1. Trang chủ
  2. » Luận Văn - Báo Cáo

Báo cáo khoa học: Effect of valine 106 on structure–function relation of cytosolic human thymidine kinase Kinetic properties and oligomerization pattern of nine substitution mutants of V106 ppt

9 448 0
Tài liệu đã được kiểm tra trùng lặp

Đang tải... (xem toàn văn)

THÔNG TIN TÀI LIỆU

Thông tin cơ bản

Định dạng
Số trang 9
Dung lượng 410,6 KB

Các công cụ chuyển đổi và chỉnh sửa cho tài liệu này

Nội dung

Kinetic properties and oligomerization pattern of nine substitution mutants of V106 Hanne Frederiksen*†, Dvora Berenstein† and Birgitte Munch-Petersen Department of Life Sciences and Che

Trang 1

Kinetic properties and oligomerization pattern of nine substitution mutants of V106 Hanne Frederiksen*†, Dvora Berenstein† and Birgitte Munch-Petersen

Department of Life Sciences and Chemistry, Roskilde University, Denmark

Information on the regulation and structure–function

rela-tion of enzymes involved in DNA precursor synthesis is

pivotal, as defects in several of these enzymes have been

found to cause depletion or deletion of mitochondrial DNA

resulting in severe diseases Here, the effect of amino acid 106

on the enzymatic properties of the cell-cycle-regulated

human cytosolic thymidine kinase 1(TK1) is investigated

On the basis of the previously observed profound differences

between recombinant TK1 with Val106 (V106WT) and

Met106 (V106M) in catalytic activity and oligomerization

pattern, we designed and characterized nine mutants of

amino acid 106 differing in size, conformation and polarity

According to their oligomerization pattern and thymidine

kinetics, the TK1mutants can be divided into two groups

Group I (V106A, V106I and V106T) behaves like V106WT,

in that pre-assay exposure to ATP induces reversible

transition from a dimer with low catalytic activity to a tetr-amer with high catalytic activity Group II (V106G, V106H, V106K, V106L and V106Q) behaves like V106M in that they are permanently high activity tetramers, irrespective of ATP exposure We conclude that size and conformation of amino acid 106 are more important than polarity for the catalytic activity and oligomerization of TK1 The role of amino acid

106 and the sequence surrounding it for dimer–tetramer transition was confirmed by cloning the putative interface fragment of human TK1and investigating its oligomeri-zation pattern

Keywords: dimer–tetramer formation; enzyme kinetics; enzyme mutants; structure–function relation; thymidine kinase

Enzymes involved in salvage and metabolism of

deoxy-nucleosides have an important role in the regulation of

DNA precursors for DNA synthesis and repair Recently,

severe syndromes, such as mitochondrial

neurogastrointes-tinal encephalomyopathy and mitochondrial DNA

deple-tion syndrome which lead to multiple mitochondrial DNA

abnormalities, were found to be caused by defects in the cytoplasmic thymidine phosphorylase [1,2] or the two mitochondrial deoxynucleoside kinases: deoxyguanosine kinase (dGK) and thymidine kinase 2 (TK2) respectively [3,4] In contrast with earlier work suggesting spatial and metabolic separation of thymidine phosphate pools between the cytosol and mitochondria [5,6], recent evidence suggests the two compartments are connected by a rapid and dynamic exchange [7] These findings may explain why defects in deoxynucleotide metabolic enzymes, mitochond-rial as well as cytoplasmic, lead to severe mitochondmitochond-rial DNA abnormality syndromes Therefore, it is of great importance to acquire detailed knowledge about the prop-erties of the enzymes involved in balancing the cellular and mitochondrial dNTP pools

Human cytosolic thymidine kinase (TK1; EC 2.7.1.21) is

a salvage pathway enzyme in the synthesis of the DNA precursor dTTP It catalyzes the first step of this pathway, in which thymidine is phosphorylated to dTMP [8] In turn, intracellular dTMP is rapidly phosphorylated to dTTP, an allosteric effector of ribonucleotide reductase [9] Imbal-ances in the dTTP pool are thus followed by an imbalanced supply of the four deoxyribonucleoside triphosphates for DNA synthesis and repair, and result in increased rates of mutation and the probability of carcinogenesis [10] TK1 is cell-cycle regulated and its activity fluctuates with DNA synthesis [11,12] The subunit size of TK1 is 24 kDa [13,14], and the native enzymes purified from human lymphocytes [14] and HeLa cells [15] were found to be tetramers in the presence of ATP In the presence of thymidine instead of

Correspondence to B Munch-Petersen, Department of Life Sciences

and Chemistry, Roskilde University, PO Box 260, DK-4000 Roskilde,

Denmark Fax: + 45 46743011, Tel.: + 45 46742418,

E-mail: bmp@ruc.dk

Abbreviations: dCK, deoxycytidine kinase; dGK, deoxyguanosine

kinase; dNK, multisubstrate nucleoside kinase from Drosophila

mel-anogaster; GST, glutathione S-transferase; HSV1-TK, Herpes simplex

type-1thymidine kinase; TK1, human cytosolic thymidine kinase;

rLy-TK1 Val106 , recombinant TK1expressed from cDNA derived from

human lymphocytes, the same as rLy-TK1(V106WT); rLy-TK166)136,

the putative interface fragment of TK1corresponding to residues

66–136; TK1+ATP, rLy-TK1 incubated and stored with 2.5 m M

ATP/MgCl 2 ; TK1 )ATP, rLy-TK1incubated and stored without

ATP/MgCl 2 ; TK2, human mitochondrial thymidine kinase.

Enzyme: Human cytosolic thymidine kinase (TK1; EC, 2.7.1.21).

