Báo cáo khoa học: Structural basis for recognition of Co2+ by RNA aptamers pot

It tran-spired that DNA oligomer directed RNase H digestions are sensitive to Co2+ and, at an elevated metal ion concentration, the hybridization of oligomers to aptamer targets is inhib

Jan Wrzesinski and Stanisław K Jo´z´wiakowski

Institute of Bioorganic Chemistry, Polish Academy of Sciences, Poznan´, Poland

RNA molecules are involved in numerous fundamental

cellular processes, such as replication, transcription

and translation Most recently, participation of small

interfering RNA, microRNA and noncoding RNA in

the regulation of gene expression and the development

of variety organisms has been intensively investigated

[1–3] However, the interaction of RNA molecules with

cellular components requires their proper folding into

the active structure This process is facilitated by the

presence of cations, such as polyamines and

mono-valent and dimono-valent metal ions [4,5] Determination of

the precise location of the metal ions inside the RNA

structure is important for a better understanding of

RNA interactions with other components of the cell

Hence, many biophysical and biochemical methods

have been developed for defining RNA ligands that

coordinate metal ions

The most informative biophysical methods, which involve X-ray crystallography and NMR spectroscopy, provide details of the structure of the metal-ion bind-ing sites and their coordination spheres [6,7] The disadvantages of X-ray crystallography and NMR spectroscopy include problems with respect to crystalli-zation and the need for isotope enrichment to resolve the RNA spectrum Therefore, in order to gain a glo-bal insight into metal ion–RNA interactions, it is often necessary to conduct structural studies of metal ion binding modes in RNA molecules using biophysical methods simultaneously with other biochemical approaches

Metal ion-induced cleavage, an alternative approach

of biochemical studies, is frequently used to identify those RNA stretches involved in the organization of metal ion binding site(s) in solution This approach

Keywords

Co 2+ binding RNA aptamers; Co 2+ -induced

conformational changes; kissing dimer;

NAIM; oligomer hybridization ⁄ RNase H

digestion

Correspondence

J Wrzesinski, Institute of Bioorganic

Chemistry, Polish Academy of Sciences,

Noskowskiego 12 ⁄ 14, 61-704 Poznan´,

Poland

Fax: +48 61 8520532

Tel: +48 61 8528503

E-mail: wrzesinj@ibch.poznan.pl

(Received 8 October 2007, revised 27

December 2007, accepted 5 February 2008)

doi:10.1111/j.1742-4658.2008.06320.x

Co2+ binding RNA aptamers were chosen as research models to reveal the structural basis underlying the recognition of Co2+by RNA, with the application of two distinct methods Using the nucleotide analog interfer-ence mapping assay, we found strong interferinterfer-ence effects after incorpora-tion of the 7-deaza guanosine phosphorotioate analog into the RNA chain

at equivalent positions G27 and G28 in aptamer no 18 and G25 and G26

in aptamer no 20 The results obtained by nucleotide analog interference mapping suggest that these guanine bases are crucial for the creation of

Co2+binding sites and that they appear to be involved in the coordination

of the ion to the exposed N7 atom of the tandem guanines Additionally, most 7-deaza guanosine phosphorotioate and 7-deaza adenosine phos-phorotioate interferences were located in the common motifs: loop E-like

in aptamer no 18 and kissing dimer in aptamer no 20 We also found that purine rich stretches containing guanines with the highest interference val-ues were the targets for hybridization of 6-mers, which are members of the semi-random oligodeoxyribonucleotide library in both aptamers It tran-spired that DNA oligomer directed RNase H digestions are sensitive to

Co2+ and, at an elevated metal ion concentration, the hybridization of oligomers to aptamer targets is inhibited, probably due to higher stability and complexity of the RNA structure

Abbreviations

c7AaS, 7-deaza adenosine phosphorotioate; c7GaS, 7-deaza guanosine phosphorotioate; NAIM, nucleotide analog interference mapping; NTA, nitrilotriacetate.

