Recently, we reported that GPX proteins Gpx-1, Gpx-2 from Synechocystis PCC 6803 are able to util-ize NADPH, but not glutathione GSH, as an elec-tron donor, and unsaturated fatty acid hy
Trang 1glutathione peroxidase isoenzymes of Arabidopsis thaliana Aqib Iqbal1, Yukinori Yabuta2, Toru Takeda2, Yoshihisa Nakano1and Shigeru Shigeoka2
1 Department of Applied Biological Chemistry, Osaka Prefecture University, Sakai, Japan
2 Department of Advanced Bioscience, Kinki University, Nara, Japan
The generation of reactive oxygen species (ROS) is
an inevitable process in living organisms and poses a
hazard when present in high concentrations by
irre-versibly damaging different macromolecules such as
protein, lipid and DNA [1] Plants, because of their
sessile nature, are at greater risk of alterations in redox
homeostasis resulting in oxidative stress [2] However,
at moderate concentrations ROS play an important
role in signaling processes as the regulatory mediators
Thus, many ROS-mediated responses actually protect
cells against oxidative stress and re-establish redox
homeostasis [3]
In mammals, glutathione peroxidase (GPX)
iso-enzymes (EC 1.11.1.9) play a key role in protecting
cells against oxidative damage At least five GPX
iso-enzymes have been identified in mammals and these
differ with respect to structure, substrate specificity
and tissue distribution [4] cDNA with homology to
mammalian GPX isoenzymes has been cloned from Nicotiana sylvestris leaves [5] and since then more have been isolated from different plant species and photo-synthetic organisms [6–14]
Recently, we reported that GPX proteins (Gpx-1, Gpx-2) from Synechocystis PCC 6803 are able to util-ize NADPH, but not glutathione (GSH), as an elec-tron donor, and unsaturated fatty acid hydroperoxides
or alkyl hydroperoxides as acceptors [15] In addition,
it has been reported that yeast GPX isoenzymes can utilize both GSH and thioredoxin (Trx) as a reducing agent [16] This profile was also observed in GPX iso-enzymes from sunflower, tomato and Chinese cabbage [11,17] Thus it is evident that in addition to GSH, GPX proteins can utilize other physiological substrates for hydroperoxide reduction
GSH and Trx from eukaryotic cells are two major reducing compounds that maintain cellular redox
Keywords
Arabidopsis; glutathione peroxidase;
hydroperoxide; thioredoxin
Correspondence
T Takeda, Department of Advanced
Bioscience, Faculty of Agriculture,
Kinki University, 3327-204 Nakamachi,
Nara 631–8505, Japan
Fax: +81 742 43 8976
Tel: +81 742 43 8179
E-mail: t_takeda@nara.kindai.ac.jp
(Received 22 August 2006, revised 18
October 2006, accepted 20 October 2006)
doi:10.1111/j.1742-4658.2006.05548.x
Arabidopsis thalianacontains eight glutathione peroxidase (GPX) homologs (AtGPX1–8) Four mature GPX isoenzymes with different subcellular dis-tributions, AtGPX1, -2, -5 and -6, were overexpressed in Escherichia coli and characterized Interestingly, these recombinant proteins were able to reduce H2O2, cumene hydroperoxide, phosphatidylcholine and linoleic acid hydroperoxides using thioredoxin but not glutathione or NADPH as an electron donor The reduction activities of the recombinant proteins with
H2O2 were 2–7 times higher than those with cumene hydroperoxide Km values for thioredoxin and H2O2 were 2.2–4.0 and 14.0–25.4 lm, respect-ively These finding suggest that GPX isoenzymes may function to detoxify
H2O2 and organic hydroperoxides using thioredoxin in vivo and may also
be involved in regulation of the cellular redox homeostasis by maintaining the thiol⁄ disulfide or NADPH ⁄ NADP balance
Abbreviations
ABA, abscisic acid; AtGPX, Arabidopsis thaliana homolog of glutathione peroxidase; GPX, glutathione peroxidase; GSH, glutathione; Nbs 2 , 5,5¢-dithiobis(2-nitrobenzoic acid); PhGPX, phospholipid hydroperoxide glutathione peroxidase; ROS, reactive oxygen species;
SeCys, selenocysteine; TPx, Trx-dependent peroxidase; Trx, thioredoxin.
