant in liver, as expected from the Northern blot analysis We also found a significant expression in ovaries and testes (respectively 62.8%, and 21.7% of liver), but the
Fig 2 Northern blots of adult murine tissues
(A) and whole embryos (B) mRNAs E7, E11,
E15, E17: embryo stages (days post-coitum).
The LSR probe reveals a 2.1 kb band, and the
GAPDH probe a 1.35 kb band and (in some
tissues) a 1.2 kb band.
Trang 6amount in adrenal glands was only 4% of that of liver.
A substantial expression was found in intestine and brain
(respectively 41.9% and 15.9% of liver) The expression in
muscle was very low (0.5% of liver) Figure 3B and Table 3
show that LSR mRNA is rather abundant in lung and
kidney (55.8% and 11.8% of liver) but barely detectable in
heart
The distribution of several gene mRNA involved in
lipoprotein metabolism was studied comparatively as an
attempt to get some insight into the possible functions of
LSR The tissue distribution of LDLR mRNA (Tables 2 and
3) is not very different from that of LSR mRNA, with two
notable exceptions: (a) it was more abundant in adrenal
glands and ovaries than in liver (respectively 200%, and
180% of liver); (b) it was abundant in muscle (41.2% of liver)
The pattern of expression of SR-BI mRNA (Tables 2 and 3) was rather different from that of LSR mRNA: (a) it was extremely abundant in adrenal glands and ovaries (respect-ively 46.5-fold and 18-fold the amount present in liver); (b) expression in testes, brain and muscle was rather abundant (respectively 115%, 122.2% and 55.8% of the amount present in liver)
The tissue distribution of LRP mRNA in adult mice (Tables 2 and 3) was also very different from that of LSR: its amount in ovaries, adrenal glands, brain and muscle was higher than that of liver (respectively 410%, 190%, 180%, and 250% of the amount present in liver)
Although RT-PCR arbitrary units do not reflect precisely true message amounts, due to the different amplification efficiencies for different gene targets, taken altogether, the results suggest that the amount of LSR messengers in liver is higher than that of the other receptors here described It must be noted that Fig 3A and B have different scales because one was normalized
to 18S ribosomal RNA and the other to GAPDH mRNA
Several mRNA species were used as controls for tissue-specific expression As expected, prothrombin mRNA was almost exclusively expressed in liver; apoA1 and apoB mRNA were expressed mainly in liver but also in intestine; apoEmRNA was predominant in liver but abundant in all tissues; ubiquitin and GAPDH mRNA were ubiquitous, and showed important variations of expression from one tissue to another
The expression of LSR was also studied by quantitative PCR during mouse embryonic development cDNAs from whole embryos at E7, E11, E15, E17 stages were used as starting material and results were normalized to GAPDH mRNAs Figure 3C shows that LSR was detectable at E7, became more abundant at E11 (fourfold increase) and maintaining these increased levels until E17 This pattern of expression seems to parallel liver growth as a similar time-course was observed for prothrombin Table 4 shows that in contrast, LDLR and SR-BI mRNA had different time-courses with a higher amount at E7, followed by a decrease
at E11 and an increase at E15 LRP showed a time-course similar to that of LSR except for a decrease at E17; apoA1, apoBand ubiquitin showed a time-course similar to that of LRP
Immunofluorescence
To localize the LSR receptor itself, different murine tissues were studied by indirect immunofluorescence with an anti-LSR antiserum To avoid misinterpretations due to back-ground, two normal rabbit sera were systematically included
in the labeling experiments Moreover, tissues from LSR knockout mice were also tested with the LSR anti-serum Figure 4A,B shows the presence in adult liver of a strong specific signal at the periphery of hepatocytes This staining pattern is compatible with the previously described localization of LSR at the plasma membrane level [5] The presence of LSR could also be detected in fetal liver cells in E12 and E15 embryos (data not shown) A faint but specific staining was detected in kidney Fig 4E The signal was observed in the kidney cortex, mainly at the level of glomerules
Fig 3 Quantitation of LSR mRNA by real-time PCR in adult murine
tissues (A,B) and whole post-implantation embryos (C) Data were
normalized to 18S ribosomal RNA (A) and to GAPDH mRNA (B, C).
dC T were converted to arbitrary values by the following formula:
2)dCT · 10 6 Liver (L), ovaries (o), adrenal glands (a), testes (t),
intes-tine (i), brain (b) and muscle (m), lung (lu), kidney (k) and heart (h).