has been successfully used to detect various metal ions

(e.g Mg2+, Pb2+, Mn2+, Eu2+, Tb3+, Co2+, etc.) in

divergent RNA molecules involving tRNAs,

ribo-zymes, and other RNA molecules [8–10]

The active involvement of metal ions in the cleavage

of several ribozymes has been investigated using a

‘metal ion specificity switch assay’ with respect to

sul-fur substitution of the oxygen atom in the phosphate

group [11] The cleavage efficiency for such modified

ribozymes, strongly reduced in the presence of Mg2+,

is rescued when thiophillic metal ions Mn2+, Cd2+or

Zn2+are added [12,13]

However, the precise determination of RNA ligands

necessary for metal ion binding and RNA activities

(mainly ribozymes) has become possible by applying

nucleotide analog interference mapping (NAIM)

In vitro transcription in the presence of

5¢-O-(1-thio)-nucleoside triphosphates enables incorporation of these

modified nucleotides or nucleoside analogs with altered

base moieties into the RNA chain, and I2 cleavage

allows determination of the atom in the bases that

interferes with function [14,15] NAIM has been used

to identify the RNA ligands that interact with metal

ions and the nucleotide modifications that are critical

for retaining ribozyme activity [16–18]

In the present study, we applied the NAIM method

to study the structural basis of the molecular

mecha-nism underlying the binding of Co2+ to RNA

mole-cules using two aptamers, no 18 and no 20, which

coordinate Co2+ ions, previously selected in our

labo-ratory, as research models [19] Several purine N7

groups that interfere with Co2+ were detected

Additionally, the influence of the Co2+ binding

on the aptamer structure using hybridization of a

6-mers semi-random oligodeoxynucleotide library and

RNase H digestion was investigated

Results and Discussion

Synthesis of phosphorothioate nucleoside

modified RNA aptamers

As prepared using the T7 transcription system, a pool

of aptamers (Fig 1) carrying randomly distributed

phosphorothioate modifications, as well as 7-deaza

guanine or adenine analog substitutions, was analyzed

to determine which RNA ligands interfere with Co2+

binding It is worth noting that T7 RNA polymerase

only incorporates the SP-stereoisomer of

phosphoro-thioate modified nucleotides into the RNA chain and

causes inversion of the configuration at the

a-phospho-rus atom, resulting in RP-phosphorothioate

substitu-tion [16] We used nitrilotriacetate (NTA) resin with

immobilized Co2+ to separate the partially modified aptamers into Co2+ binding and nonbinding fractions

by the metal ion affinity chromatography approach and fractions were then subjected to iodine cleavage A comparison of cleavage patterns of both fractions enables determination of which RNA ligands actively participate in the Co2+binding event

Effect of RP-phosphorothioate nucleoside modification on Co2+binding

Only three phosphorothioate interferences within the loop region of both aptamers were observed (Figs 2– 4) Two weak UaS (j ¼ 1.8) interferences took place

at U42 in aptamer no 18 and at U44 in aptamer

no 20 (in equal positions; the second nucleotide at the 3¢-end of the loop; Fig 4) The third CaS moderate interference (j¼ 2.4) occurred at C36 in aptamer

no 18

Generally, relatively low interference effects were discovered after replacing the nonbridging pro-RP oxy-gen atom with sulfur The reason for the above obser-vation might be the dominant contribution of base

Fig 1 The secondary structure of the in vitro selected aptamers that bind Co 2+ The locations of Co 2+ -induced cleavage sites are shown by open arrows.

moieties in the formation of the Co2+ binding site

architecture in the aptamers Therefore, replacement of

the nonbridging oxygen atom with sulfur in the

phos-phate group had a small effect on Co2+ binding in

contrast to ‘soft’ thiophillic metal ions Cd2+, Mn2+

and Zn2+, which discriminated between the oxygen

and sulfur atoms, with the latter being preferentially

bound [20]