Trang 2balance and interact with various transducer and
effec-ter molecules to bring about specific responses [18]
GSH not only acts as a redox sensor of environmental
cues, but also forms part of multiple regulatory
path-ways coordinating the expression of defense genes [19]
Trx is a ubiquitous protein that is present in prokaryotes
and eukaryotes, and shows particularly wide diversity in
photosynthetic organisms [20,21] In higher plants, Trxs
are distributed in the cytoplasm, plasma membrane,
endoplasmic reticulum, nucleus, apoplast,
mitochon-drion and chloroplast [18,22], and are involved in the
regulation of different metabolic processes
Eight genes with homology to mammalian GPX
iso-enzymes have been identified in Arabidopsis thaliana
Seven of these, AtGPX1–7, are differently expressed in
various plant tissues However, cDNAs encoding five
GPX isoenzymes, AtGPX1, -2, -3, -5 and -6, were
detected in the ESTs database and the expression of
five genes was clearly different in response to different
abiotic stresses and plant hormones [23] Two
proteo-mic studies have identified AtGPX1 which is located in
the thylakoid membrane of chloroplast [24,25] In
addition, AtGPX3 green fluorescent fusion protein has
been localized in the cytoplasm [26] Based on the
deduced amino acid sequences of the other cDNAs, it
seems likely that AtGPX2, -5 and -6 are putatively
dis-tributed in the cytosol, endoplasmic reticulum and
mitochondria⁄ cytosol, respectively [23] GPX proteins
localized in the cytosol have been previously
character-ized only from plants and photosynthetic organisms;
thus there is no information available about the
enzy-matic properties of the isoenzymes localized in other
subcellular compartments In this study, large amounts
of four types of recombinant GPX proteins, AtGPX1,
-2, -5 and -6 with different subcellular distribution were obtained It was found that the recombinant pro-teins can reduce H2O2, cumene hydroperoxide, phos-phatidyl choline and linoleic acid hydroperoxides using Trx as an electron donor, but not GSH or NADPH Their physiological roles in plants is also discussed
Results
Expression of proteins of AtGPX1, -2, -5 and -6 and AtTrx h2 and h3 in E coli
Chimeric primers were designed to amplify AtGPX1, -2, -5 and -6 fragments comprising the amino acid residues encoding the mature proteins without transit peptides that target them to different subcellular compartments Each recombinant protein was induced
in E coli BL21 (DE3) pLysS cells in an exponentially growing culture according to the procedure described
in the Experimental procedures SDS⁄ PAGE analysis
of the soluble proteins from the host cells showed that the proteins are successfully expressed using this sys-tem, resulting in the presence of a prominent band at
22.5 kDa, corresponding to the expected molecular mass of each AtGPX isoenzyme tagged with the histi-dine residues (Fig 1A) The recombinant proteins pro-duced were 20–25% of the total soluble proteins Recombinant AtGPX1, -2, -5 and -6 proteins of near electrophoretic homogeneity were obtained using a HiTrapTM chelating HP column Recombinant thio-redoxin h2 (17.0 kDa) and h3 (15.5 kDa) were also purified using the same procedure (Fig 1B) The pro-teins of recombinant AtGPX and Trx were used for the enzymatic analysis
Fig 1 SDS ⁄ PAGE analysis of the expression of Arabidopsis recombinant proteins in E coli using a pColdII vector system (A) Recombinant AtGPX1, -2, -5 and -6 (GenBank TM accession numbers NP_180080, NP_180715, NP_191867 and AAK63967, respectively); (B) recombinant Txr h2 and h3 (GenBankTMaccession numbers NP_198811 and NP_199112, respectively) The soluble crude extract (10 lg) and each puri-fied recombinant protein (1 lg) were separated by 15% SDS ⁄ PAGE and stained with Coomassie Brilliant Blue The sizes of the molecular mass markers are shown on the left of the panel Lane 1, empty pColdII vector i, Total soluble proteins; ii, purified recombinant proteins.
Trang 3Detection of enzyme activities of GPX
isoenzymes
When the recombinant AtGPX isoenzymes were used
with GSH or NADPH as a reducing agent and H2O2,
cumene hydroperoxide, unsaturated fatty acids or lipid
hydroperoxides as electron acceptor, no hydroperoxide
reduction activities were detected (Table 1) However,
it was found that AtGPX isoenzymes were able to
reduce H2O2 with an E coli Trx as the reducing
sub-strate In addition, these isoenzymes were found to
utilize Trx for the reduction of cumene hydroperoxide,
unsaturated fatty acids hydroperoxides or lipid
hydro-peroxides The Vmaxvalues for the purified recombinant
AtGPX isoenzymes with cumene hydroperoxide and
Trx were between 60 ± 16.2 and 233 ± 16.7 nmolÆ
min)1Æmg)1 protein However, AtGPX5 was not able
to reduce cumene hydroperoxide with either Trx or
GSH The Vmax values for AtGPX isoenzymes with
H2O2 and Trx were approximately two- to sevenfold higher than those of cumene hydroperoxide Activities toward unsaturated fatty acid hydroperoxides and lipid hydroperoxides were very low compared with those toward cumene hydroperoxide (Table 1) The reduc-tion of hydroperoxides with two cytosolic Trx’s, h2 and h3 from Arabidopsis were also measured in an assay coupled with E coli Trx-reductase However, the AtGPX isoenzymes were not able to reduce hydroper-oxides with either Trx h2 or h3 (Table 1)
Enzymatic properties of recombinant GPX isoenzymes
Double reciprocal plots of 1⁄ [activity] against 1 ⁄ [Trx] for Trx and H2O2 were linear and reproducible for each AtGPX isoenzyme (data not shown) The Vmax values for AtGPX1, -2, -5 and -6 with a fixed concentration of H2O2 (0.1 mm) were 423 ± 22.5,
Table 1 Reduction of alkyl hydroperoxide (cumene hydroperoxide), H2O2, polyunsaturated fatty acids hydroperoxide (PUFAOOH, linoleic acid) or phosphatidylcholine hydroperoxide (PCOOH) with GSH, NADPH or Trx by AtGPX isoenzymes and comparison with other plant GPXs.
