The crystal structure of Escherichia coli CMP kinase, either alone or in complex with the reaction product CDP or various NMPs CMP, dCMP, AraCMP and ddCMP, underlined the residues involv
Trang 1amino acid substitutions in the pyrimidine base binding pocket of Escherichia coli CMP kinase
Augustin Ofiteru1, Nadia Bucurenci1, Emil Alexov2, Thomas Bertrand3,*, Pierre Briozzo3,
He´le`ne Munier-Lehmann4and Anne-Marie Gilles5
1 Laboratory of Enzymology and Applied Microbiology, Cantacuzino Institute, Bucharest, Romania
2 Department of Physics and Astronomy, Clemson University, SC, USA
3 UMR INRA-AgroParisTech 206 de Chimie Biologique, Institut National Agronomique Paris-Grignon, Thiverval-Grignon, France
4 Unite´ de Chimie Organique, Institut Pasteur, Paris, France
5 Unite´ de Ge´ne´tique des Ge´nomes Bacte´riens, Institut Pasteur, Paris, France
NMP kinases are key enzymes in the biosynthesis and
regeneration of ribo- and deoxyribonucleoside
triphos-phates [1] They also participate in the activation of
prodrugs such as AZT or acyclovir which are mainly
used to treat cancer or viral infection [2] They
catalyse reversible transfer of the c-phosphoryl group
from a nucleoside triphosphate, generally ATP, to a
particular nucleoside monophosphate according to the scheme: Mg.ATP + NMP« Mg.ADP + NDP Although NMP kinases from different species are well conserved in terms of both sequence and 3D structure, variations in their substrate specificity [3–5] or quater-nary structure [6–11] are frequently observed In eukaryotes, phosphorylation of UMP and CMP is
Keywords
CMP kinase; nucleobase specificity; protein
stability; site-directed mutagenesis; X-ray
crystallography
Correspondence
A.-M Gilles, Unite´ de Ge´ne´tique des
Ge´nomes Bacte´riens, Institut Pasteur, 28,
rue du docteur Roux, 75724 Paris, France
Fax: +33 1 45 68 89 48
Tel: +33 1 45 68 89 68
E-mail: amgilles@pasteur.fr
*Present address
Sanofi-Aventis Chemical Sciences,
Vitry-sur-Seine, France
(Received 5 February 2007, revised 2 May
2007, accepted 7 May 2007)
doi:10.1111/j.1742-4658.2007.05870.x
Bacterial CMP kinases are specific for CMP and dCMP, whereas the rela-ted eukaryotic NMP kinase phosphorylates CMP and UMP with similar efficiency To explain these differences in structural terms, we investigated the contribution of four key amino acids interacting with the pyrimidine ring of CMP (Ser36, Asp132, Arg110 and Arg188) to the stability, catalysis and substrate specificity of Escherichia coli CMP kinase In contrast to euk-aryotic UMP⁄ CMP kinases, which interact with the nucleobase via one or two water molecules, bacterial CMP kinase has a narrower NMP-binding pocket and a hydrogen-bonding network involving the pyrimidine moiety specific for the cytosine nucleobase The side chains of Arg110 and Ser36 cannot establish hydrogen bonds with UMP, and their substitution by hydrophobic amino acids simultaneously affects the Km of CMP⁄ dCMP and the kcat value Substitution of Ser for Asp132 results in a moderate decrease in stability without significant changes in Kmvalue for CMP and dCMP Replacement of Arg188 with Met does not affect enzyme stability but dramatically decreases the kcat⁄ Km ratio compared with wild-type enzyme This effect might be explained by opening of the enzyme⁄ nucleo-tide complex, so that the sugar no longer interacts with Asp185 The reac-tion rate for different modified CMP kinases with ATP as a variable substrate indicated that none of changes induced by these amino acid sub-stitutions was ‘propagated’ to the ATP subsite This ‘modular’ behavior of
E coliCMP kinase is unique in comparison with other NMP kinases
Abbreviations
AK, adenylate kinase; AK1, muscle cytosolic adenylate kinase; MCCE, multi-conformation continuum electrostatic.