Importance of the N7 group of purines for the

development of Co2+binding sites

In aptamer no 18, we found weak 7-deaza adenosine

phosphorotioate (c7AaS) interferences at A26

(j = 1.9) and A41 (j = 1.4) (Figs 2 and 4) By

con-trast, for 7-deaza guanosine phosphorotioate (c7GaS),

five interferences were observed and three of them

were localized at the 5¢-side of the loop The strongest

interferences (j = 4.0 and 3.6) were detected at G27 and G28, respectively Interference at G25 was less prominent (j = 1.9) Additionally, there were two weak interferences at G37 (j = 2.0) and G38 (j = 1.9), within the previously identified Co2+ -induced cleavage sites [19] The strongest interferences occurred at G27 and G28, which are positioned within the purine rich stretch 19-AGGCGAGAGG-28 It is known that such regions containing purine stretches are often involved in strong stacking interactions, reducing their flexibility [21,22] Thus, positioned within the stacked, more rigid 19-AGGCGAGAGG-28 stretch, guanine bases would be accessible to interact with the Co2+ion immobilized on NTA resin, and the ion is probably coordinated to N7 atom of the imidaz-ole ring of guanines Yet the possibility that deletion

of the N7 group of purines may result in an alternative structure of the aptamer cannot be excluded However,

Fig 2 Iodine cleavage analysis of

phospho-tioate nucleoside analogs modified 5¢- 32 P

labeled Co 2+ binding aptamer no 18 Lanes:

C, reaction control of the F N fraction; F N ,

RNA fraction which is not bound to Co 2

-NTA resin; FB, RNA fraction that is

effec-tively bound to Co2+-NTA resin and is eluted

with 2 mM concentration of Co 2+ ; L,

form-amide ladder; T1, limited hydrolysis by

RNase T 1 Guanine residues are labeled on

the right Sites of interference are denoted

with arrows.

these purines are located in the single-stranded region

accessible for chemical probing [19] Thus, N7 atoms

of the above guanine residues are not involved in

inter-actions with other base ligands or in aptamer structure

development Interestingly, similar binding properties

of Co2+ to the N7 atom of guanine residues were

previously observed in the crystal structure of the

orthorombic form of yeast tRNAPhe[23]

In the predicted loop E-like motif, bases G25⁄ A43,

as well as G27⁄ A41, form a sheared G-A base pairing,

whereas the A26-U42 base pair displays a reversed

Hoogsteen geometry [24] (Fig 5) Thus, c7AaS

interfer-ences at A26 and A41 confirm that the N7 atom of

these adenine bases is involved in the formation of

non-standard H-bonding Additionally, in the proposed

loop E-like motif structure, the aforementioned N7

position of G25 is exposed to interaction with Co2+

and such interactions may stabilize this motif

Furthermore, the N7 atom of G37 and G38 partici-pates in Co2+ coordination or is involved in other interactions that build Co2+ binding sites However, the interference j values are at least two-fold lower in comparison with G27 and G28, indicating that those interactions are weaker

Unlike in aptamer no 18, the c7AaS interferences were not observed in aptamer no 20 (Figs 3 and 4) In the case of the c7GaS modified aptamer, four inter-ferences were found Strong interinter-ferences at G25 (j = 3.7) and G26 (j = 3.5) are located at the same positions as the interferences at G27 and G28 in apt-amer no 18 (i.e in the third and fourth positions at the 5¢-end of loop, within 19AGGCGAGG-26, a pur-ine stretch two nucleotides shorter than in the case of aptamer no 18) The determined j values were very similar: 4.0 and 3.6 for G27 and G28 in aptamer

no 18 and 3.7 and 3.5 for G25 and G26 in aptamer

Fig 3 Iodine cleavage analysis of phospho-tioate nucleoside analogs modified 5¢- 32

P labeled Co 2+ binding aptamer no 20 Lanes:

C, reaction control of the FNfraction; FN, RNA fraction which is not bound to Co 2 -NTA resin; F B , RNA fraction that is effec-tively bound to Co 2+ -NTA resin and is eluted with a 2 mM concentration of Co 2+ ;

L, formamide ladder; T1, limited hydrolysis

by RNase T1 Guanine residues are labeled

on the right Sites of interference are denoted with arrows.