ER, endoplasmic reticulum; mit, mitochondria; ND, not determined.
Activity (nmolÆmin)1Æmg)1protein)
Arabidopsis
a
[6],b[17],c[16],d[11].
Trang 4346 ± 33.5, 409 ± 29.4 and 433 ± 64.2 nmolÆmin)1Æ
mg)1 protein The Km values for AtGPX1, -2, -5 and
-6 with a fixed concentration of H2O2 (0.1 mm)
for Trx were 4.0, 2.2, 3.1 and 2.3 lm, respectively
Thus the Kcat values for AtGPX1, -2, -5 and -6 for
Trx were 13.4· 10)2, 11.0· 10)2, 13.0· 10)2 and
13.7· 10)2Æs)1 and Kcat⁄ Km values were 3.35· 104,
5.0· 104, 4.19· 104 and 5.96· 104 m)1Æs)1,
respect-ively (Table 2)
Vmax and Km values for these isoenzymes for H2O2
using a fixed concentration of 4 lm E coli Trx were
also calculated The Vmax values for AtGPX1, -2, -5
and -6 were 262 ± 10.2, 218 ± 8.5, 247 ± 9.8 and
269 ± 9.1 nmolÆmin)1Æmg)1 protein and the Kmvalues
were 17.1 ± 0.8, 15.3 ± 1.4, 25.4 ± 1.6 and 14.0 ±
1.2 lm, respectively Accordingly, the Kcat values for
AtGPX1, -2, -5 and -6 calculated for H2O2 were
8.30· 10)2, 6.90· 10)2, 7.80· 10)2and 8.5· 10)2Æs)1
and the Kcat⁄ Km values were 4.9· 103, 4.5· 103,
3.1· 103and 6.1· 103 m)1Æs)1, respectively (Table 3)
Discussion
Based on amino acid sequence homology, GPX
isoen-zymes from photosynthetic organisms, including higher
plants, are closely related to mammalian GPX4
(phos-pholipid hydroperoxide GPX; PhGPX) However, these GPX isoenzymes contained a conserved Cys in their catalytic site, unlike mammalian PhGPX, which has
a selenocysteine (SeCys) [4] It has been shown that replacement of SeCys with a Cys via point mutation in pig heart GPX resulted in a drastic decrease in enzyme activity [27] Furthermore, sequence alignments for plasma GPX (GPX3) and GPX4 from mammals showed that the amino acid residues necessary for GSH binding are not conserved Consequently, GPX isoenzymes from photosynthetic organisms were not able to reduce sev-eral hydroperoxides utilizing GSH However, even when they could reduce hydroperoxides with GSH as an elec-tron donor, they had a very low activity [15,28–30] Similarly, the non-SeCys PhGPXs recently identified in mammals showed little GSH-dependent GPX activity
in vitro[31] These findings suggest that GSH is unlikely
to be the sole physiological electron donor for GPX iso-enzymes under all circumstances and hence the reduc-tion activity of the AtGPX isoenzymes toward hydroperoxides with GSH is lost, which is in accordance with the results for non-SeCys GPX isoenzymes repor-ted previously [11,16,27,31]
Interestingly, AtGPX isoenzymes were able to utilize Trx as a sole electron donor for the reduction of H2O2
or hydroperoxides (Table 1) GPX isoenzymes from
Table 2 Comparison of kinetic characteristics of Arabidopsis, tomato and sunflower GPX isoenzymes towards thioredoxin using fixed con-centration of H 2 O 2 or t-butyl hydroperoxide (100 l M ) Kinetic parameters of AtGPX isoenzymes were calculated using H 2 O 2 (100 l M ) and that
of GPXle1 and GPXha2 were calculated with t-butyl hydroperoxide (100 l M ) as the substrates Data for GPXle1 and GPXha2 were taken from Herbette et al [17].
Vmax nmolÆmin)1Æmg)1protein
Km
l M
Kcat
s)1
Kcat⁄ K m
M )1Æs)1
Table 3 Comparison of kinetic characteristics of Arabidopsis, tomato, sunflower and yeast GPX isoenzymes toward H 2 O 2 using fixed con-centration of thioredoxin (4 l M ) Data for GPXle1 and GPXha2 were taken from Herbette et al [17], data for yeast GPX2 were taken from Tanaka et al [16].
