Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

A strong FRET signal was observed in the absence of elongin B, and this signal was modestly increased by coexpression of elongin B, demonstrating that a conformation change of elongin C

elongin C visualized in living cells by a fluorescence

resonance energy transfer–fluorescence lifetime

imaging microscopy technique

Koshi Kinoshita1,*, Kenji Goryo1,*, Mamiko Takada2, Yosuke Tomokuni1, Teijiro Aso3,

Heiwa Okuda4, Taro Shuin4, Hiroshi Fukumura2and Kazuhiro Sogawa1

1 Department of Biomolecular Sciences, Graduate School of Life Sciences, Tohoku University, Aoba-ku Sendai, Japan

2 Department of Chemistry, Graduate School of Science, Tohoku University, Aoba-ku Sendai, Japan

3 Department of Functional Genomics, Kochi Medical School, Kohasu, Okoh-cho, Nankoku Kochi, Japan

4 Department of Urology, Kochi Medical School, Kohasu, Okoh-cho, Nankoku Kochi, Japan

The von Hippel–Lindau (VHL) gene is located on the

short arm of chromosome 3 and its deletions or

muta-tions are associated with VHL disease [1,2] Affected

individuals develop a variety of tumors, including

retinal hemangioblastomas, hemangioblastomas of the

central nervous system, renal cell carcinomas and

pheochromocytomas Biallelic VHL gene defects are also found in sporadic malignancies, such as renal cell carcinomas and hemangioblastomas [3,4] The VHL gene product exists in two forms, a larger p30 protein (pVHL30) and a smaller p19 protein (pVHL19), the latter generated by internal translation initiation at the

Keywords

conformation change; FRET–FLIM; live cell

imaging; protein complex; ubiquitin ligase

Correspondence

K Sogawa, Department of Biomolecular

Science, Graduate School of Life Sciences,

Tohoku University, Aoba-ku Sendai

980-8578 Japan

Fax: +81 22 795 6594

Tel: +81 22 795 6590

E-mail: sogawa@mail.tains.tohoku.ac.jp

*These authors contributed equally to this

work

(Received 26 June 2007, revised 21 August

2007, accepted 29 August 2007)

doi:10.1111/j.1742-4658.2007.06075.x

The tumor suppressor von Hippel–Lindau (VHL) gene product forms a com-plex with elongin B and elongin C, and acts as a recognition subunit of a ubiquitin E3 ligase Interactions between components in the complex were investigated in living cells by fluorescence resonance energy transfer (FRET)–fluorescence lifetime imaging microscopy (FLIM) Elongin B–ceru-lean or ceruB–ceru-lean–elongin B was coexpressed with elongin C-citrine or citrine-elongin C in CHO-K1 cells FRET signals were examined by measuring a change in the fluorescence lifetime of donors and by monitoring a corre-sponding fluorescence rise of acceptors Clear FRET signals between elon-gin B and elonelon-gin C were observed in all combinations, except for the combination of elongin B-cerulean and citrine-elongin C Although similar experiments to examine interaction between pVHL30 and elongin C linked

to cerulean or citrine were performed, FRET signals were rarely observed among all the combinations However, the signal was greatly increased by coexpression of elongin B These results, together with results of coimmuno-precipitation experiment using pVHL, elongin C and elongin B, suggest that

a conformational change of elongin C and⁄ or pVHL was induced by binding

of elongin B The conformational change of elongin C was investigated by measuring changes in the intramolecular FRET signal of elongin C linked to cerulean and citrine at its N- and C-terminus, respectively A strong FRET signal was observed in the absence of elongin B, and this signal was modestly increased by coexpression of elongin B, demonstrating that a conformation change of elongin C was induced by the binding of elongin B

Abbreviations

FLIM, fluorescence lifetime imaging microscopy; FRET, fluorescence resonance energy transfer; GFP, green fluorescent protein; VHL, von Hippel–Lindau.