no 20, respectively Additional weak interferences

(j < 2) at G39 and G40 were discovered According

to our earlier assumption, in aptamer no 20, the

self-complementary region 35-ACGCGG-40 was predicted

to be involved in the formation of the kissing dimer

[19] The appearance of this effect in aptamer no 20

was confirmed experimentally (Fig 6) In the presence

of a 1 mm concentration of Co2+, as well as Mg2+

ions, mobility shift on the nondenaturing gel was

observed, indicating that divalent metal ions Co2+and

Mg2+ are necessary for kissing dimer formation in a

nonspecific manner We believe that interferences

within the self-complementary region of aptamer

no 20 indicate the additional stabilization of the

kiss-ing complex by interaction of Co2+ with the N7 atom

of guanine bases, namely nonstandard G–A and the

neighboring G–C base pairs Interestingly, analysis of

the crystal structure of RNA fragments mimicking the

HIV-1 virus subtype A kissing complex, crystallized in

the presence of different metals, revealed that Mg2+,

Fig 4 Summary of the interference effects within the Co 2+

bind-ing aptamer no 18 and no 20 defined by NAIM The histogram

represents the secondary structure of the aptamer loop regions.

The bars are correlated with the determined magnitude of

interfer-ence (j values) Analogs used in NAIM are marked with appropriate

colors Dotted lines in aptamer no 18 mark the loop E-like base

pairing, and the solid line in aptamer no 20 indicates the

nucleo-tides involved in the dimer complex.

A

B

C

Fig 5 The aptamer no 18 loop E-like motif structure: (A) nucleo-tides involved in loop E motif formation; (B) hydrogen bonding pat-terns in the extended G-A; and (C) reversed Hoogsteen A-U nonstandard base pairs.

1 m M EDTA

Aptamer no 18 Aptamer no 20

dimer

H2O +

+ +

+ –

– –

– –

– –

– – – –

– – –

1 m M MgCl2

1 m M CoCl2

Fig 6 (A) Gel shift assay dimer formation by the aptamers no 18 and no 20 5¢- 32

P labelled RNA samples containing 20 mM Tris–HCl

pH 7.5, 40 mM NaCl dimerization buffer were supplemented with

1 mM concentration of EDTA, Mg 2+ and Co 2+ , respectively (B) Scheme of proposed secondary structure of aptamer no 20 dimer complex The self-complementary sequence ACGCGG is shown.

as well as Co2+, Zn2+ and Mn2+, preferentially bind

to the N7 atom of guanine bases in such a motif [25]

Recognition of Co2+by RNA aptamers

The data presented here reveal the importance of the

N7 atom of purines in the organization of the Co2

binding site in selected aptamers and their involvement

in the metal ion coordination (Fig 4) Participation of

the N7 atom of purines in the organization of the

ter-tiary structure of other RNAs has been extensively

investigated by the NAIM method Heide et al [26]

have demonstrated the significance of this position in

purines upon binding of tRNA to Escherichia coli

RNase P The N7 position of the adenines is also

nec-essary for the catalytic activity of the RNase

P–sub-strate conjugate [27] Using the NAIM assay, six

adenines critical for self-cleavage have been identified

The application of a set of phosphorothioate

nucleo-side analogs, including 7-deaza-purine analogs, to

examine the interactions of low molecular ligand

glu-cosamine 6-phosphate with glmS ribozyme in the

pres-ence of Mg2+ demonstrated the importance of the N7

group of purines and Mg2+ions in the organization of

the catalytic site of the ribozyme and in the

glucosa-mine 6-phosphate recognition process [28] We show

that, in the selected aptamers, the N7 position of some

guanine bases is needed for binding of Co2+

immobi-lized on the NTA resin As Co2+ions usually contain

six coordination sites and four of them are occupied

upon complexation with the resin, only two sites

remain available for interactions with RNA ligands,

including the N7 atom of purines Therefore, there is

the possible involvement of the N7 atom of the

neigh-boring tandem guanines, G27 and G28 or G37 and

G38 in aptamer no 18, as well as G25 and G26 or

G39 and G40 in aptamer no 20, in Co2+binding

Interestingly, a similar metal ion binding mode to

the tandem guanines has been observed in the resolved

crystal structure of leadzyme [29] Strontium ions,

which mimic lead ions, have been bound directly or

water mediated to the N7 position of several purines,

mainly guanine tandems In other RNAs whose

struc-tures have been determined with atomic resolution,

such as hairpin ribozyme and the P4–P6 domain of the

group I intron, binding of metal ions in a manner

identical to that of guanine tandems has been

identi-fied [30,31]