Trang 2accomplished by a single enzyme [12–14] In
prokaryo-tes, there are distinct NMP kinases for each pyrimidine
nucleotide: CMP⁄ dCMP, UMP and TMP
Bacterial CMP kinases (EC 2.7.4.14) conserve the
three-domain overall fold of eukaryotic UMP⁄ CMP
kinases (EC 2.7.4.14): the central parallel b-sheet
together with surrounding a-helices, defined as the
CORE domain, is conserved in NMP kinases It is
used as a rigid platform around which the short
a-heli-cal LID domain, situated in the C-terminal moiety,
and the NMP-binding (NMPbind) domain move in an
induced-fit mechanism, closing upon binding of the
phosphate donor and acceptor nucleotides, respectively
[15]
The crystal structure of Escherichia coli CMP kinase,
either alone or in complex with the reaction product
CDP or various NMPs (CMP, dCMP, AraCMP and
ddCMP), underlined the residues involved in
recogni-tion of the nucleobase, pentose moiety and phosphate
group(s) [15], and site-directed mutagenesis
experi-ments have further confirmed the role of Ser101,
Arg181 and Asp185 in pentose recognition [16] How-ever, the main difference between eukaryotic and bacterial NMP kinases concerns the recognition of pyrimidine nucleotides The structure of E coli CMP kinase in complex with CMP or dCMP showed that discrimination between CMP and UMP is achieved by Ser36, Arg110 and Asp132, which form hydrogen bonds with the amino group and the N3 atom of the cytosine (Fig 1) This study uses site-directed muta-genesis to further explore the contribution of these amino acids interacting with the pyrimidine ring to the catalysis of E coli CMP kinase Substitution of the side chain from a well-structured protein can have two types of consequence: (a) a purely localized effect of binding due to removal of a specific interaction between the enzyme and its substrate; (b) a more glo-bal effect due to subtle or gross changes in enzyme conformation Therefore, our study was completed using numerical calculations to better emphasize the role of each of these residues on protein stability The results highlight the importance of the
N O
OH
N O HO
NH2 O
O
H
P
HO
O
N O
HO
O
HO P HO O
NH O
D129
S3 CMP
R188
O
N4
N3 O2
R110 D132 D185
OG
O2’
O3’
Fig 1 Comparative structures of CMP and UMP, and interactions between the cyto-sine moiety of nucleotide and various side chains of wild-type CMP kinase (Upper) Chemical differences between CMP and UMP are indicated in red (Lower) Hydrogen bonds are indicated with green dots, carbon atoms being indicated in grey (enzyme) or yellow (nucleotide) D185, a residue close to R188 and involved in ribose binding is also shown Drawn using PYMOL [41].
Trang 3binding network surrounding the cytosine moiety in
the specificity of the enzyme for the acceptor
nucleo-tide Because this specificity is characteristic of
bacter-ial CMP kinases, these enzymes represent possible
targets for antibacterial drugs [17]
Results
Overproduction and molecular characterization of
the modified variants of E coli CMP kinase
The wild-type and various modified forms (S36A,
R110M, D132A, D132H, D132N, D132S and R188M)
of E coli CMP kinase overproduced in strain
BL21(DE3) represented between 25 and 30% of
sol-uble E coli proteins Recombinant enzymes adsorbed
onto a Blue-Sepharose column equilibrated with
50 mm Tris⁄ HCl pH 7.4, were then eluted with 1 m
NaCl In the case of the D132S mutant, higher NaCl
concentrations (2 m) were required for complete
elu-tion of the protein Gel permeaelu-tion chromatography
on Ultrogel AcA54 yielded pure enzymes, which
according to appropriate markers corresponded to
monomers After prolonged dialysis against
ammo-nium bicarbonate a small proportion of dimers were
formed, even in the case of the wild-type protein as
indicated by ESI-MS or SDS⁄ PAGE in the absence of
reducing agents The proportion of dimers increased
notably in D132A and D132S mutants
Thermal denaturation experiments, summarized in
Table 1, indicated that S36A and R188M substitutions
did not affect protein stability, Tm (melting
tempera-ture) values being identical or very close to that of the
native enzyme Other substitutions (D132S, D132N
and D132H) led to a moderate decrease in stability,
lowering Tm by 4–5C compared with the wild-type
protein The last group includes amino acid
substitu-tions (D132A and R110M) that noticeably lowered the
stability of CMP kinase
Limited proteolysis experiments did not detect signi-ficant differences between wild-type CMP kinase and its variants The first-order rate constant of inactiva-tion by TPCK-trypsin at 4C was found to be around
3· 10)3Æs)1 Addition of ATP protected all modified CMP kinases, decreasing the first-order rate constant
of inactivation by a factor of 5–10 (data not shown)
Effect of charge alterations on protein stability Because all mutations altered the protein charge, we evaluated their potential effect with numerical calcula-tions using the CMP⁄ CMP kinase model (PDB code 1kdo) for each of the sites selected for site-directed mutagenesis (Table 1)
Numerical calculations showed that S36 is not involved in significant interactions with the side chains
of its neighbouring protein residues By contrast, S36 forms a strong hydrogen bond with the backbone of D129 However, the favourable energy of the hydrogen bond is almost completely cancelled out by the desol-vation penalty of S36 Thus, its replacement by Ala is not expected to change the protein stability
In the wild-type protein, R188 is involved in salt-bridge with D185 and in many other interactions with neighbouring residues such as R110, D132 Despite this complicated network of interactions, R188M sub-stitution does not have a significant effect on the experimentally measured protein stability However, calculations using the multi-conformation continuum electrostatic (MCCE) method for the ionization states
of native and R188M-modified structures revealed a major difference In the absence of R188, D185 is cal-culated to be neutral (protonated) Thus, by turning off both charges (of R188 and D185), the protein reduces the effect of amino acid substitution on enzyme stability to almost zero This a typical example
of charge rearrangement caused by an amino acid substitution
In the wild-type enzyme, D132 is also involved in
a complicated network of interactions, the strongest being with R110 The energy balance in wild-type CMP kinase shows that D132 contributes to the stabil-ity by )37.7 kJ Thus, replacing this residue with Ser, Ala or His should have a significant effect on stability, depending on the substituting residue MCCE calcula-tions showed that in all modified forms of CMP kinase the R110 side chain reorients and becomes more exposed to the solution This reduces the energy cost
of the mutation No change in the ionization states was found to be induced by the mutation However, the D132H variant does not introduce charge reversal, because His is calculated to be deprotonated (neutral)
Table 1 Thermal stability of E coli CMP kinase variants (Tm) and
calculated stability changes (DDG) upon amino acid substitution
with respect to the energy of the wild-type enzyme.