*Present address: Institute of Food and Veterinary Research,

Department of Toxicology and Risk Assessment, Mørkhøj Bygade 19,

DK-2860 Søborg, Denmark.

These authors contributed equally to this publication.

Note: A website is available at http://www.ruc.dk

(Received 1March 2004, revised 6 April 2004,

accepted 16 April 2004)

Trang 2

ATP or without substrates present, TK1appears as a dimer

[14] Human TK1 has 234 amino acids, and, in the originally

published primary sequence, amino acid 106 was

methio-nine [16,17] Our group has recently analysed TK1 cDNA

and genomic DNA from 22 normal or transformed cell

lines, and in all cases we found a valine at amino acid

position 106 [18] Also, alignment of mammalian TK1 and

TK from vaccinia virus (Fig 1) demonstrates the presence

of valine at the site corresponding to amino acid 106 in

human TK1, which is located in a highly conserved area

thought to encompass the magnesium-binding and

thymi-dine-binding sites [19,20] We have found a remarkable

difference in catalytic activity between recombinant TK1

expressed from human lymphocyte cDNA, rLy-TK1Val106

(V106WT) and its mutant rLy-TK1Met106 (V106M) [18]

V106WT was a dimer with low catalytic activity (K0.5for

thymidine about 15 lM), but pre-assay exposure to ATP

induced an enzyme concentration-dependent reversible

transition from a dimer to a tetramer with an 30-fold

higher catalytic activity (K0.5 for thymidine  0.5 lM)

[14,18,21] The maximal velocities for the ATP exposed

and unexposed forms were the same In contrast,

irrespect-ive of pre-assay exposure to ATP, V106M was a permanent

tetramer with low K0.5for thymidine ( 0.5 lM) and similar

maximal velocities, which were 2–3-fold lower than that

of V106WT [18,21]

Until recently, the only deoxyribonucleoside kinase with

a known 3D structure solved by X-ray crystallography was

the Herpes simplex virus type-1thymidine kinase

(HSV1-TK) [22–26] In 2001, the X-ray crystallographic structure

was reported for two cellular deoxynucleoside kinases – the

Drosophila melanogaster multisubstrate deoxynucleoside

kinase (dNK) and the human deoxyguanosine kinase

(dGK [27]) – and in 2003 the X-ray crystallographic

structure of the human deoxycytidine kinase (dCK) was

solved [28] The amino acid sequence identity is 34%

between dNK and dGK [29], and 47% between dGK and

dCK [28], and the structures of dNK, dGK and dCK

appeared to be very similar [27,28] Despite the very low

sequence identity of the cellular kinases with the Herpes

virus TK ( 1 0%), the core structures have a similar fold

and there is also a close resemblance to the human and yeast

thymidylate kinases [8,27] Therefore, although the sequence

identity of TK1with HSV1-TK and the other cellular

kinases belonging to the dNK group is too low for a reliable

homology model ( 10%), TK1 may have the same overall

structure as the other nucleoside kinases Furthermore, a

prediction of the secondary structure of TK1[30–32] places

Val106 in the middle of an a-helix which aligns inCLUSTAL

W[33] with one of the interface helices (a-helix 4) of

HSV1-TK This may indicate that the area surrounding Val106 is integrated into the oligomerization interface

To obtain more information about this putative interface region of TK1, we sought to clarify the importance of amino acid 106 for the structure and function of the enzyme by mutating Val106 to amino acids differing in polarity, size and conformation, and subsequently investigating their effect on the quaternary structure and kinetics Further-more, we confirmed that amino acid 106 and the neigh-bouring residues are involved in dimer–tetramer transition

by cloning the putative interface fragment of human TK1, rLy-TK166)136, and investigating the influence of the V106M mutation on the oligomerization properties of this fragment

Materials and methods

Bacterial strains and plasmids The thymidine kinase-deficient strain of Escherichia coli, KY895 [34], and E coli strain BL21were used to propagate bacterial plasmids BL21was used for expression of recombinant TK1enzymes We have previously cloned the entire TK1coding sequence into the BamHI–EcoRI restriction sites of the glutathione S-transferase (GST) fusion vector pGEX-2T, as described in [18] This vector encodes a thrombin cleavage site between the GST gene and the multiple cloning site

Construction of pGEX-2T-LyTK1Val106Xmutants The plasmid pGEX-2T-LyTK1Val106 [18] was used as template DNA for PCR, and mutations in the GTG codon coding for Val106 were introduced with the Quick ChangeTM site-directed mutagenesis kit from Stratagene (according to the instructions of the manufacturer) The sense [5¢-TTTTTCCCTGACATCGTGGAGTTCTGCGA GGCC(358–390)-3¢] and antisense [5¢-GGCCTCGCAGA ACTCCACGATGTCAGGGAAAAA(390–358)-3¢] muta-genic primers were substituted as follows in the target codon for Val106 (bold): GCG/CGC for Ala106, CAG/CTG for Gln106, GGT/ACC for Gly106, CAC/GTG for His106, ATC/GAT for Ile106, CTG/CAG for Leu106, AAA/TTT for Lys106, ATG/CAT for Met106 and ACC/GGT for Thr106 The altered bases are underlined and the codons are given in the sense/antisense primer, respectively The base

Fig 1 Amino-acid sequence alignment of the putative interface region of human TK1 with related enzymes Val106 is in bold and italics, the putative

Mg2+-binding motif VIGID97[19,20] and the putative thymidine-binding motif FQRK131[20] are in italics in all sequences In the human sequence, the b-branching amino acids and the a-helix breaking glycines and prolines are in bold and underlined The sequences have the following GenBank identifier numbers: gi/23503074, human; gi/6678357, mouse; gi/125428, Chinese hamster; gi/125427, chicken; gi/9791018, vaccinia virus Identical amino acids are indicated by asterisks.