The previously performed Co2+ -induced cleavage

of aptamers revealed a doublet of scissions occurring

at nucleotides G37 and G38 in aptamer no 18 and

nucleotides A31 and G32 in aptamer no 20 [19]

Additionally, the determined cleavage rate constant for

aptamer no 18 was three-fold higher than that for apt-amer no 20 It is well established that the rate of metal ion-induced cleavage strongly depends on the distance between the ion in its strong binding site and the 2¢OH group of ribose moiety involved in the scission phosphodiester bond mechanism [10] Thus,

RP-phosphorothioate CaS interference at C36 in apt-amer no 18, adjacent to Co2+ -induced cleavage sites, strongly suggests that this region is involved in direct metal ion–RNA interactions In the case of aptamer

no 20, those interactions are presumably weaker; hence, interference was not observed

Influence of Co2+on aptamer structures in solution

To gain a better insight into the effect of Co2+binding

on the RNA structure, we applied a semi-random DNA library of 6-mers and RNase H, an endonucleolytic ribonuclease that specifically recognizes the DNA–RNA duplex and digests it It has been shown that hybridiza-tion of short oligodeoxyribonucleotides to RNAs is strongly affected by RNA target structures, which results in changing RNase H digestion efficiency [32,33] One big advantage of this approach involving the appli-cation of a semi-random library is that no knowledge of the RNA structure is required to determine the DNA oligomer sequence that effectively hybridizes to the RNA target We applied a semi-random library contain-ing a scontain-ingle fixed nucleotide (A,G, C or T), located in the third position of the oligodeoxyribonucleotide chain and five random nucleotides; thus, the library consisted

of 4096 members (Fig 7A) Knowing the RNase H digestion preferences that cleave RNA at the end of bound DNA oligomer, it is possible to correlate the RNase H digestion sites with the most likely positions

of hybridized DNA 6-mers [32,33]

In a first step, we determined the RNase H digestion sites and the possible location of the binding region within the aptamer structures to which 6-mers, mem-bers of the oligodeoxyribonucleotide library, hybridize

In aptamer no 18, digestions took place at G27, G28, G30 and G31 at the 5¢-end of the loop (Fig 7B,C) Additionally, a doublet at G35 and C36 was identified However, in aptamer no 20, four digestion sites were found: G26, U27, A30 and A31 at the 5¢-end of loop

In both loops, 6-mer oligomers hybridize to the 5¢-end

of the loops and propagate to nucleotides involved in the formation of the helix The strong preference for the 5¢-side of the loops in comparison with the 3¢-side may be explained by different sequences of both sides As noted above, both aptamers contain purine rich stretches that could be involved in stacking

interactions Such specific characteristics of RNA,

involving the U turn, the formation of stable tertiary

base pairs and, particularly, the stacking interactions

that ensure the helical order of single-stranded regions,

are the main factors determining the efficiency of

hybridization of short DNA oligomers to the RNA

target [32,33] Protection of the 35-ACG-37 region in

aptamer no 20 against hybridization of the 6-mers oli-godeoxyribonucleotide library is due to the formation

of the kissing loop complex (Fig 6) Additionally, the observations of RNase H specificity are well correlated with the results obtained by NAIM noted earlier The main c7GaS interference sites are positioned in the same regions: 19-AGGCGAGAGG-28 at G27 and

A

B

C

Fig 7 (A) Sequence of the

oligodeoxyribo-nucleotide library used (B) Autoradiograms

of RNA fragments showing digestion of

Co 2+ binding aptamers with RNase H in the

presence of semi-random libraries 5¢- 32

P end-labeled RNAs were used and the

reac-tion products were analyzed on the gel.