Vmax nmolÆmin)1Æmg)1protein
Km
l M
Kcat
s)1
Kcat⁄ K m
M )1Æs)1
Trang 5several other plants, such as tomato, sunflower and
Chinese cabbage, and microorganisms such as
Synecho-cystisPCC 6803, Saccharomyces cerevisiae and
Plasmo-dium falciparum have also been found to utilize other
physiological electron donors, such as NADPH or Trx,
for the reduction of hydroperoxides [11,15–17]
GPX isoenzymes from photosynthetic organisms
contain three conserved Cys; the third Cys is outside
the classical GPX catalytic domains (Fig 2) The first
and third Cys residues conserved in yeast GPX2 and Chinese cabbage Trx-dependent peroxidase (TPx) are needed to form a disulfide bond within the GPX monomer in vivo, suggesting that the first Cys func-tions as a peroxidatic site attacked by hydroperoxides
to produce H2O and Cys-SOH which then form an in-tramolecular disulfide bond with the third Cys [an atypical 2 Cys peroxiredoxin (Prx)-type reaction] [11,16] The process for reduction of the disulfide bond
Fig 2 Alignment of the amino acid sequence of the GPX proteins The deduced amino acid sequences aligned for comparison are from
A thaliana (AtGPX1–8), Helianthus annuus (HaPhGPX), Lycopersicon esculentum (LePhGPX), Chinese cabbage (PHCC-TPx), Setaria italica (SiPhGPX), Raphanus sativus (RsPhGPX), S cerevisciae (yeast GPX2) and non-SeCys type GPX from human and mouse The three con-served Cys of these GPX isoenzymes are shown by inverted triangles The GPX concon-served regions are shown by a horizontal line below the amino acid residues and represented by I, II and III GenBank TM accession numbers for AtGPX1, -2, -5 and -6 are shown in Fig 1 The acces-sion numbers of other isoenzymes are AtGPX3 (NP_181863), AtGPX4 (NP_566128), AtGPX7 (NP_194915), AtGPX8 (NP_176531), HaPhGPX (CAA75009), LePhGPX (CAA75054), PHCC-TPx (AF411209), RsPhGPX (AF322903), SiPhGPX (AAS47590), yeast GPX2 (NP_009803), human NPGPx (BC032788) and mouse NPGPx (BC003228).
Trang 6in target proteins by the reduced Trx has already been
elucidated [32,33] The Arabidopsis and other plant
GPX isoenzymes also contained the same Cys
arrange-ment and thus may possess a similar mode of action
for the reduction of hydroperoxide utilizing Trx
(Fig 2)
Km values for both Trx and H2O2 of AtGPX
isoen-zymes were nearly similar to those of GPXs from
sev-eral plants and yeast (Tables 2 and 3) Km values for
AtGPXs for Trx were in lm, which were compatible
with Trx levels in vivo and thus within physiological
limits However, the TPx activities with H2O2 or alkyl
hydroperoxides of Arabidopsis, sunflower and tomato
GPXs were significantly lower than those of yeast
GPX2 and Chinese cabbage TPx (Tables 2 and 3)
There are no significant differences between these
enzymes with respect to the arrangement of the
well-conserved secondary structural elements, that is, the
existence of three Cys residues and deletion of the
region for tetramerization (Fig 2) Accordingly, it is
necessary to undertake a more detailed investigation to
clarify why Arabidopsis GPX isoenzyme has low TPx
activity with H2O2or alkyl hydroperoxides
Tomato and sunflower GPX isoenzymes had
approximately similar reduction activity with H2O2,
alkyl and lipids hydroperoxide in the presence of Trx
In contrast, those from Arabidopsis and Chinese
cab-bage, and yeast GPX2 had higher activity with H2O2
than with the other hydroperoxides (Table 1),
indica-ting a gradual evolution toward a more specialized
function of H2O2 reduction [11,16,17] Even though
the GPX isoenzymes from photosynthetic organisms
and Prx are weakly homologous at the amino acid
level, substrate specificity, reaction mechanism, affinity
and catalytic efficiency toward various hydroperoxides
are very similar [36] As the three conserved Cys
resi-dues appear to be essential for the
thioredoxin-depend-ent reduction activity [11,16], it is suggested that GPX
isoenzymes from photosynthetic organisms may be
classified as a distinct group of 3-Cys peroxiredoxins
(Fig 2)
Although plant GPX isoenzymes were able to utilize
E coliTrx as a substrate in vitro and have been
identi-fied as potential Trx targets in different proteomic
approaches [34], AtGPX isoenzymes were not able to
reduce hydroperoxides with the two cytosolic Trxs h2
and h3 from Arabidopsis [21] The two mitochondrial
Trxs, poplar PtTrxh2 and Arabidopsis AtTrxo1, could
not serve as electron donors to either the
mitochond-rial PtGPX3 or cytosolic PtGPX1 and -5 of poplar,