Trang 3

Plasmid pGEX-2T-LyTK1Val106[1 8] was used as template

for PCR with a sense primer: 5¢- GGGGGATCCTGCA

CACATGACCGGAACACC(247–273)-3¢ designed to

contain a GGG overhang and an antisense primer:

5¢-CGGCACCGAATTCTAGATGGCCCCAAATGGC

TTCCT(480–445)-3¢ The numbering is as described in [16]

The underlined bases are changed in comparison with the

original sequence to introduce a BamHI site (in bold) and

the coding sequence for thrombin cleavage in the sense

primer, and an EcoRI site (in bold) in the antisense primer

Thus, the N-terminal amino acids of the expressed fragment

will be GS66CTHD instead of66CTHD The PCR

condi-tions were: 4 lgÆmL)1 template DNA, 3 mM MgCl2,

0.2 mM each dNTP and 0.36 lM each primer in 10 mM

Tris/HCl buffer (pH 8.3) and 1unit of Thermus aquaticus

DNA polymerase (Stratagene) in a total volume of 25 lL;

30 cycles; 1min at 94C, 1min at 55 C, and 1 min at

72C The purified PCR product was ligated into the

BamH1–EcoR1restriction sites of the pGEX-2T vector and

transformed into competent E coli cells Codon CTG(466–

468) was mutated to a UAG stop signal by site-directed

mutagenesis performed with the QuickChangeTM

site-directed mutagenesis kit according to the manufacturer’s

instructions The following mutagenic primers were used:

sense, 5¢-CCATTTGGGGCCATCTAGAACCTGGTGC

CGCTG(451–483)-3¢; antisense, 5¢-CAGCGGCACCAG

GTTCTAGATGGCCCCAAATGG(483–451)-3¢ The

underlined bases were changed in comparison with the

original sequence; the stop codon is in bold

Construction of pGEX-2T-LyTK166)136(Met106)

GTG at positions 373–375 (bold), corresponding to amino

acid 106 (numbers as described in [16]), was mutated to

ATG with the QuickChangeTMsite-directed mutagenesis kit

with the following primers: sense primer, 5¢-CAGTTTT

TCCCTGACATCATGGAGTTCTGCGAGGCCATG

(355–393)-3¢; antisense primer, 5¢-CATGGCCTCGCAGA

ACTCCATGATGTCAGGGAAAAACTG(393–355)-3¢

The changed bases are underlined

DNA sequencing

pGEX-2T-LyTK1Val106, pGEX-2T-LyTK1Val106X mutant

plasmids and pGEX-2T-LyTK166)136(Met106)plasmid were

sequenced on both strands using the Thermo Sequenase

sequencing kit (Amersham Biosciences), and

pGEX-2T-LyTK166)136(Val106)plasmid was sequenced on both strands

with SequenaseTM version 2.0 DNA Sequencing Kit

(Amersham Biosciences)

Expression and purification of rLy-TK1 recombinant

enzymes and rLy-TK166)136proteins

Expression and purification of the GST-TK1fusion

proteins have been described in detail previously [18]

After addition of glycerol, dithiothreitol, MgCl2and Triton X-100 to final concentrations of 10%, 5 mM, 5 mMand 1%, respectively, the thrombin cleavage fractions were stored at )80 C The yield of enzyme protein from 300 mL bacterial culture was 1–3 mg in the thrombin cleavage fractions, and the purification fold, calculated as the ratio between the specific activity in the pooled cleavage fractions and in the crude bacterial extract, was  20 The yield of rLy-TK166)136proteins in the cleavage fractions was 3–6 mg per litre bacterial culture The purity of the preparations was estimated to be over 90% by SDS/PAGE (not shown)

ATP incubation and storage of the rLy-TK1 recombinant enzymes for kinetic experiments and gel filtration The thrombin cleavage fractions were diluted to 5 lgÆmL)1

in dilution buffer A (50 mM Tris/HCl, pH 7.5, 5 mM

MgCl2, 0.1MKCl, 2 mMChaps, 10% glycerol and 5 mM

dithiothreitol) with and without 2.5 mMATP, and incuba-ted on ice for 2 h before storage at)80 C The enzymes incubated and stored with and without ATP are referred to

as the +ATP and –ATP forms, respectively

Estimation of subunit molecular size of rLy-TK166)136

by tricine/ethylene glycol/SDS/PAGE Because the standard SDS/PAGE methods resulted in diffuse protein bands and insufficient resolution of the relatively small rLy-TK166)136 peptide (< 8 kDa), a method of Scha¨gger & von Jagow [35] modified according

to Separation Technique File no 112 from Pharmacia (now Amersham Biosciences) was used The upper and lower gel was made 4.5% and 13% with polyacrylamide, respectively, and the gel buffer was 30% ethylene glycol/0.112Macetate/ 0.112MTris/HCl, pH 6.5 The electrode buffer consisted of 0.2M Tris, 0.2M tricine (instead of glycine) and 0.55% SDS, pH 8.1 The Peptide marker kit, molecular mass 2512–16 949 Da, from Amersham Biosciences was used as the molecular mass standard

Native molecular size The apparent molecular size of recombinant enzymes was determined by gel filtration on a Superdex 200 column (10· 300 mm) connected to a Gradifrac automatic sampler (Amersham Biosciences) as described previously [14,18]