second methionine [5,6] Both pVHL proteins are

asso-ciated with two ubiquitous proteins, elongin B and

elongin C, to form a ternary complex (hereafter

referred to as the VBC complex), and its formation is

required for tumor suppressor functions

Elongin B and elongin C were initially found

together with elongin A in the elongin (SIII) complex

that increases the efficiency of elongation by RNA

polymerase II [7,8] Biochemical analysis of the

com-plex revealed that elongin A functions as a

trans-criptionally active subunit whereas elongin B and

elongin C act as regulatory subunits Elongin B and

elongin C bind stably to each other (elongin BC

com-plex), and elongin A has the ability to bind to

elon-gin C but cannot bind directly to elonelon-gin B Elonelon-gin B

has a ubiquitin homology domain, whereas elongin C

contains homology to Skp1, a subunit of Skp1-Cul1-F

box ubiquitin ligases The ubiquitin-like domain of

elongin B was found to be necessary for binding to

elongin C [9] pVHL shares a common binding site

with elongin A on elongin C, and no direct interaction

occurs between pVHL and elongin B Thus, interaction

of elongin BC with elongin A and pVHL is mutually

exclusive The elongin BC complex interacts not only

with elongin A and pVHL, but also with SOCS-box

proteins with a conserved BC-box motif located in the

SOCS-box [10] Mutations of pVHL that inactivate

binding to elongin C result in the development of

malignant tumors For formation of the VBC complex,

it has been elucidated that cooperation of the HSP70

and TRiC⁄ CCT chaperone systems is required [11,12]

The VBC complex further associates with cullin-2 and

a ring-finger protein, Rbx1, to form a larger

ubiquitin-ligase complex, and pVHL acts as the

substrate-binding subunit in the E3 ubiquitin ligase Hypoxia

activated transcription factors, HIF-1a, HLF (HIF-2a,

EPAS-1) and HIF-3a, are known substrates for

ubiqu-itin ligase [13–16] Oxygen-dependent hydroxylation of

specific proline residues in the oxygen-dependent

deg-radation domain of the factors are recognized by the

pVHL in the E3 ligase and subsequent ubiquitination

of the factors results in degradation by proteasomes

Lowered oxygen levels in hypoxia down-regulate prolyl

hydroxylation and increase stabilization of the factors

Degradation of the factors in normoxia and their

sta-bilization in hypoxia comprise the pivotal mechanism

for cellular hypoxic responses such as the promotion

of glycolysis and vascularization [17,18]

Fluorescence lifetime imaging microscopy (FLIM) is

a recently developed technique that can be applied to

measure fluorescence lifetimes of fluorescent proteins

such as green fluorescent protein (GFP) in living cells

When combined with fluorescence resonance energy

transfer (FRET), this measurement presents unambigu-ous evidence for spatial and temporal interactions between proteins and conformational changes of pro-teins occurring in living cells The occurrence of FRET can be accurately and finely determined by measuring the reduced fluorescence lifetime of donor proteins in the presence of acceptors Because fluorescence lifetime

is, in principle, unaffected by changes in probe concen-tration or excitation intensity, FRET–FLIM has advantages over intensity-based FRET techniques In particular, FRET–FLIM has advantages in intermole-cular FRET measurement in which expression levels of the two fluorescent proteins cannot be easily controlled

in individual cells [19–21]

In the present study, we monitored the fluorescence rise of acceptor fluorescent proteins as distinctive evi-dence for the occurrence of FRET in addition to the decreased fluorescence lifetimes of donor proteins using time-domain FLIM Using the FRET–FLIM technique, we observed strong intermolecular FRET signals between elongin B and elongin C For stable binding of pVHL30 to elongin C, we found that the coexistence of elongin B is necessary to induce a con-formational change of elongin C

Results

Imaging of interaction between elongin B and elongin C

As shown in Fig 1A, cerulean-elongin B and elon-gin B-cerulean were expressed throughout cells, and citrine-elongin C and elongin C-citrine were similarly expressed in the cells As a first step to examine interac-tion between elongin B and elongin C by FRET–FLIM, the fluorescence lifetime of cerulean-elongin B and elongin B-cerulean, which were separately expressed in CHO-K1 cells, was determined, using a subnanosecond