Lanes: –, reaction control; a, g, c, t, parts of

semi-random library; L, formamide ladder;

T1, limited hydrolysis by RNase T1 Guanine

residues are labeled on the right (C)

Loca-tion of RNase H digesLoca-tion sites displayed on

the aptamer secondary structure models.

Gray lines along the aptamer sequences

show the possible position of 6-mer

oligode-oxyribonucleotides hybridizing to the RNA

targets Letters with arrow denote

diges-tions to which the corresponding 6-mer

oli-godeoxyribonucleotides could be assigned.

G28 in aptamer no 18 and 19-AGGCGAGG-26 at

G25 and G26 in aptamer no 20, which we postulate

to be involved in Co2+coordination

The dependence of oligomer hybridization and

RNase H digestion of aptamers on Co2+concentration

was studied with a library (i.e the part of the

semi-random library that contains adenosine in the third

position) because this part of the library revealed the

most prominent and specific RNase H digestion sites

(Fig 7B,C) We detected inhibition of RNase H

diges-tion efficiency with an increased Co2+ concentration

despite the presence of Mg2+ at a 10 mm

concentra-tion, as necessary for enzyme activity (Fig 8) The

inhibition constants, determined as the concentration

of Co2+at which the extent of RNase H digestion was

reduced by half, were approximately 0.5 mm for both

aptamers Subsequently, to exclude the possibility that

Co2+would inhibit RNase H activity at a higher

con-centration, we used another RNA model, antigenomic

delta ribozyme, which has been well characterized in

our laboratory [34] Previously, we mapped the

hybrid-ization sites of the 6-mer oligodeoxyribonucleotide

library in delta ribozyme using an RNase H digestion

assay and they have appeared to be localized within

the single-stranded P1 and J1⁄ 4 regions [32] Delta

ribozyme is highly active in the presence of a 1 mm concentration of Co2+ ions; therefore, these ion bind-ing sites probably occur inside the ribozyme structure [35] Strikingly, we did not observe reduction of the RNase H digestion efficiency, but an increase of the digestion yield when Co2+was added, even at a 3 mm concentration We assume that the lower RNase H digestion efficiency of the studied RNA aptamers is mainly related to the stabilization of their structures in the presence of Co2+ ions Presumably, the regions to which DNA oligomers hybridize become less accessible

in more compact aptamer structures upon Co2+ bind-ing and this process prevents the DNA–RNA duplex formation necessary for the RNase H digestion event

A reverse effect takes place in the antigenomic delta ribozyme The presence of Co2+ presumably desta-bilizes or rearranges the ribozyme structure facilitating hybridization of DNA oligomers because an increase

of RNase H digestion efficiency was observed

The influence of Co2+ions on the global structure of aptamers has been studied by applying the UV melting technique (data not shown) We observed an increase

of the melting temperature from 69.7C to 71.8 C for aptamer no 18, and from 64.9C to 66.2 C for aptamer no 20, despite the low concentration of Co2+

0

0.01 0.06

Aptamer no 18 Aptamer no 20 Antigenomic delta ribozyme

0.1 0.2 0.3 0.5 1 2 3

G38 G35 G31

0.01 0.06 0.1 0.2 0.3 0.5 1 2 3

Co [mM] 2+

G32 G37

G29 G26

G42

G35

0.0 0.5 1.0 1.5 2.0 2.5 3.0

Co2+ concentration [m M ]

0.0 0.5 1.0 1.5 2.0 2.5 3.0

Co2+ concentration [m M ]

0.0 0.5 1.0 1.5 2.0 2.5 3.0

Co2+ concentration [m M ] 0.0

0.2

0.4

0.6

0.8

1.0

0.0 0.2

0.4

0.6 0.8 1.0

0.0 0.2

0.4

0.6 0.8 1.0

A

B

Fig 8 (A) Digestion of Co 2+ binding aptamers and antigenomic delta ribozyme with RNase H in the presence of a-library (ie: the part of the semi-random library that contains adenosine in the third position) at different Co2+concentrations Figure labelling is the same as in Fig 7.