Trang 4in modified CMP kinase Thus, the three variants
D132S, D132N and D132H result in replacement of a
negatively charged residue with a polar residue Each
of the substituting residues is involved in favourable
interactions with its neighbours and thus further
redu-ces the effect of the mutation This is why D132A
sub-stitution has the largest effect on stability The side
chain of Ala, located in a very hydrophilic
environ-ment does not have favourable energy and further
destabilizes the mutant
R110 is involved in many interactions but, as shown
previously, its major partner is D132 Removal of
R110 leaves D132 without the favourable pairwise
energy but D132 is calculated to be still ionized Thus,
in contrast to R188M where D185 plays a
compensa-tory role, D132 does not and this results in a dramatic
decrease in protein stability upon R110M mutation
However, the calculated energy change for the R110M
mutation is quite similar to that for D132A (Table 1)
Kinetic properties of the modified variants of
E coli CMP kinase with CMP, dCMP and UMP
as variable substrates
Substitution by hydrophobic side chains of the four
amino acids demonstrated by crystallography as
inter-acting with the cytosine moiety of CMP and dCMP,
always affected the kinetic parameters of bacterial
CMP kinase (Table 2) The S36A substitution mainly
changed the Km value for the two natural substrates,
which increased by a factor of 70 (CMP) and 37
(dCMP) compared with the parent molecule The
decrease in kcat of only 1.6-fold (CMP) and 7.4-fold
(dCMP) with respect to the wild-type enzyme
sugges-ted that the major role of S36 is related to
CMP⁄ dCMP binding to the active site The S36A
sub-stitution did not significantly affect phosphorylation of
UMP We note that S36, which is common to CMP
kinases from Gram-negative organisms, alternates in
CMP kinases from Gram-positive bacteria with a Thr
residue, but never with Ala as in the case of
Dictyoste-lium discoideum UMP⁄ CMP kinase By contrast, the
A37T substitution in the slime mold enzyme (A M
Gilles, P Glaser and L L Ylisastigui-Pons,
unpub-lished data) or the T39A substitution in the pig muscle
cytosolic adenylate kinase [18] had no consequence on
binding or phosphorylation of the corresponding
NMPs (A37 and T39 in these enzymes are equivalent
to S36 in E coli CMP kinase)
Substitution of R110 with Met in E coli CMP
kin-ase affected both kcat and Km The kcat⁄ Km ratio with
CMP and dCMP decreased by a factor of > 105in the
modified protein compared with wild-type enzyme
The kcat⁄ Kmratio with UMP as substrate decreased by
a factor of only 200 compared with wild-type CMP kinase The loss in stability of R110M mutant might
be responsible at least in part for the modified kinetic properties This is not the case for the R188M variant, whose thermal stability is similar to that of the wild-type enzyme; however, the kcat⁄ Km ratio with CMP and dCMP decreased by a factor > 104compared with wild-type enzyme
To explain these effects, the R188M variant was crystallized either alone or in complex with dCMP Information on data collection, processing, refinement and model statistics are given in Table 3 For the free enzyme, the structure of this mutant could be success-fully refined It was found to be identical to that of the wild-type CMP kinase By contrast, the data for this variant in complex with dCMP were of poor quality due to anisotropy of the crystals As a consequence, the model was refined to a Rcryst of 25.9% and a Rfree
of 33.9% The Rfree⁄ Rcryst ratio is 1.31, which is not
Table 2 Kinetic parameters of E coli CMP kinase variants with three NMP substrates at a single fixed concentration of ATP (1 m M ) Curve-fit was performed using the nonlinear least-squares fitting analysis of KALEIDAGRAPH software Kmis the Michaelis–Men-ten constant; k cat was calculated assuming a molecular mass of
E coli CMP kinase of 24.7 kDa Values are means of two to four independent measurements.
Enzyme Nucleotide
Km (m M )
kcat (s)1)
kcat⁄ K m
(s)1Æm M )1)
Trang 5unusual for a 2.8 A˚ resolution structure [19] However,
the electron-density map of the substrate-binding
region was unambiguous As shown in Fig 2, the
structure is in an ‘open’ form in which deoxyribose
does not establish H bonds with enzyme residues In
the structure of the wild-type CMP kinase in complex
with dCMP [16], there are two, quite different,
mole-cules in the asymmetric unit (rmsd¼ 0.89 A˚) In the A
molecule, the 3¢OH from deoxyribose forms hydrogen
bonds with D185 and R181 residues as for CMP
bind-ing The R188M variant in complex with dCMP is in
many respects comparable with the B molecule of
wild-type CMP kinase complexed to dCMP, in which
the deoxyribose does not interact with R181 or D185
Moreover, the hydrogen bond, which connected R188
and the carbonyl from cytosine, is lost It seems
there-fore that the role of R188 is to maintain a closed
structure of the protein by direct interaction with the
substrate (Fig 1)
Replacement of D132 with Ala had the most
dra-matic consequences on the protein stability as Tm
decreased by 9C in comparison with the wild-type
protein The kcat⁄ Km ratio for CMP and dCMP
decreased by more than three orders of magnitude in comparison with the wild-type enzyme, indicating a loss of 19.2 and 20.0 kJ per mole in the stability of the transition state complex At the same time, the kcat⁄ Km ratio with UMP as substrate remained unchanged Moreover, the kcat value with UMP increased by one order of magnitude with respect to the wild-type enzyme, at the expense of the Km value The overall effect of this structural change is a twofold increase in the kcat⁄ Km ratio with UMP as substrate over the
kcat⁄ Km ratio with CMP as substrate The relative increase in the specificity of the D132A variant for UMP over CMP and dCMP is somehow unexpected
It reflects an increase in local flexibility of the polypep-tide chain with loss of discrimination between the three nucleotides Because of its size, polarity and charge D132 plays a unique role in both protein stability and kinetic properties Consequently, several other variants were explored in which each of these properties of the aspartate side chain was altered individually Because the D132S variant essentially conserved the properties
of the wild-type enzyme, it appears that the major fac-tor in CMP⁄ dCMP recognition by D132 is its hydro-gen-bonding capacity The kinetic parameters of the D132H variant were modified in the expected sense because the charge of this residue was removed The D132N substitution was designed to ‘conserve’ the size
of the original molecule and part of its
hydrogen-Table 3 Structural data.