A 200-lL portion of thrombin cleavage fraction stored at )80 C at a protein concentration of 5 lgÆmL)1was mixed with 100 lL of the equilibration and elution buffer B (50 mMimidazole/HCl, pH 7.5, 5 mMMgCl2, 0.1MKCl,

2 mM Chaps and 5 mM dithiothreitol), containing 0.17 mgÆmL)1 Blue Dextran 2000 as internal marker for determination of column void volume Then 200 lL of this mixture (protein concentration 3.25 lgÆmL)1) was applied

to the column The +ATP enzyme samples contained 2.5 mMATP, and were eluted in buffer B with 2.5 mMATP Fractions of 200 lL were collected and mixed with 100 lL

Trang 4

buffer B containing 30% glycerol and 2 mM ATP for

enzyme stabilization, and assayed for thymidine kinase

activity at standard assay conditions with 100 lM

thymidine

The native molecular size of the rLy-TK166)136proteins was estimated on a Superose 12 column (10· 300 mm) connected to a Gradifrac automatic sampler (Amersham Biosciences) as described previously [14,18] Protein from

Fig 2 Gel filtration of rLy-TK1(V106WT)

and rLy-TK1(V106X) enzymes

Approxi-mately 0.65 lg protein in 200 lL was injected

into a Superdex 200 column (A) Dimeric

enzymes: V106WT, V106A, V106I, and

V106T; (B) tetrameric enzymes: V106G,

V106H, V106K, V106L, V106M, and V106Q.

The molecular mass markers (|) are (from left

to right): b-amylase (200 kDa), BSA

(66 kDa), ovalbumin (45 kDa), carbonic

anhydrase (29 kDa) and cytochrome

c (12.4 kDa) V e is the elution volume, and V 0

is the void volume estimated with blue dextran

2000 The horizontal bars indicate the range of

duplicate determinations.

Trang 5

fractions were collected for estimation of protein

concen-tration by the method of Bradford [36]

Thymidine kinase assay

TK1activity was assayed by measuring the initial velocities

using the DE-81filter paper method as described previously

[14,18] Standard assay conditions were 5 ngÆmL)1enzyme,

50 mM Tris/HCl, pH 7.5, 2.5 mM MgCl2, 1 0 mM

dithio-threitol, 2.5 mM ATP, 0.5 mM Chaps, 3 mgÆmL)1 BSA,

3 mM NaF and the indicated concentrations of

[methyl-3H]thymidine (Amersham Biosciences) in a final

volume of 50 lL For each velocity, four time samples were

taken The enzymes, stored without ATP at 5 lgÆmL)1,

were diluted immediately before the start of the reaction

with ice-cold enzyme dilution buffer C (50 mM Tris/HCl,

pH 7.5, 1mMChaps and 3 mgÆmL)1BSA) For dilution of

the TK1+ATP form, 2.5 mM ATP and 2.5 mM MgCl2

were included in the dilution buffer

Enzyme kinetics

The kinetic parameters and the degree of co-operativity

were determined as previously described [18] The

experi-mental data were fitted to the Hill equation

v¼ Vs

n

Kn 0:5þ sn

and the kinetic parameters determined with the nonlinear

regression software from Graphpad Prism V is the

maximal velocity, n is the Hill constant, and K0.5, like Km

in the Michaelis–Menten equation, defines the substrate

concentration S where v¼ 0.5 Vmax[37]

Results

Subunit and native molecular size

In a previous study we have shown that replacement of

Val106 with methionine affected the dimer–tetramer ratio

and kinetic properties of recombinant TK1from human

lymphocytes [18] To identify the functional group of amino

acid 106 responsible for this dimer–tetramer transition and

change in thymidine K0.5, we introduced the following nine

mutations: V106A, V106G, V106H, V106I, V106K, V106L,

V106M, V106Q and V106T We then characterized the

enzymatic properties of the mutant enzymes

The apparent native sizes of the –ATP forms of V1 06WT

and of the mutant recombinant enzymes (subunit size

24 kDa, in agreement with previous results [13,14]) were

determined by gel filtration, and the profiles are shown in

Fig 2 The applied volume was 200 lL with an enzyme

concentration of 3.25 lgÆmL)1, because we wished to

operate at the supposed physiological concentration of

TK1protein calculated to be 4 lgÆmL)1in S-phase cells

[21] V106A, V106I and V106T were eluted essentially as

V106WT: a substantial part of each of these enzymes was

tetramers (Fig 2B) Accordingly, we named the first group

of enzymes the dimeric enzymes, and the second group the tetrameric enzymes

The oligomerization pattern of the peptides rLy-TK166)136(Val106) and rLy-TK166)136(Met106) is shown in Fig 3 rLy-TK166)136(Val106) was eluted as two separate peaks with molecular sizes of  29 kDa and 12 kDa, whereas rLy-TK166)136(Met106)was eluted as a single sharp peak of  29 kDa According to the calculated (and verified by SDS/PAGE) subunit size of 7.7 kDa, rLy-TK166)136(Val106)appeared to be eluted as a mixture of a tetramer and a dimer, whereas rLy-TK166)136(Met106)was eluted as a tetramer only This oligomerization pattern strongly supports our assumption that the peptide rLy-TK166)136is an integral part of the TK1oligomerization interface, and that amino acid 106 is indeed of significance for the subunit arrangement of the enzyme molecule Kinetic properties

We have previously shown that replacement of Val106 with methionine results in a rLy-TK1with high catalytic activity (K0.5¼ 0.5 lM), irrespective of pre-assay exposure to ATP, and associated with the tetrameric state of the enzyme [18,21] Figure 4 shows the relation between the initial velocity and the thymidine concentration for both the –ATP and +ATP form of the V106 mutant enzymes at saturating concentration of ATP The calculated kinetic parameters are given in Table 1 The substrate kinetics of the dimeric enzymes V106A, V106I and V106T (Fig 4A) is essentially the same as that previously observed for V106WT [18] and for the endogenous TK1purified from human lymphocytes

Fig 3 Gel filtration of rLy-TK166)136proteins About 100 lg of rLy-TK166)136(Val106)(d) and rLy-TK166)136(Met106)(r) were injected into

a Superose 12 column The molecular mass markers (|) are (from left to right): b-amylase (200 kDa), BSA (66 kDa), ovalbumin (45 kDa), carbonic anhydrase (29 kDa) and cytochrome c (12.4 kDa) V e is the elution volume, and V 0 is the void volume estimated with blue dextran 2000.