410 nm light-emitting diode and a time- and space-correlated single photon counting detector on a FLIM microscope A representative FLIM image of cells expressing cerulean-elongin B is shown in Fig 1B Its lifetime was fairly constant throughout the cells, and similar lifetimes were observed in different cells expressing the fluorescent protein (Fig 1B) Fig-ure 1C,D shows a fluorescence decay curve of ceru-lean-elongin B, which was further analyzed by following a two-component model Two lifetimes, 1.32 ns and 3.54 ns, were calculated from the curve with ratio coefficients of 37.9% and 62.1%, respec-tively (Table 1) The decay curve of elongin B-cerulean was similarly analyzed as shown in Fig 1E,F, and the lifetimes, 1.38 ns and 3.41 ns, were almost identical to

those of cerulean-elongin B (Table 1) The v2values of

the fit were between 1.0 and 1.3 and between 1.0 and

1.2, respectively, indicating that the overall model

fit-ting was statistically significant The decays were also

analyzed according to a three-exponential model as

reported by Millington et al [22], resulting in only a

modest improvement of fit as judged from v2 values;

the values were reduced by approximately 4% or less

by the three-exponential fitting

Next, we coexpressed acceptor fluorescent proteins

together with donor fluorescent proteins in the

follow-ing four combinations: cerulean-elongin B and

citrine-elongin C; cerulean-citrine-elongin B and citrine-elongin C-citrine;

elongin B-cerulean and elongin C-citrine; and

elon-gin B-cerulean and citrine-elonelon-gin C Transfected cells

with coexpression of moderate amounts of two

fluo-rescent proteins, cerulean-elongin B and

citrine-elongin C, were randomly chosen for measuring

fluorescence decay of the two proteins As shown in

Fig 1C, decay of fluorescence of cerulean-elongin B in

the presence of coexpressed citrine-elongin C was

sig-nificantly faster than that of separately expressed

ceru-lean-elongin B The two lifetimes of donor, s1 and s2,

were decreased to 0.93 ns and 3.05 ns, respectively, in

the presence of the acceptor (Table 1), indicating

trans-fer of energy between the two fluorescent proteins This decrease in the fluorescence lifetime of donors was clearly observed when their FLIM images were compared (Fig 1B) The FLIM image of cerulean-elongin B in the presence of citrine-cerulean-elongin C suggests that the interaction between the two fluorescent pro-teins homogeneously occurred in the cells The

0.01 0

1

0.1

Time/ns

Cit

Cit

0.01 0

1

0.1

Time/ns

Cit

0.01 0

1

0.1

Time/ns

0.01 0

1

0.1

Time/ns

550-600nm 450-500nm

0.01 0

1

0.1

Time/ns

0.01 0

1

0.1

Time/ns

Ceru

0.01 0

1

0.1

Time/ns

0.01 0

1

0.1

Time/ns

Ceru-EloB Ceru-EloB

Cit-EloC

Ceru-EloB Ceru-EloB + EloC-Cit

EloC-Cit Ceru-EloB + EloC-Cit

EloB-Ceru

EloB-Ceru

2.0 2.5 3.0 3.5 4.0 ns) (

2.0 2.5 3.0 3.5 4.0 (ns)

A

C

D

E

F

B

Fig 1 FLIM analysis of interaction between elongin B and

elon-gin C in CHO-K1 cells (A) Cellular localization of elonelon-gin B linked to

cerulean and elongin C linked to citrine Chimeric proteins,

ceru-lean-elongin B (Ceru-EloB), elongin B-cerulean (EloB-Ceru),

citrine-elongin C (Cit-EloC) and citrine-elongin C-citrine (EloC-Cit) were transiently

expressed in CHO-K1 cells by DNA transfection using the

lipofec-tion method Forty hours after transfeclipofec-tion, fluorescence of

ceru-lean and citrine moieties of the chimeric proteins was observed

with an Olympus BX50 fluorescent microscope with a filter set

(Olympus U-MCFPHQ and U-MYFPHQ) Scale bar ¼ 20 lm A

typi-cal result of immunoblot analysis of whole cell extracts of cells

expressing cerulean-linked elongin B or citrine-linked elongin C was

shown using anti-GFP serum, as shown below Lane 1, mock;