Data collection
Unit cell (A ˚ , )
Completeness (%) 97.9 (86.1) a 92.3 (84.6) a
Refinement statistics
R crystc(%) 23.1 1 25.9
rmsd
a
Numbers in parentheses represent values in the highest
resolu-tion shell (last of 20 shells) b Rsym¼ S h S i |I(h,i) ) < I(h) > | ⁄ S h S i
I(h,i) where I(h,i) is the intensity value of the i-th measurement of h
and < I(h) > is the corresponding mean value of I(h) for all i
meas-urements c Rcryst¼ S ||F obs | ) |F calc || ⁄ S |F obs |, where |Fobs| and
|Fcalc| are the observed and calculated structure factor amplitudes,
respectively.dR free is the same as R cryst but calculated with a 10%
subset of all reflections that was never used in crystallographic
refinement.
D129
S36
dCMP
M188
R110
D132
D185
N4
Fig 2 Electron-density map of the dCMP-binding region for the R188M CMP kinase variant The F o ) F c omit map calculated for the dCMP–R188M CMP kinase complex in the absence of the dCMP model is green The contour level is at 2 r The same neigh-bouring enzyme residues as those of Fig 1 are shown, in the same orientation, with their 2F o ) F c map in magenta (contour level 1 r) The only hydrogen bond still observed for dCMP–R188M CMP kinase complex is indicated by green dots.
Trang 6bonding ability However, it strongly affected the
stability and catalytic properties of the protein in
com-parison with the wild-type enzyme This suggests that
both hydrogen bonds (Fig 1) received by the side
chain of D132, from the H bond donors R110 (side
chain extremity) and N4 from cytosine, are important
for the enzyme As shown in Table 2, introduction of
a H-bond donor via Asn substitution of D132 is
not compatible with enzyme binding and substrate
catalysis
Kinetic and nucleotide-binding properties of
E coli CMP kinase variants with ATP as variable
substrate
Determination of the reaction rates of different modified
CMP kinases with ATP as the variable substrate at fixed
concentrations of NMP (around the corresponding Km
values) yielded apparent Km values for ATP between
0.04 and 0.08 mm, irrespective of the chemical nature of
NMP or the substituted residue This was also
con-firmed by fluorescence experiments using Ant-dATP as
a reporter molecule [20] The Kdvalue for the complex
of various proteins with the fluorescent derivative was
between 4 and 10 lm, whereas Kdvalues for complexes
with ATP varied between 14 and 25 lm This means that
structural modifications affecting the NMP subsite of
the catalytic centre of bacterial CMP kinases are not
‘propagated’ to the ATP subsite In this respect, E coli
CMP kinase is unique in comparison with other NMP
kinases, in particular with adenylate kinases [21]
Discussion
A common property of various NMP kinases, except
for bacterial UMP kinases, is an overall fold consisting
of three domains, the CORE, the LID and the
NMPbind[1] A characteristic of bacterial CMP kinases
is an extension of the NMPbind domain by 40 amino
acid residues forming a three-stranded antiparallel
b sheet and two a helices This large NMPbind insert
undergoes rearrangement during the binding of
cyto-sine nucleotides, its b sheet moving away from the
substrate and the a helices coming closer to it [15]
Sequence comparison of E coli or many other
bacter-ial CMP kinases indicated that the basic residues
inter-acting with the phosphate group of CMP or dCMP
(R41, R131 and R181) are conserved in NMP kinases
irrespective of the chemical nature of the acceptor
sub-strate (Fig 3) Thus, R41 is conserved as R42 in
D discoideum UMP⁄ CMP kinase and as R44 in pig
muscle cytosolic adenylate kinase (AK1) The R44M
substitution in pig muscle AK1 decreases over two
orders of magnitude the kcat⁄ KAMP
m ratio in comparison with the wild-type enzyme [18] Similarly, R131 in
E coliCMP kinase is conserved as R93 in D discoideum UMP⁄ CMP kinase, R96 in human UMP ⁄ CMP kinase and R97 in pig muscle AK1 R97M substitution in the latter enzyme decreases, by three orders of magnitude, the kcat⁄ KAMP
m ratio in comparison with wild-type pro-tein [21] Finally, R181 in E coli CMP kinase is con-served as R149 in pig muscle AK1 Substitution of these residues by the hydrophobic side-chain of methi-onine decreases in these two enzymes both the Kmfor NMP and the kcatcompared with the parent molecules [16,18] In conclusion, the amino acids interacting with the phosphate group of NMP and conserved in eukaryotic UMP⁄ CMP kinases, bacterial CMP kinases and eukaryotic or bacterial adenylate kinases, most probably have identical roles during catalysis