Trang 6

[14]: The –ATP form of these enzymes displays

nonhyper-bolic, creeping binding curves, with high K0.5values and

n (Hill coefficient) values < 1(Table 1), whereas their

corresponding +ATP forms have low K0.5 and n values

slightly above 1 The substrate kinetics of the permanently

tetrameric mutants V106G, V106H, V106K, V106L and

V106Q (Fig 4B) is essentially the same as that previously

described for V106M [18], as both the –ATP and +ATP

form of these enzymes have low K0.5and n values above 1

(Table 1) Although the –ATP form of V106K does not

gain the V value of its +ATP form, both the +ATP

and –ATP forms have low K0.5values of 0.7 and 1.2 lMand

nvalues of 1.4, similar to the other enzymes in the tetrameric group

The ratios between the K0.5 values for the –ATP and +ATP forms clearly justify the above proposed grouping

as dimeric and tetrameric enzymes The K0.5(–ATP)

to K0.5(+ATP) ratios for V106WT, V106A, V106I, and V106T are 30 or higher (Table 1), in agreement with the previous observations for V106WT [14,18] In contrast, both the –ATP form and +ATP form of the tetrameric enzymes, V106G, V106H, V106K, V106L, V106M, and V106Q have the same low K0.5 values (0.3–1.2 lM), and their K0.5(–ATP) to K0.5(+ATP) ratios are1 Despite the low K0.5 values, the phosphorylating capacity of the tetrameric enzymes seems to be compromised, as the Vmax values of both the +ATP and –ATP forms are 2–3-fold lower than those of the dimeric enzymes (Table 1)

Discussion

There is no known 3D structure for the group of enzymes to which TK1belongs The only available 3D structures of the deoxynucleoside kinases are for the thymidine kinase from Herpes virus [22–26] and for the TK2-like enzymes, i.e the multisubstrate deoxynucleoside kinase from Drosophila melanogaster, dNK, the human deoxyguanosine kinase, dGK [27], and the human deoxycytidine kinase, dCK [28] Despite the very low overall amino-acid sequence homology ( 10%), the region of mammalian TK1 enzymes with amino acid 106 aligns with the dimerization region of HSV1 -TK Amino acid 1 06 is positioned in an area of TK1 that is (a) highly conserved among vertebrates and viruses of the pox family and may be important for the regulation and substrate affinity of the enzyme and (b) predicted to form an amphipathic helix facilitating subunit interaction [8] Con-sequently, we cloned, expressed and purified the putative interface domain of rLy-TK1, rLy-TK166)136, and investi-gated the oligomerization properties of rLy-TK166)136with valine or methionine as amino acid 106 Our results confirmed the importance of amino acid 106 for the subunit arrangement of the enzyme molecule, because in gel-filtration experiments, the Met106 rLy-TK1 interface frag-ment was eluted as a tetramer, whereas the Val106 rLy-TK1 fragment was eluted as a mixture of a dimer and a tetramer For further investigation of the role of size, conformation and polarity of amino acid 106 for the function and structure of human TK1, we created nine mutant enzymes

at amino acid site 106 by site-directed mutagenesis of the recombinant human lymphocyte TK1, rLy-TK1Val106 (V106WT) After expression and purification, the effect of the mutated amino acids on the oligomerization pattern and kinetic properties was examined

Our results suggested that the recombinant enzymes could be divided into two groups Group I, the dimeric enzymes, containing V106A, V106I and V106T, shared their oligomerization and kinetic properties with V106WT, i.e their –ATP form had high K0.5values for thymidine, 27–

43 lMfor valine, isoleucine and threonine, and 13 lM for alanine The thymidine substrate kinetic pattern was nonhyperbolic, with creeping velocity vs substrate curves, and the Hill coefficient was determined to be 0.8, indica-ting a negative co-operative reaction mechanism At the

Fig 4 Relation between the initial velocity of dTMP formation and

thymidine concentration Open symbols, +ATP forms; closed

sym-bols, –ATP forms (A) Dimeric enzymes: V106WT, V106A, V106I and

V106T; (B) tetrameric enzymes: V106G, V106H, V106K, V106L,

V106M and V106Q v is the initial velocity.