lane 2, cerulean-elongin B; lane 3, elongin B-cerulean; lane 4,

citrine-elongin C; lane 5, elongin C-citrine (B) FLIM image of

ceru-lean-elongin B in the presence or absence of citrine-elongin C A

lifetime map was made from time- and space-correlated single

pho-ton counting data by fitting data to a single exponential decay In

the FLIM map, color corresponds to the fluorescence lifetime

indi-cated by a false color scale (C–F) CHO-K1 cells were transfected

with plasmids encoding: (C) cerulean-elongin B and elongin

C-citrine; (D) elongin B-cerulean and elongin C-C-citrine; (E)

cerulean-elongin B and citrine-cerulean-elongin C; and (F) cerulean-elongin B-cerulean and

citrine-elongin C The fluorescence decay curve of cerulean (shown

in blue) and citrine (shown in green) represents an average of

fluo-rescence decay data obtained from cells observed For comparison,

the decay curve of cerulean-linked elongin B without acceptor

(shown in black) or the decay curve of citrine-linked elongin C

with-out donor (shown in black) are also shown.

fluorescence decay curve of citrine-elongin C

coex-pressed with cerulean-elongin B was also obtained as

shown in Fig 1C When its decay curve was compared

with that of citrine-elongin C, a clear fluorescence rise

in the curve was observed A similar level of FRET sig-nals could be detected in the combination of cerulean-elongin B and cerulean-elongin C-citrine, as shown in Fig 1D and Table 1 FRET between elongin B-cerulean and elongin C-citrine was weak (Fig 1E), and FRET sig-nals were very weak for the combination of elongin B-cerulean and citrine-elongin C (Fig 1F and Table 1)

Interaction between elongin C and pVHL30

A chimeric fluorescent protein, pVHL30-cerulean, was expressed in CHO-K1 cells by DNA transfection As shown in Fig 2A, it was distributed throughout the cells with stronger expression in the cytoplasm By western blotting analysis, it was found that a small amount of pVHL19-cerulean was also expressed Life-times were determined on the FLIM microscope as shown in Table 2 We constructed a plasmid only for expression of pVHL19-cerulean, introduced it into the

Table 1 Fluorescence decay data for cerulean-linked elongin B and citrine-linked elongin C expressed in living CHO-K1 cells Data are derived from whole cell regions of interest and are expressed as mean ± SD a 1 and a 2 are the exponential coefficients (%) for the s 1 and s 2 decay times, respectively n, number of cells examined.

pVHL-Ceru

mock pVHL-Ceru

0.01

1

0.1

Time/ns

` Ceru

Cit

0.01

1

0.1

Time/ns

0.01

1

0.1

Time/ns

0.01

1

0.1

Time/ns

HA-pVHL

FLAG-EloC

Myc-EloB

-+

-+ +

-+ +

+ + +

WB : anti-FLAG

WB : anti-Myc

WB : anti-FLAG

Elongin C

Elongin B

Elongin C pVHL

Elongin B

WB : anti-HA

WB : anti-Myc

IP :

anti-FLAG

Input

pVHL-Ceru pVHL-Ceru + Cit-EloC

Cit-EloC pVHL-Ceru + Cit-EloC

Cit-EloC pVHL-Ceru

+ Cit-EloC + EloB

pVHL-Ceru + Cit-EloC + EloB pVHL-Ceru

A

B

C

D

Fig 2 Interaction between pVHL and elongin C induced by elon-gin B (A) Cellular localization of pVHL linked to cerulean A chime-ric protein, pVHL-cerulean (pVHL-Ceru), was transiently expressed

in CHO-K1 cells by DNA transfection using the lipofection method Forty hours after transfection, fluorescence of cerulean moiety of the chimeric proteins was observed with an Olympus BX50 fluores-cent microscope with a filter set (Olympus U-MCFPHQ) Scale bar ¼ 20 lm A typical result of western blotting for expressed pro-teins of pVHL-cerulean is shown on the right CHO-K1 cells were transfected with plasmids encoding (B) pVHL-cerulean and citrine-elongin C and (C) pVHL-cerulean and citrine-citrine-elongin C coexpressed with elongin B The fluorescence decay curve of cerulean (shown