The situation is different when comparing the nucleobase recognition by eukaryotic UMP⁄ CMP kinases and bacterial CMP kinases Thus, despite opposing hydrogen-bonding properties at positions 3 and 4 of the pyrimidine ring, UMP and CMP are phosphorylated with similar efficiency by D discoideum UMP⁄ CMP kinase [13] This might be explained by the fact that the base located in a hydrophobic pocket
of D discoideum enzyme interacts with the protein indirectly, via one (with CMP) or two (with UMP) close water molecules connected to the carboxamide group of N97 The side chain of N97, like the water molecule, can switch to either hydrogen bond accep-tor or donor depending on its orientation, and pro-vides a flexible way to accommodate either CMP or UMP in the NMP-binding site [22] The residues forming the hydrophobic pocket in D discoideum UMP⁄ CMP kinase are conserved in the equivalent human or yeast enzymes This scenario is not compat-ible with bacterial CMP kinases in which UMP is a very poor substrate compared with CMP The side chain of R110 is a hydrogen bond donor to the N3 atom of cytosine As the main chain carbonyl of D129, a H-bond acceptor, interacts with the terminal oxygen of S36 side chain, the latter can only behave
as a H-bond acceptor with the nucleobase as is the case with the four-amino group of cytosine These hydrogen bonds involving side chains from R110 and S36 could not be established with UMP
Each of these residues could, in principle, also be important for stability of the protein Partial coupling between the structural and functional roles can be observed for D132 Substitution by Ser results in a moderate decrease in stability without significant chan-ges in Kmfor CMP and dCMP However, replacement
of D132 with Asn or His results in a completely
Trang 7different Kmfor CMP, but only slightly affects the Km
for dCMP Finally, replacement of D132 with Ala has
a dramatic effect on both stability and activity This
indicates that the residue at position 132 is structurally
important, and also plays a role in the reaction, most
probably as hydrogen acceptor to CMP⁄ dCMP Much
more prominent is the coupling effect for the Arg
resi-due at position 110 Mutation of Arg to Met causes a
dramatic decrease in both the stability and reaction
rate for all substrates In contrast, residues 36 and 188
are ‘pure’ functional ones Substitution of Ser36 to Ala
does not change the stability but has great effect on
the activity Thus, Ser36 is not important energetically
but serves as a hydrogen bond acceptor for the
sub-strate R188M substitution does not affect the stability,
but this may be related to the compensatory role of
Asp185 Thus, the salt bridge R188–D185 has a
negli-gible contribution to the stability of the protein and its
substitution does not cause a change in Tm However,
suppression of the R188–D185 ‘bridge’ has a dramatic
effect on the reaction
Analysis of the effect of the mutations on protein stability revealed three distinctive mechanisms of relaxation, and in the case of S36A, no relaxation at all The first type of relaxation (structural relaxation), which involves only proton and side chain motions, is seen in D132 and R110 mutants Substitution of either D132 or R110 disrupts the salt bridge D132–R110 and causes the partner side chain to adopt a different conformation, thereby reducing the effect of the muta-tion The other two types of relaxation are mainly charge relaxation Replacing D132 with His is sup-posed to reverse the charge at position 132 and should have a dramatic effect on stability However, the sub-stituting residue is calculated to be neutral and thus has a zero net charge Unfavourable interactions with R110 make the pKavalue for H132 far below the phy-siological pH and thus turn off the His charge Because the pKa of isolated His is 6.5, the difference
in ionization energy of His in the denaturated state (where His is presumably ionized) and in the protein
is very small and does not affect the results [23] The
Fig 3 Sequence alignment of E coli CMP kinase with human, D discoideum and yeast UMP ⁄ CMP kinases and with pig muscle cytosolic adenylate kinase (AK1), respectively Residues common to all proteins are indicated in black, residues common to the last four enzymes are
in grey Asterisks and triangles on the top of sequences indicate conserved residues involved in the interaction with the phosphate moieties
of various NMPs (R41, R131 and R181 in E coli CMP kinase) and the four modified residues of E coli CMP kinase specifically interacting with the cytosine moiety (S36, R110, D132 and R188), respectively.