Trang 7

investigated concentrations in gel-filtration experiments,

they appeared as both dimers and tetramers with native

molecular sizes of about 50 and 100 kDa, respectively

The +ATP form of the group I enzymes had low K0.5

values for thymidine,  0.3–0.9 lM, and Hill coefficients

slightly above 1 Except for alanine, the amino acids at site

106 in the dimeric group are of similar size and

conforma-tion, but different polarities, and the hydroxyl moiety of

threonine does not seem to cause any disturbances Hence,

the hydrophobicity of the residue at site 106 is not critical

for the function and conformation of rLy-TK1

Group II, the tetrameric enzymes, containing V106G,

V106H, V106K, V106L and V106Q, have properties similar

to V106M, i.e in both the absence and presence of ATP

they have low K0.5values for thymidine, 0.3–1.2 lM, and

Hill coefficients between 1.4 and 2, indicating positive

co-operativity, and they are eluted as tetramers in

gel-filtration experiments Dilution experiments have shown

that the stability of the –ATP form of group II enzymes is

strikingly low compared with the group I enzymes If diluted

to 25 ngÆmL)1 and incubated at 4C for 30 min, the

dimeric group I enzymes retained 80–100% of their

enzymatic activity, while the tetrameric group II enzymes

retained only 0.5–3% As the amino acids at site 106 in

group II differ in polarity as well as in size and

conforma-tion, these properties do not appear to explain the decreased

K0.5values, the decreased stability, or the conformational

changes

Although it is clear that group I comprises enzymes that

have a substantial portion eluted as a dimer and biphasic

kinetics with a high K0.5value, the correlation between the

K0.5value and the dimer–tetramer ratio is less clear This

may rely on the fact that the mutation not only interferes

with the dimer–tetramer transition but also the interaction

with the substrate

Because valine, isoleucine and leucine are nonpolar

amino acids with similar hydrophobicity, size and side

chain conformation, grouping of V106I with the V106WT

in the dimeric group I was expected, but the absence of

V106L was not The presence of the polar V106T in group I

was also unexpected However, the side chains of valine,

isoleucine and threonine have one property in common, i.e branching at the b-carbon atom classically considered to destabilize a-helices because of steric clashes The side chain

of leucine differs from valine, isoleucine and threonine by having a branch at its c-carbon atom, and, although the a-helical propensity of leucine is nearly as high as that of alanine [38], the long hydrophobic side chain of leucine resembles the side chain of methionine in its length and the absence of the branched b-carbon This may explain why the oligomerization and kinetic properties of V106L are the same as those of V106M [18] and other enzymes

of the tetrameric group II (Table 1)

Dimer–tetramer transition, which is dependent on enzyme concentration and pre-exposure to ATP [14,18,21], would require an enzyme with substantial conformational flexibility b-Branching amino acids may have a regulatory role in such conformation-dependent transitions, as they are known to increase the strain within an a-helix, and so to destabilize helix–helix interaction [39–41] In fact, Val106 in human TK1is preceded by another b-branched residue, Ile105, and among the 71 conserved residues in the segment 66–136, there are six a-helix-breaking glycines, three prolines and 15 b-branching amino acids (Fig 1)

The activity of TK1correlates with the DNA synthesis [11,12], and we have previously proposed a model in which fluctuation of TK1activity during the cell cycle is due to a shift from a low activity dimer dominating at low TK1 concentrations in G1to a high activity tetramer dominating

in the S phase with high TK1concentrations [21]

Perturbation in transition pattern from a low thymidine affinity dimer to a high thymidine affinity tetramer has recently been reported for a recombinant TK1(V106WT) enzyme, in which Ser13 was substituted with aspartate [42] The S13D substitution mimics phosphorylation of Ser13, shown to be the site of heavy mitotic phosphorylation in HeLa cells [43–45] Thymidine kinetics and gel-filtration experiments show that the S13D mutation causes an equilibrium shift from a tetramer to a dimer paralleled by

an 10-fold increase in Km[42] These results explain the previously observed downregulated activity of phosphoryl-ated TK1at G2/M phases in proliferating cells [43–45]

Group I – dimeric enzymes

V106WT 11.0 ± 1.3 9.4 ± 0.2 27.1 ± 8.5 0.6 ± 0.05 0.8 ± 0.07 1.2 ± 0.05 45

V106A 8.0 ± 0.8 6.6 ± 0.2 12.7 ± 3.2 0.3 ± 0.03 0.8 ± 0.06 1.3 ± 0.1 42

V106I 10.3 ± 1.8 8.3 ± 0.3 29.4 ± 16.4 0.9 ± 0.1 0.8 ± 0.1 1.2 ± 0.1 33

V106T 8.4 ± 1.9 7.1 ± 0.2 43 ± 28 0.4 ± 0.04 0.8 ± 0.1 1.2 ± 0.1 108

Group II – tetrameric enzymes

V106G 3.6 ± 0.2 3.0 ± 0.1 0.4 ± 0.1 0.3 ± 0.1 1.9 ± 0.4 1.7 ± 0.4 1.3

V106H 3.7 ± 0.2 3.1 ± 0.1 0.3 ± 0.2 0.4 ± 0.1 1.6 ± 0.7 2.0 ± 0.4 0.8

V106K 2.2 ± 0.06 4.1 ± 0.1 0.7 ± 0.1 1.2 ± 0.1 1.4 ± 0.1 1.4 ± 0.1 0.6

V106L 4.1 ± 0.1 3.9 ± 0.1 0.4 ± 0.1 0.7 ± 0.1 1.9 ± 0.2 1.8 ± 0.1 0.6

V106M 2.9 ± 0.06 2.9 ± 0.06 0.6 ± 0.08 0.6 ± 0.1 1.5 ± 0.1 1.5 ± 0.1 1.0

V106Q 4.9 ± 0.2 4.2 ± 0.1 0.8 ± 0.1 0.8 ± 0.1 1.5 ± 0.2 1.6 ± 0.1 1.0

Trang 8

The observations described above [42] extend our model

[21] by showing that phosphorylation of TK1 is involved in

the dimer–tetramer transition, as well Taken together, these

observations imply that the shift in TK1between a low

activity dimer with apparently negative co-operativity and a

high activity tetramer with apparently hyperbolic reaction

mechanism plays a significant physiological role in the

regulation of TK1activity and hence the biosynthesis of

dTTP

The vital importance of enzyme regulation by

co-operative mechanisms has recently been underlined by the

H121N mutant of the mitochondrial TK2, found in some

patients with the mitochondrial DNA depletion syndrome,

combined with severe myopathy and early death [46] It is

therefore of great importance to obtain as much

informa-tion as possible about regulainforma-tion and enzymatic properties

of enzymes in DNA precursor metabolism

Acknowledgements

We are indebted to Marianne Lauridsen for excellent technical

assistance This work was supported by the Danish Research Council

and the NOVO research foundation.