C, incubation control; C1, incubation control in the presence of a 3 mM Co 2+ concentration (B) Graphical representation of the dependencies

of RNase H digestion efficiency on Co 2+ concentration of aptamers no 18 and no 20 and antigenomic delta ribozyme.

(0.1 mm) At a higher Co2+ concentration, significant

degradation of RNA during UV melting experiments

was detected This observation supports the above

suggestion, as formulated on the basis of oligomer

hybridization and RNase H digestion, that the binding

of Co2+ to in vitro selected Co2+ -specific aptamers

stabilizes their structure, even at a low metal ion

concentration

In the present study, we postulate that Co2+binding

to the aptamer structures induces the increase in their

stabilities A similar situation has been observed for

riboswitches, which are highly structured domains that

reside in the 5¢-UTR region of mRNA and affect gene

expression [36] The binding of some low molecular

ligands (e.g FMN, adenosylocobalamin, guanine,

l-lysine) to the ‘aptamer domain’ of riboswitches

stabi-lizes the specific RNA structure involved in the

regula-tion of gene expression at a transcripregula-tion or translaregula-tion

level It is also known that attachment of the Co2+

binding domains to the allosteric hammerhead

ribo-zyme may regulate its catalytic activity [37] More

recently, riboswitches that respond to the cellular

con-centration of Mg2+ by forming a stable hairpin that

affects the transcription level of Mg2+transporter gene

expression (MgtA and MgtE in bacteria Salmonella

enterica and Bacillus subtilis, respectively) have been

described [38,39] The above information, together with

the data presented here, indicates that possibly also

Co2+binding RNA molecules responding to the Co2+

concentration may regulate RNA activity

Conclusions

The significance of Mg2+ for RNA stability, RNA

catalysis and the regulation of gene expression is well

established However, information concerning

partici-pation of other metal ions with distinct chemical

prop-erties (e.g Co2+, a member of the transition metal ion

group), in such processes, and particularly the

molecu-lar recognition of Co2+ by RNA, still remains limited

and requires further study

The application of phosphorothioate 7-deaza-purine

analogs and the NAIM approach for studying the

structure of Co2+ binding sites in aptamers has

revealed the importance of the N7 group of guanine

bases In both aptamers, we identified several tandems

of guanines involved in Co2+ binding or the

develop-ment of aptamer structures Additionally, other

ele-ments of the secondary structure of aptamers, such as

the E-like loop and kissing complex motifs, appear to

be important in the formation of the architecture of

Co2+ binding sites However, in the case of aptamer

no 20, which contains the self-complementary 35-AC

GCGG-40 sequence, we have confirmed the appear-ance of a kissing loop complex motif in the presence

of divalents Co2+or Mg2+ This observation is in line with NAIM results showing that the N7 groups of G39 and G40 interfere with Co2+

We would like to emphasize the importance of the purine rich stretches with stacking interactions for the binding of Co2+ and other nucleic acid molecules Regions 19-AGGCGAGAGG-28 in aptamer no 18 and 19-AGGCGAGG-26 in aptamer no 20 contain a tandem of guanines with the highest c7GaS interfer-ence values, thus indicating direct coordination of

Co2+ The same regions are targets for 6-mer oligode-oxyribonucleotides, as confirmed in the present study using semi-random DNA library hybridization and an RNase H digestion assay

Moreover, the binding of Co2+to aptamers induces conformational changes that result in the stabilization

of the RNA structures, which was confirmed in two independent experiments, namely (a) the hybridization

of a semi-random library and RNase H digestion and (b) temperature-dependent UV melting

Experimental procedures

Materials

NTA resin was obtained from Novagen (Darmstadt, Ger-many); all chemicals were obtained from Serva (Heidelberg, Germany) or Fluka (Buchs, Switzerland) Phosphorothioate

was purchased from IBA (Berlin, Germany) Enzymes: T7 RNA polymerase and DNA Taq polymerase T4 polynucleo-tide kinase were obtained from MBI Fermentas (Vilnius,