whereas the cytosolic Trx isoforms, PtTrxh1 and
PtTrxh3, could reduce them [22] It has been reported
that various types of Trx isoforms show considerable
differences in structure and electrostatic potentials around the redox active site [35] These findings sug-gest that plant Trxs show functional redundancy and a high degree of specificity toward target proteins [35] Although we checked hydroperoxide reduction activity
in only two cytosolic Trx isoforms from Arabidopsis, it
is possible that AtGPX isoenzymes could utilize a par-ticular Trx with the respective subcellular distribution
or some other unidentified reductant, as reported pre-viously [22] Accordingly, it is imperative to identify the in vivo reductant for each GPX isoenzyme because the various thiol buffers, including Trx, can affect a number of redox reactions in the cells
Thiol-dependent redox regulation is more diverse
in plants than in animals, bacteria or fungi [36] Thiol– disulfide exchange reactions, which are rapid and read-ily reversible, are ideally suited to controlling protein function via the redox state of structural or catalytic
SH groups [37–39] The occurrence of thiol-dependent activities in the GPX isoenzymes suggests that they may be involved in redox modification and signal transduction in plant cells Anti-apoptotic activities have been reported for mitochondrial PhGPX [40] and tomato GPX1 [41] Similarly, it has been reported that tomato plants overexpressing an eukaryotic selenium-independent GPX (GPX5) maintained a significantly higher photosynthesis rate and fructose-1,6-bisphos-phatase activity under chilling stress, because of the sustenance of the cellular redox homeostasis [42] Fur-thermore, plant GPX isoenzymes are induced to remarkable levels by various stress conditions surmi-sing involvement in defense [6,23,43] Overexpression
of Chlamydomonas GPX in tobacco plants either in the cytosol (TcGPX) or chloroplasts (TpGPX) also resulted in the maintenance of a higher photosynthetic capacity and increased tolerance to various abiotic stresses [44] Recently, it has been reported that the atgpx3 mutation in Arabidopsis disrupted abscisic acid (ABA) activation of calcium channels and the expres-sion of ABA and stress-responsive genes [26] GPXs may thus work in tandem with peroxiredoxins, the other antioxidant enzymes utilizing Trx, to detoxify
H2O2and organic hydroperoxides and also be involved
in the regulation of the redox homeostasis by main-taining the thiol⁄ disulfide or NADPH ⁄ NADP balance
Experimental methods
Plant materials and chemicals NADPH, H2O2, GSH, E coli Trx and Trx reductase were purchased from Sigma Aldrich (St Louis, MO) Hydroper-oxides of unsaturated fatty acids were prepared by
Trang 7oxygen-ation with 2,2¢-azobis (2-amidinopropane) dehydrochloride
and purified using RP-HPLC in the mobile phase as
repor-ted previously [45] The amount of hydroperoxide was
calculated from the UV absorption at 234 nm (e¼
27400 m)1Æcm)1) Arabidopsis plants (ecotype Columbia)
were grown for 15 days in MS medium containing 3%
sucrose under a white light of 75–100 lEÆm)2Æs)1 at
25C with a 16 h light period
Cloning of AtGPX isoenzymes
Total RNA was extracted from 15-day-old Arabidopsis
seed-lings as described previously [46] First-strand cDNA was
synthesized using oligo(dT20) primer and RevTra Ace
(reverse transcriptase; Toyobo, Osaka, Japan) with 5 lg total
RNA as a template according to the manufacturer’s
proto-col Full-length cDNAs encoding mature AtGPX1 (CAT
ATGGCTGCAGAAAAAACCG⁄ GGATCCTTTAAGCG
GCAAGCAA), AtGPX2 (CATATGGCGGATGAATC
TCCAA⁄ GGATCCTCCTCCTCCTGGTGAT), AtGPX5
(CATATGGGTGCTTCATCATCAT⁄ GGATCCCTGTG
CGTGTTCACAA) and AtGPX6 (CATATGGCAGC
AGAGAAGTCTG⁄ GGATCCAGTTATCCAGATTGAA)
without transit peptides or Trx h2 (CATATGGGA
GGAGCTTTATC⁄ GGATCCGCGTTAACAATGCTCA)
and Trx h3 (CATATGGAAGAGAAGCCGCA⁄ GGATCC
AAATCAAGCAGCAGC) proteins were amplified by
RT-PCR with chimeric primers (in parenthesis) introducing the
NdeI⁄ BamHI sites into the respective forward and reverse
primers (bold sequences) The amplification conditions were
30 cycles at 94, 58 and 72C for 1 min each and final
exten-sion at 72C for 10 min The PCR product was gel purified
using GFXTMPCR Gel Band Purification kit (GE
Health-care, Chalfont St Giles, UK), ligated into pT7 vector
(Nov-agen, EMD Bioscience Inc., La Jolla, CA) and sequenced
using the dideoxy chain terminator method with an
automa-tic DNA sequencer (ABI PRISMTM310; Applied
Biosys-tems) The NdeI⁄ BamHI fragment was obtained and