References

1 Nishino, I., Spinazzola, A & Hirano, M (1999) Thymidine

phosphorylase gene mutations in MNGIE, a human

mitochon-drial disorder Science 283, 689–692.

2 Spinazzola, A., Marti, R., Nishino, I., Andreu, A.L., Naini, A.,

Tadesse, S., Pela, I., Zammarchi, E., Donati, M.A., Oliver, J.A &

Hirano, M (2002) Altered thymidine metabolism due to defects of

thymidine phosphorylase J Biol Chem 277, 4128–4133.

3 Mandel, H., Szargel, R., Labay, V., Elpeleg, O., Saada, A.,

Sha-lata, A., Anbinder, Y., Berkowitz, D., Hartman, C., Barak, M.,

Eriksson, S & Cohen, N (2001) The deoxyguanosine kinase gene

is mutated in individuals with depleted hepatocerebral

mito-chondrial DNA Nat Genet 29, 337–341.

4 Saada, A., Shaag, A., Mandel, H., Nevo, Y., Eriksson, S & Elpeleg,

O (2001) Mutant mitochondrial thymidine kinase in

mitochon-drial DNA depletion myopathy Nat Genet 29, 342–344.

5 Berk, A.J & Clayton, D.A (1973) A genetically distinct thymidine

kinase in mammalian mitochondria Exclusive labeling of

mito-chondrial deoxyribonucleic acid J Biol Chem 248, 2722–2729.

6 Bogenhagen, D & Clayton, D.A (1976) Thymidylate nucleotide

supply for mitochondrial DNA synthesis in mouse 1-cells Effect

of 5-fluorodeoxyuridine and methotrexate in thymidine kinase

plus and thymidine kinase minus cells J Biol Chem 251, 2938–

2944.

7 Pontarin, G., Gallinaro, L., Ferraro, P., Reichard, P & Bianchi,

V (2003) Origins of mitochondrial thymidine triphosphate:

dynamic relations to cytosolic pools Proc Natl Acad Sci USA

100, 12159–12164.

8 Eriksson, S., Munch-Petersen, B., Johansson, K & Eklund, H.

(2002) Structure and function of cellular deoxyribonucleoside

kinases Cell Mol Life Sci 59, 1327–1346.

9 Thelander, L & Reichard, P (1979) Reduction of ribonucleotides.

Annu Rev Biochem 48, 133–158.

10 Kunz, B.A., Kohalmi, S.E., Kunkel, T.A., Mathews, C.K.,

McIntosh, E.M & Reidy, J.A (1994) International Commission

for Protection Against Environmental Mutagens and

Carcinogens Deoxyribonucleoside triphosphate levels: a critical

factor in the maintenance of genetic stability Mutat Res 318, 1 –

64.

11 Sherley, J.L & Kelly, T.J (1988) Regulation of human thymidine kinase during the cell cycle J Biol Chem 263, 8350–8358.

12 Kristensen, T., Jensen, H.K & Munch-Petersen, B (1994) Over-expression of human thymidine kinase mRNA without corre-sponding enzymatic activity in patients with chronic lymphatic leukemia Leuk Res 18, 861–866.

13 Munch-Petersen, B., Cloos, L., Tyrsted, G & Eriksson, S (1991) Diverging substrate specificity of pure human thymidine kinases 1 and 2 against antiviral dideoxynucleosides J Biol Chem 266, 9032–9038.

14 Munch-Petersen, B., Tyrsted, G & Cloos, L (1993) Reversible ATP-dependent transition between two forms of human cytosolic thymidine kinase with different enzymatic properties J Biol Chem 268, 15621–15625.

15 Sherley, J.L & Kelly, T.J (1988) Human cytosolic thymidine kinase Purification and physical characterization of the enzyme from HeLa cells J Biol Chem 263, 375–382.

16 Bradshaw, H.D Jr & Deininger, P.L (1984) Human thymidine kinase gene: molecular cloning and nucleotide sequence of a cDNA expressible in mammalian cells Mol Cell Biol 4, 2316– 2320.

17 Flemington, E., Bradshaw, H.D Jr, Traina-Dorge, V., Slagel, V.

& Deininger, P.L (1987) Sequence, structure and promoter characterization of the human thymidine kinase gene Gene 52, 267–277.

18 Berenstein, D., Christensen, J.F., Kristensen, T., Hofbauer, R & Munch-Petersen, B (2000) Valine, not methionine, is amino acid

106 in human cytosolic thymidine kinase (TK1) Impact on oligomerization, stability, and kinetic properties J Biol Chem.

275, 32187–32192.

19 Black, M.E & Hruby, D.E (1992) Site-directed mutagenesis of a conserved domain in vaccinia virus thymidine kinase Evidence for

a potential role in magnesium binding J Biol Chem 267, 6801– 6806.

20 Folkers, G., Trumpp-Kallmeyer, S., Gutbrod, O., Krickl, S., Fetzer, J & Keil, G.M (1991) Computer-aided active-site-directed modeling of the herpes simplex virus 1and human thymidine kinase J Comput Aided Mol Des 5, 385–404.