Trang 8third case is a charge relaxation involving
neighbour-ing group Substitution of R188 to Met does not
affect stability because the removal of R188 causes
de-protonation of its partner D185 and thus the net
effect is almost zero A similar effect was suggested to
occur in the reaction centre when particular residues
were mutated [24] This effect can be explained in
a different manner considering the salt bridge
R188–D185 as a dipole from the distal point of the
rest of the protein Such a dipole will have weak
inter-actions with the rest of the protein Thus, if turned off
(by removal of Arg and protonation of Asp185), the
protein energy should not change by much, as found
experimentally
Experimental procedures
Chemicals
Nucleotides, restriction enzymes, T4 DNA ligase, T4 DNA
polymerase and coupling enzymes were from Roche
Applied Sciences (Indianapolis, IN) T7 DNA polymerase
was from Amersham-Biosciences (Piscataway, NJ) Affi-Gel
Blue was from Bio-Rad Laboratories (Hercules, CA)
CMP, dCMP, AraCMP and UMP were purchased from
Sigma (St Louis, MO) NDP kinase from D discoideum
(2000 U mg)1of protein) was kindly provided by M Ve´ron
(Institut Pasteur, Paris)
Bacterial strains, plasmids, growth conditions
and DNA manipulation
Site-directed mutagenesis was performed according to
Kun-kel et al [25] with single-stranded DNA of pHS210 [20]
grown in E coli strain CJ236 in the presence of the helper
phage M13K07 The primers used to create the point
mutations, where the changed codons are underlined, were:
S36A: AATTGCACCTGCGTCCAGCAGATG; R110M:
TAATGCTTCCATAACGCGTGGGAA; D132A: CGTTC
CCATTGCGCGGCCATCGGC; D132H: TACCACCGT
TCCCATATGGCGGCCATCGGCAAT; D132N: TACCAC
CGTTCCCATATTGCGGCCATCGGCAAT; D132S:
TAC CACGTTCCCATGGAGCGGCCATCGGCAAT;
R188M: CGCTACCGCCATGTTACGATCGCG For
each mutagenesis, the whole sequence of the cmk gene was
checked for the absence of any other mutation [26] Plasmid
pHS210 and derivatives were introduced into the E coli
strain BL21(DE3)⁄ pDIA17 [27] Overproduction was
car-ried out by growing bacteria at 37C in 2YT medium [28]
supplemented with ampicillin (100 lgÆmL)1) and
chloram-phenicol (30 lgÆmL)1) When A600¼ 1.5, isopropyl thio
b-d-galactoside (1 mm final concentration) was added to
the medium Bacteria were harvested by centrifugation 3 h
after induction at 5000 g for 15 min at 4C (Sorvall RC 5B)
Purification of the enzymes, activity assays and other analytical procedures
Overproduced wild-type and modified variants of E coli CMP kinase were purified as described previously [20] and checked by MS (a quadrupole API-365 mass spectrometer from Perkin-Elmer, Norwalk, NJ) equipped with an ion spray (nebulizer-assisted electrospray) source Protein con-centration was measured according to Bradford [29] SDS⁄ PAGE was performed as described by Laemmli [30] Enzyme activity was determined at 30C and 340 nm using
a coupled spectrophotometric assay in 0.5 mL final volume
on an Eppendorf ECOM 6122 photometer [31] The reac-tion medium contained 50 mm Tris⁄ HCl (pH 7.4), 50 mm KCl, 2 mm MgCl2, 1 mm phosphoenolpyruvate, 0.2 mm NADH, different concentrations of ATP and NMPs, and
2 units each of pyruvate kinase, lactate dehydrogenase and NDP kinase (forward reaction) The rate was calculated assuming that two ADP are generated during the reaction One unit of CMP kinase corresponds to 1 lmol of product formed per minute The thermal stability of CMP kinase variants was tested by incubating the purified enzymes (1 mgÆmL)1) in 50 mm Tris⁄ HCl (pH 7.4) containing 0.1 m NaCl at temperatures between 30 and 60C for 10 min The results, expressed as the percentage of residual activity compared with unincubated controls, were used to calculate the temperature of half inactivation (Tm) of each variant Proteolysis of bacterial CMP kinase (1 mgÆmL)1 in 50 mm Tris⁄ HCl, pH 7.4) was followed at 4 C in the presence of
2 lgÆmL)1 of TPCK-trypsin At different time intervals, aliquots were withdrawn and diluted in buffer containing
10 lgÆmL)1 of soybean trypsin inhibitor The first-order rate constant of inactivation of CMP kinase by TPCK-tryp-sin was calculated from the log10of residual activity versus the time Binding of nucleotides to E coli CMP kinase was measured from the fluorescence of Ant-dATP (kexc¼
330 nm, kem¼ 420 nm) on a Jasco spectrofluorimeter
FP 750, thermostated at 25C using a UV-grade quartz cuvette [20,32]
Numerical calculations The MCCE [33–35] method was used to calculate the ion-ization states, polar hydrogen positions and possible side chain rearrangements in the native structure and the corres-ponding variants In all calculations, we used the PDB file (code: 1-KDO) of E coli CMP kinase in complex with its major natural substrate CMP The effect of a mutation on the stability of CMP kinase is calculated as:
DGiðmutÞ ¼ DGiselfðWTÞ XN
j¼ 1;
j6¼ i
DGpairwisei;j ðWTÞ
þX k
DDGselfk ðmutÞ þX
k
XN
j ¼ 1;
DDGpairwisek;j ðmutÞ ð1Þ
Trang 9where DGselfi ðWTÞ is the loss of the self energy in the
wild-type enzyme of the residue that was mutated,