subsequently ligated into pColdII vector (Takara, Kyoto,
Japan) giving an in-frame fusion with His6tag After
con-firming sequence using the same procedure mentioned above,
E coliBL21 (DE3) pLysS (Promega Corp., Madison, WI)
cells were transformed and used for the protein expression
Heterologous expression and purification of
A thaliana GPX1, -2, -5, -6 and AtTrx h2 and h3
Escherichia coliBL21 (DE3) pLysS cells containing the
pos-itive clones for AtGPX1, -2, -5 and -6, AtTrx h2 and h3
were grown in 50 mL LB medium, containing 50 lgÆmL)1
of ampicillin and 34 lgÆmL)1 of chloramphenicol at 37C
until the D600 of the culture is between 0.4 and 0.6 Cells
were kept at 15C for 30 min without shaking and the
fusion protein expression was induced by the addition of
0.4 mm isopropyl-thio-b-d-galactoside Cells were further
grown for 24 h at 15C with shaking, collected by centrifu-gation at 3000 g for 10 min with a himac CR21 centrifuge (Hitachi, Tokyo, Japan; rotor type R20A2), resuspended in
100 mm Tris⁄ HCl buffer, pH 8.0, and disrupted by sonica-tion at 10 kHz for a total of 2 min (five intervals of 40 s each) Soluble proteins were collected by centrifugation at
15 000 g for 15 min at 4C (himac CR21 centrifuge, rotor type R20A2) and purified using a HiTrapTM chelating HP column (Amersham Biosciences, Uppsala, Sweden) accord-ing to the manufacturer’s protocol Briefly, the column was washed with 10 mL of distilled water, charged with 0.5 mL
of 0.1 m NiCl2 and washed again with 5 mL of distilled water After preparation, the column was equilibrated with
10 vol of binding buffer (20 mm Tris⁄ HCl, pH 8.0, 0.5 m NaCl, 5 mm imidazole and 1 mm 2-mercaptoethanol) The sample was applied using a syringe and the column was washed with 10 vol of binding buffer containing 20 mm im-idazole The recombinant protein was eluted with 5–10 vol
of the binding buffer containing 500 mm imidazole, and collected in a 1-mL fraction Protein content was deter-mined according to the method of Bradford [47] The reduced forms of recombinant Trxs were confirmed by determining the reduction of 5,5¢-dithiobis(2-nitrobenzoic acid) (Nbs2) in the presence of E coli Trx reductase One millilitre of assay mixture contained 100 mm Tris⁄ HCl,
pH 7.5, 5 mm EDTA, 0.2 mm NADPH, 0.6 mm Nbs2
and the recombinant proteins The reaction was started
by the addition of 0.5 U E coli Trx reductase and the reduction of Nbs2 was monitored at 412 nm [e412(Nbs2)¼
13 600 m)1Æcm)1] in a spectrophotometer (data not shown) [48]
Enzymatic assays GPX activity with GSH and H2O2 or hydroperoxides was assayed spectrophotometrically at 340 nm by the decrease
in the absorbance due to the conversion of NADPH in the presence of GSH reductase, which catalyzes the reduc-tion of oxidized GSH formed by GPX [14] The reacreduc-tion mixture contained 100 mm Tris⁄ HCl, pH 7.5, 1 mm GSH, 0.2 mm NADPH, 0.1 mm H2O2 or hydroperoxides, 5 mm EDTA, 1 U GSH reductase and the enzyme in a total vol-ume of 0.5 mL Reduction of hydroperoxides was meas-ured in the same assay mixture, except that H2O2 was replaced by 0.1 mm cumene, unsaturated fatty acid or lipid hydroperoxides Enzymes activities were calculated using an e-value of 6220 m)1Æcm)1 Trx- and NADPH-dependent reduction activities were measured in a manner similar to that described previously [15,17] The GSH and GSH reductase in the reaction mixture mentioned above were replaced with E coli Trx and Trx reductase (0.3 UÆmL)1) or Arabidopsis Trx h2 and h3 (4 lm) NADPH-dependent Trx peroxidase activity was measured
in the same way as the GSH-dependent peroxidase activity mentioned above
Trang 8We thank Miss Aya Muramoto, Mr Takahisa Ogawa
and Mr Noriaki Tanabe for their excellent technical
assistance and expert advice during the course of this
experiment This work was supported by CREST, JST
(S.S: 2005-10) and by the ‘Academic Frontier’ Project
for Private Universities: matching fund subsidy from
MEXT (S.S: 2004-08)
References
1 Imlay JA (1988) DNA damage and oxygen radical
tox-icity Science 240, 1302–1309
2 Foyer CH, Valadier MH & Ferrario S (1994)
Co-regula-tion of nitrogen and carbon assimilaCo-regula-tion in leaves In
Environment and Plant Metabolism, Flexibility and
Accli-mation(Smirnoff N, ed.), pp 17–33 Bios Scientific,
Guildford
3 Mittler R (2002) Oxidative stress, antioxidants, and
stress tolerance Trends Plant Sci 9, 405–410
4 Ursini F, Maiorino M, Brigelius-Flohe´ R, Aumann
KD, Roveri A, Schomburg D & Flohe´ L (1995)