E7, E11, E15, E17: Embryo stages (days post-coitum).
Trang 7Knock-out of theLSR gene Mice with one LSR allele inactivated did not show any detectable defect Their size, weight, adiposity, plasma glucose, cholesterol, triglycerides, phospholipids, nonesteri-fied fatty acids, free glycerol, as well as their lipoprotein profile were similar to those of their wild-type littermates Animals bearing two inactivated LSR alleles (LSR–/–) show an embryonic lethality between E12.5 and E15.5 As
an attempt to define the reason for the embryonic lethality
of LSR–/– embryos, timed matings were set up and resulting embryos examined and genotyped (Table 5 and Fig 5) Up to E12.5, LSR–/– mice were obtained in numbers compatible with Mendelian ratios, and macro-scopic examination of the whole litters showed that all embryos were alive and had no observable anomalies But
at E15.5, genotyping did not show the presence of viable homozygote embryos Resorbed embryos were numerous at E14.5/15.5 and the majority were most probably LSR–/–, but we were not able to genotype them because of DNA degradation At E14.5, some litters contained LSR–/– embryos Their only constant defect was a reduction in liver size (Fig 6A); in some embryos, the liver was reduced to a punctiform red spot (not shown) Histological sections of E14.5 LSR–/– embryos showed that the cell density was lower than in the wild-type littermates Spaces devoid of cells were observed, but no specific cellular abnormalities or absence of certain cell types were observed in the liver of the mutants For example, megacaryocytes, although rare (Fig 6E), could be found in LSR–/– embryos (not shown) LSR–/– embryos had other anomalies but they were not constant: a general white coloration, while the LSR+/+ and LSR+/– littermate embryos had a pinkish hue; superficial hemmorrhages (Fig 6A), superficial detachment
of the skin (Fig 6A); a smaller size than their littermates and finally some of them were obviously dead Interestingly homozygote embryos did not show an overall developmen-tal delay, as shown by limb bud, eye and facial development (Fig 6A)
During the last three years, no viable adult LSR–/– was obtained by intercrossing LSR+/– mice However in the very first litters obtained by intercrossing male LSR+/– derived from the chimeras with female LSR+/– derived
Table 2 Quantitation of LSR, LDLR, SR-BI, LRP, apoA1, apoB, apoE, ubiquitin, prothrombin, and GAPDH mRNAs by real-time PCR in a first set
of adult murine tissues For each gene, results were normalized to 18S ribosomal RNA dC T were converted to arbitrary values by the following formula: 2)dCT · 10 6
mRNA
Tissue
Table 3 Quantitation of LSR, LDLR, SR-BI, LRP, apoA1, apoB,
apoE, ubiquitin, and prothrombin by real-time PCR in a second set
of adult murine tissues For each gene, results were normalized to
GAPDH mRNA DC T were converted to arbitrary values by the
following formula: 2)dCT · 10 6
mRNA
Tissue
Ubiquitin 2060 000 6770 000 966 000 63700
Table 4 Quantitation of LSR, LDLR, SR-BI, LRP, apoA1, apoB,
apoE, ubiquitin and prothrombin by real-time PCR in whole
post-implantation embryos For each gene, results were normalized to
GAPDH mRNA DC T were converted to arbitrary values by the
fol-lowing formula: 2)dCT · 10 6
Embryo stages (days post-coitum.): E7, E11, E15, E17.
mRNA
Age
Adult Liver
ApoE 12 600 30 800 277 000 578 000 1 5700 000
Ubiquitin 979 000 1 580 000 3 030 000 1 060 000 2 060 000
Prothrombin 13.6 2670 40 900 114000 901 000
Trang 8from the first generation, or intercrossing male and female
LSR+/–mice derived from the first generation, three viable
LSR–/–mice (all males, two from one litter, and one from
another) were obtained They had no morphological defects
except that one of them seemed to have no testes They were smaller than their littermates: the 9-month weight of LSR–/– was 30.7 ± 0.2 vs 39.3 ± 2.1 g for their wild-type litter-mates (P < 0.02) Continual matings for 3 months demon-strated that these mice were sterile As one of the LSR–/– mice died spontaneously and the others became sick (lethargic), we killed these two animals for necropsy and collection of organ samples; they both showed a limited amount of fat and one of them actually had no testes, but no other anatomical defect was detected To explore whether the genetic background could influence the viability of LSR–/– mice, we backcrossed the mutations in two inbred strains (C57BL/6 and 129/Sv) and an outbred strain (MF1); we also intercrossed heterozygotes of C57BL/6 and 129/Sv back-grounds, but no viable LSR–/– mice were obtained
Discussion
In this study, we used Northern blotting, real-time PCR and immunofluorescence microscopy to examine the expression
of LSR in the adult mouse and during development In the adult, the highest levels of LSR expression were found in liver as expected from results obtained in the rat [5] Several reports published by Bihain and colleagues [2–5] have provided circumstantial evidence for a role of LSR in the
Fig 4 Immunolocalization of LSR in liver and kidney (A,B,C,E) anti-LSR serum, (D,F) normal rabbit serum Specific staining is observed at the periphery of hepatocytes of adult liver (A,B) No signal was observed in liver from one LSR–/– mouse (C) Specific staining is also found in kidney cortex (E) principally at the level of glomeruli (arrows).