DGpairwisei;j ðWTÞ are the pair wise energies of the original
resi-due ‘i’ in the native protein with the rest of the resiresi-dues,
DDGselfk ðmutÞ are the changes of the self energies of the
resi-dues ‘k’ that change either their ionization or conformation
upon the mutation and DDGpairwisek;j ðmutÞ are the pair-wise
energies changes caused by the mutation All energies are
calculated with respect to hypothetical unfolded state of
extended polypeptide (noninteracting residues assumption)
This is an obvious oversimplification, but because we are
interested in the difference in stability of wild-type versus
modified proteins, the vast part of the possible error will
cancel out – most probably both denaturated states
(wild-type and the mutant) will be very similar Thus, the first
two terms account for the loss of the protein energy of the
residue that is mutated and the last two terms account for
the change of protein energy due to ionization or
confor-mation changes in the mutant protein
Preparation of the structures used in the
calculations
Calculations on the wild-type CMP kinase were performed
on the 1-KDO file (CMP⁄ CMP kinase complex) using
molecule A of the asymmetric unit The rmsd between
mole-cules A and B of the asymmetric unit is only 0.45 A˚ and
thus this choice is not critical for the calculations Side
chain mutations were performed with scap [36] The
pro-tons were generated with MCCE
Crystallography of the R188M variant
Two types of crystals were studied: enzyme alone (R188M)
and in complex with nucleotide (R188M–dCMP) They
were grown at 20C using the vapour-diffusion method, in
a 50 mm Tris⁄ HCl buffer pH 7.4, with a hanging droplet
(6 lL) containing 10 mgÆmL)1 of the R188M CMPKeco
variant, and in the case of dCMP–R188M complex with a
large excess of nucleotide (200 mm) Drops were
equili-brated with a reservoir solution (1 mL) containing the
pre-cipitant ammonium sulphate (1.3 m in the case of enzyme
alone, and 1.7 m for the R188M–dCMP variant)
Diffrac-tion data were collected at room temperature on a Rigaku
rotating-anode RTP 300 RC X-ray generator for crystal of
the enzyme alone, and at 100K (using glycerol as a
cryo-protectant) on the LURE synchrotron (beamline DW32) in
Orsay, France for R188M–dCMP crystal Crystals of the
enzyme alone belong to the hexagonal space group P63,
those with dCMP to the tetragonal space group P41212 In
both cases there is one molecule per asymmetric unit
Dif-fraction data were processed using denzo and scaled and
reduced with scalepack [37] The structures were solved by
molecular replacement with amore [38], using the wild-type
enzyme as the search model Models were built with o [39],
and refined with cns [40] The first refinement steps used simulated annealing For the dCMP–R188M complex, the dCMP density was unambiguous before this ligand was included in the refinement The Protein Data Bank codes are 2FEM for the R188M enzyme alone and 2FEO for the R188M–dCMP complex
Acknowledgements
We thank O Baˆrzu for interest and continuous sup-port, Y Janin for carefully reading this manuscript and constructive criticism, L Tourneux for providing some modified forms of CMP kinase This work was supported by grants from Institut Pasteur, the Centre National de la Recherche Scientifique (URA2185, URA2171, URA2128), the Institut National de la Sante´ et de la Recherche Me´dicale, and the Institut National de la Recherche Agronomique (UMR 206)
References
1 Yan H & Tsai M-D (1999) Nucleoside monophosphate kinases: structure, mechanism, and substrate specificity Adv Enzymol Related Areas Molec Biol 73, 103–133
2 Mitzuya H, Weinhold KJ, Furman PA, St Clair MH, Nusinoff-Lehrman S, Gallo RC, Bolognesi D, Barry
DW & Broder S (1985) 3¢-Azido-3¢-deoxythymidine (BW A509U): an antiviral agent that inhibits the infectivity and cytopathic effect of human T-lympho-tropic virus type III⁄ lymphadenopathy-associated virus
in vitro Proc Natl Acad Sci USA 82, 7096–7100
3 Chenal-Francisque V, Tourneux L, Carniel Christova P,
Li de la Sierra I, Baˆrzu O & Gilles A-M (1999) The highly similar TMP kinases of Yersinia pestis and Escherichia colidiffer markedly in their AZTMP phos-phorylating activity Eur J Biochem 265, 112–119
4 Lavie A, Ostermann N, Brundiers R, Goody RS, Rein-stein J, Konrad M & Schlichting I (1998b) Structural basis for efficient phosphorylation of 3¢-azidothymidine monophasphate by Escherichia coli thymidylate kinase Proc Natl Acad Sci USA 95, 14045–14050
5 Munier-Lehmann H, Chaffotte A, Pochet S & Labesse
G (2001) Thymidylate kinase of Mycobacterium tuber-culosis: a chimera sharing properties common to euk-aryotic and bacterial enzymes Protein Sci 10, 1195– 1205
6 Gentry D, Bengra C, Ikehara K & Cashel M (1993) Guanylate kinase of Escherichia coli K-12 J Biol Chem
268, 14316–14321
7 Sekulic N, Shuvalova L, Spangenberg O, Konrad M & Lavie A (2002) Structural characterization of the closed conformation of mouse guanylate kinase J Biol Chem
277, 30236–30243
Trang 108 Perrier V, Burlacu-Miron S, Boussac A, Meier A &