Diversity of glutathione peroxidases Methods Enzymol
252, 38–53
5 Criqui MC, Plesse B, Durr A, Marbach J, Parmentier
Y, Jamet E & Fleck J (1992) Characterization of genes
expressed in mesophyll protoplasts of Nicotiana
sylves-trisbefore the re-initiation of the DNA replicational
activity Mech Dev 38, 121–132
6 Holland D, Ben-Hayyim G, Faltin Z, Camoin L,
Stros-berg AD & Eshdat Y (1993) Molecular characterization
of salt-stress-associated protein in citrus: protein and
cDNA sequence homology to mammalian glutathione
peroxidase Plant Mol Biol 21, 923–927
7 Sugimoto M & Sakamoto W (1997) Putative
phospholi-pids hydroperoxide glutathione peroxidase gene from
Arabidopsis thalianainduced by oxidative stress Genes
Genet Syst 72, 311–316
8 Roeckel-Drevet P, Gango G, deLabrouhe T, Dufaure
JP, Nicolas P & Drevet JR (1998) Molecular
characteri-zation, organ distribution and stress-mediated induction
of two glutathione peroxidase-encoding mRNAs in
sun-flower (Helianthus annuus) Physiol Plant 103, 385–394
9 Depege N, Drevet J & Boyer N (1998) Molecular
clon-ing and characterization of tomato cDNAs encodclon-ing
glutathione peroxidase-like proteins Eur J Biochem 253,
445–451
10 Mullineaux PM, Karpinski S, Jimenez A, Cleary SP,
Robinson C & Creissen GP (1998) Identification of
cDNAS encoding plastid-targeted glutathione
peroxi-dase Plant J 13, 375–379
11 Jung BG, Lee KO, Lee SS, Chi YH, Jang HH, Kang
SS, Lee K, Lim D, Yoon SC & Yun DJ (2002) A
Chinese cabbage cDNA with high sequence identity to
phospholipids hydroperoxide glutathione peroxidase encodes a novel isoform of thioredoxin-dependent per-oxidase J Biol Chem 277, 12572–12578
12 Xiao-Dong Y, Jun LW & Yuan LJ (2005) Isolation and characterization of a novel PhGPx gene in Raphanus sativus Biochem Biophys Acta 1728, 199–205
13 Leisinger U, Ru¨fenacht K, Zehnder AJB & Eggen RIL (1999) Structure of a glutathione peroxidase homolo-gous gene involved in the oxidative stress response in Chlamydomonas reinhardtii Plant Sci 149, 139–149
14 Takeda T, Nakano Y & Shigeoka S (1993) Effects of selenite, CO2and illumination on the induction of sele-nite-dependent glutathione peroxidase in Chlamydomo-nas reinhardtii Plant Sci 94, 81–88
15 Gaber A, Tamoi M, Takeda T, Nakano Y & Shigeoka
S (2001) NADPH-dependent glutathione peroxidase-like proteins (Gpx-1, Gpx-2) reduce unsaturated fatty acid hydroperoxides in Synechocystis PCC 6803 FEBS Lett
499, 32–36
16 Tanaka T, Izawa S & Inoue Y (2005) GPX2, encoding a phospholipid hydroperoxide glutathione peroxidase homologue, codes for an atypical 2-Cys peroxiredoxin in Saccharomyces cerevisiae J Biol Chem 280, 42078–42087
17 Herbette S, Lenne C, Leblanc N, Julien JL, Drevert JR
& Drevert PR (2002) Two GPX-like proteins from Lycopersicon esculentumand Helianthus annuus are anti-oxidant enzymes with phospholipid hydroperoxide glu-tathione peroxidase and thioredoxin peroxidase activities Eur J Biochem 269, 2414–2420
18 Das KC & White CW (2002) Redox systems of the cell: possible links and implications Proc Natl Acad Sci USA 99, 9617–9618
19 Grene R (2002) Oxidative stress and acclimation mecha-nisms in plants In The Arabidopsis Book (Somerville
CK & Meyerwitz EM, eds), pp 1–19 American Society
of Plant Biologists, Rockville, MD
20 Buchanan BB, Schu¨rmann P, Wolosiuk RA & Jacquot
JP (2002) The ferredoxin⁄ thioredoxin system: from dis-covery to molecular structures and beyond Photosynth Res 73, 215–222
21 Schu¨rmann P & Jacquot JP (2000) Plant thioredoxin system revisited Annu Rev Plant Physiol Plant Mol Biol
51, 371–400
22 Gelhyde E, Rouhier N, Ge´rard J, Jolivet Y, Gualberto
J, Navrot N, Ohlsson PI, Wingsle G, Hirasawa M, Knaff DB et al (2004) A specific form of thioredoxin h occurs in plant mitochondria and regulates alternative oxidase Proc Natl Acad Sci USA 101, 14545–14550
23 Rodriguez Milla MA, Maurer A, Rodriguez Huete A & Gustafson JP (2003) Glutathione peroxidase genes in Arabidopsisare ubiquitous and regulated by abiotic stresses through diverse signaling pathways Plant J 36, 602–615
24 Jean-Benoit P, Ytterberg AJ, Sun Q & Klaas JW (2004) New functions of the thylakoid membrane proteome of
Trang 9Arabidopsis thalianarevealed by a simple, fast, and
ver-satile fractionation strategy J Biol Chem 279, 49367–
49383
25 Myriam F, Salvi D, Brugie´re S, Miras S, Kowalski S,
Louwagie M, Garin J, Joyard J & Rolland N (2003)
Proteomics of the chloroplast envelope membranes from
Arabidopsis thaliana Mol Cell Proteomics 2, 325–345