No staining was detected in liver (D) and kidney (F) treated with normal rabbit serum Bar in (F) relates to 20 lm (A,C,D,E,F) and
6 lm (B).
Table 5 Embryos obtained by intercrossing LSR+/– mice Embryos
were genotyped as shown in Fig 6 Living LSR–/– embryos were
found at E10.5 and E12.5 and were apparently normal LSR–/–
embryos could not be found at E15.5 At E14.5, living LSR–/–
embryos were found but had all a small liver (Fig 6A) Moreover, one
litter contained two dead LSR–/– embryos with a punctiform liver.
Genetic
No of embryos
No of litters
LSR mutants
a Dead embryos.
Trang 9clearance of TRL by the liver The LDLR and the LRP
have both been shown to be involved in the removal of
chylomicron remnants by the liver [12,13] The facts that
mice with an isolated inactivation of the LDLR show no
increase in circulating TG [14], and that the lack of LDLR
in humans does not lead to a pathological change in the
metabolism of dietary fat [15] suggest that (an)other
receptor(s) play(s) the major part in TRL clearance by the
liver Moreover, Rohlmann et al [16] demonstrated that the
absence of LRP expression in the livers of LDLR-deficient
mice resulted in a large elevation in the plasma
concentra-tion of cholesterol and TG that were carried in apo
B48-containing lipoproteins resembling remnants Nevertheless,
in LDLR-deficient mice the increase in TG levels was much
smaller than that obtained in RAP overexpression
experi-ments [17] The authors concluded that the most probable
explanation is that RAP-sensitive receptors such as LSR [7]
could be involved in TRL clearance Actually, our real-time
PCR data indicate that in liver, LSR mRNA is expressed
as well as LDLR and LRP mRNA, suggesting that the
newcomer receptor could indeed play an important role in
TRL clearance by the liver Moreover, the abundance of
LSR in liver contrasts with its almost complete absence in
skeletal muscle and heart In that respect LSR differs
strikingly from the VLDL receptor which is very abundant
in these latter tissues and is involved together with LPL in fatty acid uptake by striated muscle [18] Thus, our data indicate that LSR could be specialized in the uptake of TRL
by liver as suggested by its discoverers [5] The demonstra-tion of this hypothesis would require an analysis of the lipoprotein phenotype of a sufficient number of adult LSR–/– mice (for instance after designing a liver-specific inducible inactivation of the LSR gene)
Recent studies have suggested that cholesterol plays a crucial role in specific processes during embryonic develop-ment Cholesterol deficiency during embryogenesis can be caused by defects in apolipoproteins, enzymes or cell-surface receptors that are potentially involved in cellular lipoprotein uptake, either by cells of the yolk sack or the placenta or by the embryo itself [19] We have studied LSR expression during late embryogenesis in comparison with other lipoprotein receptors which are known to play an important role in embryonic development, and with prothrombin, a liver-specific marker Due to unequal loading
of the lanes, Northern blots were not sensitive enough to show significant changes in LSR expression between E7 and E17 However real-time PCR showed that LSR mRNA is detectable at E7, becomes abundant at E11 (fourfold increase) and remains practically constant until E17 This can be attributed to liver organogenesis which follows a similar time-course [20] Moreover, LSR protein was detected by immunofluorescence in dissected fetal livers of E12 and E15 mice Although our real-time PCR data show that all lipoprotein receptors tested follow roughly similar time-courses between E11 and E17, LSR and LDLR are probably the only receptors, among those tested to be present in fetal liver in substantial amounts Actually previous reports show that (a) the LDLR is present in rat liver from E19 fetuses at 19% of the adult level; (b) hepatic LRP is still low at 19 days of gestation (only 6% of the adult level) [21] and (c) SR-BI is not detectable in embryonic liver until stage E17 [22] The increased SR-BI mRNA synthesis that we observed between E11 and E15 is probably due to adrenal gland organogenesis [22] Fetal liver has been shown