21 Munch-Petersen, B., Cloos, L., Jensen, H.K & Tyrsted, G (1995) Human thymidine kinase 1 Regulation in normal and malignant cells Adv Enzyme Regul 35, 69–89.

22 Wild, K., Bohner, T., Aubry, A., Folkers, G & Schulz, G.E (1995) The three-dimensional structure of thymidine kinase from Herpes simplex virus type 1 FEBS Lett 368, 289–292.

23 Brown, D.G., Visse, R., Sandhu, G., Davies, A., Rizkallah, P.J., Melitz, C., Summers, W.C & Sanderson, M.R (1995) Crystal structures of the thymidine kinase from herpes simplex virus type-I

in complex with deoxythymidine and Ganciclovir Nat Struct Biol 2, 876–881.

24 Wild, K., Bohner, T., Folkers, G & Schulz, G.E (1997) The structures of thymidine kinase from herpes simplex virus type 1in complex with substrates and a substrate analogue Protein Sci 6, 2097–2106.

25 Champness, J.N., Bennett, M.S., Wien, F., Visse, R., Summers, W.C., Herdewijn, P., Declercq, E., Ostrowski, T., Jarvest, R.L & Sanderson, M.R (1998) Exploring the active site of herpes simplex virus type-1thymidine kinase by X-ray crystallography of com-plexes with acyclovir and other ligands Protein Struct Funct Genet 32, 350–361.

26 Bennett, M.S., Wien, F., Champness, J.N., Batuwangala, T., Rutherford, T., Summers, W.C., Sun, H., Wright, G & Sander-son, M.R (1999) Structure to 1.9 A˚ resolution of a complex with herpes simplex virus type-1thymidine kinase of a novel, non-substrate inhibitor: X-ray crystallographic comparison with binding of acyclovir FEBS Lett 443, 121–125.

Trang 9

anticancer and antiviral therapy Nat Struct Biol 10, 513–519.

29 Munch-Petersen, B., Knecht, W., Lenz, C., Sondergaard, L &

Piskur, J (2000) Functional expression of a multisubstrate

deoxyribonucleoside kinase from Drosophila melanogaster and its

C-terminal deletion mutants J Biol Chem 275, 6673–6679.

30 Cuff, J.A., Clamp, M.E., Siddiqui, A.S., Finlay, M & Barton, G.J.

(1998) JPred: a consensus secondary structure prediction server.

Bioinformatics 14, 892–893.

31 Cuff, J.A & Barton, G.J (1999) Evaluation and improvement of

multiple sequence methods for protein secondary structure

pre-diction Proteins 34, 508–519.

32 Cuff, J.A & Barton, G.J (2000) Application of multiple sequence

alignment profiles to improve protein secondary structure

pre-diction Proteins 40, 502–511.

33 Higgins, D.G & Thompson, J.D (1996) Using CLUSTAL for

multiple sequence alignments Methods Enzymol 266, 383–402.

34 Igarashi, K., Hiraga, S & Yura, T (1967) A deoxythymidine

kinase deficient mutant of Escherichia coli Mapping and

trans-duction studies with phage phi-80 Genetics 57, 643–654.

35 Scha¨gger, H & von Jagow, G (1987) Tricine-sodium dodecyl

sulfate-polyacrylamide gel electrophoresis for the separation of

proteins in the range from 1to 100 kDa Anal Biochem 166, 368–

379.

36 Bradford, M.M (1976) A rapid and sensitive method for the

quantitation of microgram quantities of protein utilizing the

principle of protein-dye binding Anal Biochem 72, 248–254.

37 Cornish-Bowden, A (ed.) (1995) Control of enzyme activity In

Fundamentals of Enzyme Kinetics, pp 203–237 Portland Press

Ltd, London.

40 Deber, C.M., Li, Z., Joensson, C., Glibowicka, M & Xu, G.Y (1992) Transmembrane region of wild-type and mutant M13 coat proteins Conformational role of beta-branched residues J Biol Chem 267, 5296–5300.

41 Deber, C.M., Khan, A.R., Li, Z., Joensson, C., Glibowicka, M & Wang, J (1993) Val fi Ala mutations selectively alter helix–helix packing in the transmembrane segment of phage M13 coat pro-tein Proc Natl Acad Sci USA 90, 11648–11652.

42 Li, C.L., Lu, C.Y., Ke, P.Y & Chang, Z.F (2004) Perturbation

of ATP-induced tetramerization of human cytosolic thymidine kinase by substitution of serine-13 with aspartic acid at the mitotic phosphorylation site Biochem Biophys Res Commun 313, 587– 593.

43 Chang, Z.F & Huang, D.Y (1993) The regulation of thymidine kinase in HL-60 human promyeloleukemia cells J Biol Chem.

268, 1266–1271.

44 Chang, Z.F., Huang, D.Y & Hsue, N.C (1994) Differential phosphorylation of human thymidine kinase in proliferating and

M phase-arrested human cells J Biol Chem 269, 21249– 21254.

45 Chang, Z.F., Huang, D.Y & Chi, L.M (1998) Serine 13 is the site

of mitotic phosphorylation of human thymidine kinase J Biol Chem 273, 12095–12100.

46 Wang, L., Saada, A & Eriksson, S (2003) Kinetic properties of mutant human thymidine kinase 2 suggest a mechanism for mitochondrial DNA depletion myopathy J Biol Chem 278, 6963–6968.

Ngày đăng: 16/03/2014, 16:20

TỪ KHÓA LIÊN QUAN

TÀI LIỆU CÙNG NGƯỜI DÙNG

TÀI LIỆU LIÊN QUAN

🧩 Sản phẩm bạn có thể quan tâm