26 Miao Y, Lv D, Wang P, Wang XC, Chen J, Miao C &
Song CP (2006) An Arabidopsis glutathione peroxidase
functions as both a redox transducer and a scavenger in
abscisic acid and drought stress responses Plant Cell,
doi:10.1105⁄ tpc.106.044230
27 Mairino M, Aummann KD, Brigelius-Fohle´ R, Doria
D, Van den Heuvel J, McCarthy J, Roveri A, Ursini F
& Fohle´ L (1995) Probing the presumed catalytic triade
of selenium-containing peroxidases by mutational
analy-sis of phospholipid hydroperoxide glutathione
peroxi-dase (PhGPx) Biol Chem Hoppe-Seyler 376, 651–660
28 Wilkinson SR, Meyers DJ & Kelly JM (2000)
Biochem-ical characterization of trypanosome enzyme with
glu-tathione dependent peroxidase activity Biochem J 352,
755–761
29 Avery AM & Avery SV (2001) Saccharomyces cerevisiae
expresses three phospholipid hydroperoxide glutathione
peroxidases J Biol Chem 276, 33730–33735
30 Sztajer H, Gamain B, Aumann KD, Slomainny C,
Becker K, Brigelius-Folhe R & Folhe L (2001) The
putative glutathione peroxidase gene of Plasmodium
fal-ciparumcodes for a thioredoxin peroxidase J Biol Chem
276, 7397–7403
31 Ahmad U, Xianzhi J, Saori F, Jeanho Y, David LS,
Yi-Chun JW, Kartiki VD, Jeffrey EJ, Phang-Lang C &
Wen-Hwa L (2004) Identification of a novel
putative non-selenocysteine containing phospholipid
hydroperoxide glutathione peroxidase (NPGPx) essential
for alleviating oxidative stress generated from
polyunsa-turated fatty acids in breast cancer cells J Biol Chem
279, 43522–43529
32 Holmgren A (1985) Thioredoxin Annu Rev Biochem 54,
37–271
33 Holmgren A (1989) Thioredoxin and glutaredoxin
sys-tems J Biol Chem 264, 13963–13966
34 Laloi C, Rayapuram N, Chartier Y, Grienberger JM,
Bonnard G & Meyers Y (2001) Identification and
char-acterization of a mitochondrial thioredoxin system in
plants Proc Natl Acad Sci USA 98, 14144–14149
35 Collin V, Bourguet EI, Marchand C, Hirasawa M,
Lancelin JM, Knaff DB & Maslow MM (2003)
Arabi-dopsisplastidial thioredoxins; new function and new
sight into specificity J Biol Chem 278, 23747–23752
36 Dietz KJ, Jacob S, Oelze ML, Laxa M, Tognetti V,
de Miranda SM, Baier M & Finkemeier I (2006) The
function of peroxiredoxins in plant organelle redox metabolism J Exp Bot 57, 1697–1709
37 Laughner BJ, Sehnke PC & Ferl RJ (1998) A novel nuclear member of the thioredoxin superfamily Plant Physiol 118, 987–996
38 Motohashi K, Kondoh A, Stumpp MT & Hisabori T (2001) Comprehensive survey of proteins targeted by chloroplast thioredoxin Proc Natl Acad Sci USA 98, 11224–11229
39 Laloi C, Dominique MO, Marco Y, Meyers Y & Reichheld JP (2004) The Arabidopsis h5 gene induction
by oxidative stress and its W-box mediated response to pathogen elicitor Plant Physiol 134, 1006–1016
40 Nomura K, Imai H, Koumura T, Arai M & Nakagawa
Y (1999) Mitochondrial phospholipid hydroperoxide glutathione peroxidase suppresses apoptosis mediated
by a mitochondrial death pathway J Biol Chem 274, 29294–29302
41 Chen S, Vaghchhipawala Z, Li W, Asard H & Dickman
MB (2004) Tomato phospholipid hydroperoxide glu-tathione peroxidase inhibits cell death induced by Bax and oxidative stresses in yeast and plants Plant Physiol
135, 1630–1641
42 Herbette S, Menn AL, Rousselle P, Ameglio T, Faltind
Z, Branlard G, Eshdat Y, Julien JL, Drevet JR & Dre-vet PR (2005) Modification of photosynthetic regulation
in tomato overexpressing glutathione peroxidase Biochim Biophys Acta 1724, 108–118
43 Churin Y, Schilling S & Borner T (1999) A gene family encoding glutathione peroxidase homologues in Hor-dium vulgare FEBS Lett 459, 33–38
44 Yoshimura K, Miyao K, Gaber A, Takeda T, Kanabo-shi H, Miyasaka H & Shigeoka S (2004) Enhancement
of stress tolerance in transgenic tobacco plants over expressing Chlamydomonas glutathione peroxidase in cytosol or chloroplast Plant J 37, 21–33
45 Funk CD, Gunne H, Steiner H, Izumi T & Samuelsson
B (1989) Native and mutant 5-lipoxygenase expression
in baculovirus⁄ insect cell system Proc Natl Acad Sci USA 86, 2592–2596
46 Ogawa T, Ueda Y, Yoshimura K & Shigeoka S (2005) Comprehensive analysis of cytosolic Nudix hydrolases from Arabidopsis thaliana J Biol Chem 280, 25277– 25283
47 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein util-izing the principle of protein–dye binding method Anal Biochem 717, 1448–1454
48 Pasternak C, Haberzettl K & Klug G (1999) Thiore-doxin is involved in oxygen-regulated formation of the photosynthetic apparatus of Rhodobacter sphaeroides
J Bacteriol 181, 100–106