Gilles A-M (1998) Metal chelating properties of
adenylate kinase from Paracoccus denitrificans Protein
Eng 11, 917–923
9 Vonrhein C, Bo¨nish H, Scha¨fer G & Schulz GE (1998)
The structure of a trimeric archaeal adenylate kinase
J Mol Biol 282, 167–179
10 Hible G, Renault L, Schaeffer F, Christova P, Zoe
Radulescu A, Evrin C, Gilles AM & Cherfils J (2005)
Calorimetric and crystallographic analysis of the
oligo-meric structure of Escherichia coli GMP kinase J Mol
Biol 352, 1044–1059
11 Hible G, Christova P, Renault L, Seclaman E,
Thomp-son A, Girard E, Munier-Lehmann H & Cherfils J
(2006) Unique GMP-binding site in Mycobacterium
tuberculosisguanosine monophosphate kinase Proteins
62, 489–500
12 Mu¨ller-Dieckmann H-J & Schulz GE (1995) Substrate
specificity and assembly of the catalytic center derived
from two structures of ligated uridylate kinase J Mol
Biol 246, 522–530
13 Wiesmu¨ller L, Noegel AA, Baˆrzu O, Gerish G &
Schlei-cher M (1990) cDNA-derived sequence of UMP–CMP
kinase from Dictyostelium discoideum and expression of
the enzyme in Escherichia coli J Biol Chem 265, 6339–
6345
14 Pasti C, Gallois-Montbrun S, Munier-Lehmann H,
Veron M, Gilles AM & Deville-Bonne D (2003)
Reaction of human UMP–CMP kinase with natural and
analog substrates Eur J Biochem 270, 1784–1790
15 Briozzo P, Golinelli-Pimpaneau B, Gilles A-M, Gaucher
J-F, Burlacu-Miron S, Sakamoto H, Janin J & Baˆrzu O
(1998) Structures of Escherichia coli CMP kinase alone
and in complex with CDP: a new fold of the nucleoside
monophosphate binding domain and insights into
cyto-sine nucleotide specificity Structure 6, 1517–1527
16 Bertrand T, Briozzo P, Assairi L, Ofiteru A, Bucurenci
N, Munier-Lehmann H, Golinelli-Pimpaneau B, Baˆrzu
O & Gilles A-M (2002) Sugar specificity of bacterial
CMP kinases revealed by crystal structures and
muta-genesis of Escherichia coli enzyme J Mol Biol 315,
1099–1110
17 Yu L, Mack J, Hajduk PJ, Kakavas SJ, Saiki AY,
Lerner CG & Olejniczak ET (2003) Solution structure
and function of an essential CMP kinase of
Streptococ-cus pneumoniae Protein Sci 12, 2613–2621
18 Yan H, Dahnke T, Zhou B, Nakazawa A & Tsai M-D
(1990a) Mechanism of adenylate kinase Critical
evalua-tion of the X-ray model and assignment of the AMP
site Biochemistry 29, 10956–10964
19 Tickle IJ, Laskowski RA & Moss DS (1998) Rfreeand
the rfreeratio I Derivation of expected values of
cross-validation residuals used in macromolecular
least-squares refinement Acta Crystallogr D Biol Crystallogr
54, 547–557
20 Bucurenci N, Sakamoto H, Briozzo P, Palibroda N, Serina L, Sarfati RS, Labesse G, Briand G, Danchin A, Baˆrzu O et al (1996) CMP kinase from Escherichia coli
is structurally related to other nucleoside monophos-phate kinases J Biol Chem 271, 2856–2862
21 Tsai M-D & Yan H (1991) Mechanism of adenylate kinase: site-directed mutagenesis versus X-ray and NMR Biochemistry 30, 6806–6818
22 Scheffzek K, Kliche W, Wiesmu¨ller L & Reinstein J (1996) Crystal structure of the complex of UMP⁄ CMP kinase from Dictyostelium discoideum and the bisub-strate inhibitor P1-(5¢-adenosyl) P5-(5¢-uridyl) penta-phosphate (UP5A) and Mg2+at 2.2 A˚: implications for water-mediated specificity Biochemistry 35, 9716–9727
23 Alexov E (2004) Calculating proton uptake⁄ release and binding free energy taking into account ionization and conformation changes induced by protein–inhibitor association: application to plasmepsin, cathepsin D and endothiapepsin–pepstatin complexes Proteins 56, 572– 584
24 Alexov E, Miksovska J, Baciou L, Schiffer M, Hanson
DK, Sebban P & Gunner MR (2000) Modeling the effects of mutations on the free energy of the first elec-tron transfer from QA to QB in photosynthetic reaction centers Biochemistry 39, 5940–5952
25 Kunkel TA, Roberts JD & Zakour RA (1985) Rapid and efficient site-specific mutagenesis without pheno-typic selection Methods Enzymol 154, 367–382
26 Sanger F, Nicklen S & Coulson AR (1977) DNA sequencing with chain terminating inhibitors Proc Natl Acad Sci USA 74, 5463–5467
27 Munier H, Gilles A-M, Glaser P, Krin E, Danchin A, Sarfati RS & Baˆrzu O (1991) Isolation and characteriza-tion of catalytic and calmodulin-binding domains of Bordetella pertussisadenylate cyclase Eur J Biochem
196, 469–474
28 Sambrook J, Fritsch EF & Maniatis T (1989) Molecular Cloning: A Laboratory Manual, 2nd edn Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
29 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein util-izing the principle of protein–dye binding Anal Biochem
72, 248–254
30 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature (Lond) 227, 680–685
31 Blondin C, Serina L, Wiesmu¨ller L, Gilles A-M & Baˆrzu O (1994) Improved spectrophotometric assay of nucleoside monophosphate kinase activity using the pyruvate kinase⁄ lactate dehydrogenase coupling system Anal Biochem 220, 219–221
32 Sarfati RS, Kansal VK, Munier H, Glaser P, Gilles A-M, Labruye`re E, Mock M, Danchin A & Baˆrzu O (1990) Binding of 3¢-anthraniloyl-2¢deoxy-ATP to calmodulin-activated adenylate cyclase from Bordetella