to synthesize and export into the fetal circulation about one-half of the cholesterol required for heart, lung and kidney development [21, 23] The early expression of LSR in fetal liver suggests that this receptor could play a role in the uptake of lipoproteins during embryogenesis, a process that cannot be effected by SR-BI at this stage [22] The scarcity
of LSR messages at E7 contrasts with the high expression at that stage of the other lipoprotein receptors which are involved in exchanges between the embryo and extraem-bryonic and maternal tissues For example, SR-BI present
on the apical surfaces of visceral endodermal is thought to provide cholesterol to extraembryonic cells for storage until
it can be subsequently transferred to the embryo [22] Whatever the importance of LSR for post-implantation embryo viability, it must be noted that the abundance of its mRNA increases dramatically during adulthood (Fig 3) It would be interesting to determine whether it is suckling, like
in the case of LRP [21], or weaning, as in the case of LDLR [24], which triggers the increase of LSR seen in liver, as such
an induction would be consistent with a role of LSR in chylomicron remnant metabolism
The lethality of LSR–/– embryos that we observed occurs around E12.5–14.5, a period which is concomittant
Fig 5 Genotyping of embryos obtained by intercrossing LSR+/– mice.
PCR of diagnostic LSR (773 bp) and neo (180 bp) gene regions is
described in Materials and methods LSR –/– embryos (upper 5, 6) are
present at E12.5 but missing at E15.5.
Trang 10with the appearance of specific hepatocyte function in the
fetus [25–27] The fact that LSR–/– embryos’ livers were
smaller (and sometimes punctiform) at E14.5 but normal
size at E12.5 indicates that an atrophy of the liver
occurred after a first period of apparently normal growth
Histological sections of E14.5 LSR–/– embryos actually
showed that the cell density was lower than in the
wild-type littermates; moreover spaces devoid of cells were
observed in the mutants Future studies using time-specific
markers of liver development will be conducted to
compare their time-course in the mutant and the
wild-type mice If the primary effect of the mutation indeed
affects liver development, other defects such as the smaller
size and even lethality of the embryo can be explained by
ischemia, as liver is the major hematopoietic organ at that
stage Inactivations of some lipoprotein receptor genes, for
instance LRP and gp330/megalin, have also been found to
result in embryonic lethality by various mechanisms [28,29]
We found transcripts for all the lipoprotein receptors tested, including LSR, in steroidogenic organs such as adrenal glands, testes and ovaries This is in agreement with results showing SR-BI to be highly expressed in steroido-genic tissues [30,31] which are the sites of the highest specific activity for selective HDL cholesterol uptake in rodents [32] Nevertheless, LSR and SR-BI were expressed differently, more in reproductive organs than in adrenal glands for LSR, and inversely for SR-BI The specific abundance of LSRmRNA in testes suggests that this receptor could play
an important role in this organ However its implication in steroidogenesis is questionable as SR-BI, which has also been detected in testes, seems to mediate phagocytosis of apoptotic spermatogenic cells by Sertoli cells after recogni-tion of surface phosphatidylserine [33,34] In ovaries and
Fig 6 Gross morphology and liver histology of
a typical LSR–/– mutant embryo compared to
a wild-type littermate Lateral views of E14.5 embryos (A,B) The LSR–/– embryo (A) shows a reduction of liver size (white arrow) and displays hemorrhages (black arrow) contrasting with an anemic color It also shows a detachment of dorsal skin (small arrows) The wild-type littermate (B) shows a liver of normal size (white arrows); its skin has
a pinkish hue, distinct subcutaneous vessels and does not show detachment Note that the overall development of the mutant is not dif-ferent from that of the wild-type as shown by embryo size, and limb bud and eye stages Histological sections of livers of E14.5 em-bryos stained with hematoxylin and eosin (C,D,E,F) Note the presence of large inter-cellular spaces (arrow) in the liver of the mutant (C,E) contrasting with the normal architecture of the wild-type liver (D,F) In addition, megacaryocytes were very rare in the mutant liver while they were easily found in the wild-type liver [see arrow on view (F)] Bar
in F relates to 160 lm (C,D) and 40 lm (E,F).