Hartmann Analytic (Braunschweig, Germany)

DNA template construction

The following oligodeoxynucleotides were used for con-struction of the DNA templates: LM47: 5¢-GCGAGCTCT AATACGACTCACTATGGGCATA nCGTTAGGCTGTA

GAGGCGATATTTCCGCTTTCCTCTCGCCTACAGCC TAACGTATGCCC-3¢ and LM20: 5¢-CGAAGCTTGCA TATGCTACGCTGAGGCUATTACCGCGTTTCTTCCA

italic indicate the T7 RNA promotor, complementary sequences are underlined) Oligomers were deprotected after

polyacryl-amide gel Equimolar amounts of oligomers LM 47 and

LM 18 or LM 20 were annealed and double-stranded DNA

template was generated by PCR The reaction mixture

con-tained 1.5 lm of both LM 47 oligomers and 0.3 lm of LM

150 mm KCl, 0.1% Triton X-100, 200 lm each of dNTP

performed on Biometra (Go¨ettingen, Germany) UNO II

over-night The dsDNA template was recovered by

centrifuga-tion, dissolved in TE buffer and used in the transcription

reaction

RNA preparation

The modified RNA aptamers were prepared by the in vitro

transcription reaction where the typical transcription

reac-tion contained 0.5 lm dsDNA template, 40 mm Tris–HCl,

RNA polymerase Additionally, the reaction mixtures

con-tained one from the following phosphorothioate analogs:

4 h and purification on polyacrylamide gel, the RNA

tran-scripts were excised, eluted, precipitated with ethanol, and

RNA was recovered by centrifugation and dissolved in

10 mm Tris–HCl, pH 7.0, 0.1 mm EDTA

Nucleotide analogs interference mapping

Prior to the interference procedure, RNA transcripts were

P]ATP and polynucleotide kinase under standard conditions Labeled aptamers (typically

unlabeled RNA to a final 0.2 lm concentration) were

sub-jected to a denaturation–renaturation procedure in 200 lL

of the standard binding buffer A (40 mm Hepes, pH 8.0,

for 5 min and, subsequently, the resin was washed with six

volumes (400 lL each) of buffer A to remove the unbound

RNA In the next step, the resin was washed with

3 volumes of ethanol were added and the mixtures were

centrifugation and dissolved in water The RNA fraction

were subjected to cleavage of phosphorothioate linkage in

the RNA was precipitated, recovered by centrifugation and

polyacrylamide gel alongside alkaline hydrolysis ladders

PhosphoImager Typhoon 8600 (Uppsala, Sweden) with

The interference j value was calculated from the equation:

az

P

Interferences were considered as: weak, j = 1.5–2.0; mod-erate, 2.0–2.5; and strong, > 2.5

RNase H RNA mapping experiment

The RNA aptamers were prepared by in vitro transcription, under the conditions described above, using unmodified NTPs, purified and labeled at their 5¢-end Prior to digestion

P labeled RNA was renatured in

1 mm dithiothreitol and 0.1 mm EDTA) Subsequently,

The digestion reactions were initiated by adding separately four parts of the DNA 6-mers library with the appropriate fixed nucleotide to four RNA target samples to a final con-centration of 200 lm (i.e 5000-fold excess over the RNA

EDTA and immediately frozen on dry ice

In vitro RNA aptamer dimerization assay

Aliquots of 5¢ labeled RNA aptamers, supplemented with unlabeled RNA to a concentration of 250 nm, were heated

dimerization buffer containing, respectively, 20 mm Tris-HCl, pH 7.5, 40 mm NaCl alone, or supplemented with

directly on the 12% nondenaturing polyacrylamide gel The electrophoresis under nondenaturing conditions was carried out at room temperature using 20 mm Tris–HCl, pH 7.5,

Acknowledgements

We are very grateful to Professor Jerzy Ciesiolka for critically reading the manuscript and for helpful