in blue) and citrine (shown in green) represents an average of fluo-rescence decay data obtained from cells observed For comparison, the decay curve of pVHL-cerulean without acceptor protein (shown

in black) or the decay curve of citrine-linked elongin C without donor protein (shown in black) are also shown (D) Coimmunopre-cipitation analysis of pVHL, elongin B and elongin C HA-pVHL, myc-elongin B and Flag-elongin C were expressed in CHO-K1 cells Whole cell extracts were treated with anti-Flag serum Co-precipi-tated proteins were visualized with anti-HA, anti-Flag or anti-myc sera after electrophoresis and subsequent electroblotting to a nitro-cellulose membrane; 5% input is shown.

cells and measured lifetimes of expressed

pVHL19-cerulean Almost identical lifetimes to those of

pVHL30-cerulean were obtained (data not shown)

When an acceptor chimeric protein, citrine-elongin C

was coexpressed with pVHL30-cerulean, the lifetimes

of cerulean moiety showed only a minimal decrease

(Fig 2B and Table 2) We expressed donor and

accep-tor proteins in the pairs pVHL30-cerulean and

elon-gin C-citrine, cerulean-pVHL30 and citrine-elonelon-gin C,

and cerulean-pVHL30 and elongin C-citrine, and

determined lifetimes of donors Non-existent or

negli-gible FRET signals were observed similar to the pair

of pVHL30-cerulean and citrine-elongin C (data not

shown) These results suggest two possibilities; one is

that interaction between pVHL30 and elongin C rarely

occurs in the cells, and the other is that interaction

occurs when the fluorophores are separated by more

than 10 nm We expressed elongin B together with

pVHL30-cerulean and citrine-elongin C, and the

inter-action between pVHL30 and elongin C was

investi-gated by FRET–FLIM As shown in Fig 2C and

Table 2, clear FRET signals, decrease in lifetimes of

pVHL30-cerulean and fluorescence rise in the decay

curve of acceptors, could be detected, only when

elon-gin B was coexpressed To examine the interaction

between pVHL and elongin C, a

coimmunoprecipita-tion experiment was performed As shown in Fig 2D,

an interaction between elongin C and VHL30 existed

in the absence of elongin B, and considerable

stabiliza-tion of pVHL and elongin C was observed with the

coexistence of elongin B

Taken together, these results indicate that distance

between donor and acceptor in the pair of

pVHL30-cerulean and citrine-elongin C is so separated that

energy transfer was below the detection level

Conformational change of elongin C induced by

binding of elongin B

Increased FRET signals between pVHL-cerulean and

citrine-elongin C by coexpression of elongin B suggest

that a conformation change of elongin C induced by

binding of elongin B may occur and that this

confor-mational change of elongin C leads to stabilization of

elongin C and pVHL To visualize the conformational change in living cells, intramolecular FRET measure-ment using a chimeric protein of cerulean-elongin C-citrine was carried out in the presence or absence of elongin B Without the coexistence of elongin B, a con-siderable decrease in donor fluorescence lifetime was observed (Fig 3B and Table 3) compared to that of cerulean-elongin C-citrine(Y66A) in that fluorophore formation in the citrine moiety was abolished by the mutation of Tyr66 to Ala (Fig 3A) A decrease in the lifetimes was further augmented by the coexpression of elongin B as shown in Fig 3D and Table 3 This decrease was modest but reproducible in three indepen-dent experiments Coimmunoprecipitation experiments indicated that the presence of fluorescent proteins at N- and C-terminal ends of elongin C did not affect the binding of elongin B to elongin C moiety (Fig 3C)

Discussion

We used cerulean as the FRET donor because the flu-orescence lifetime of this protein is reported to be the best fit by a single exponential [23], which greatly sim-plifies quantitative analysis of FRET data compared to donors with a double exponential decay However, our results clearly demonstrated that the decay curve of cerulean is the best fit by a double exponential such as CFP This finding agrees with the results of Millington

et al [22] Two fluorescent lifetimes of cerulean and their fraction ratios displayed in the literature are simi-lar to those obtained in the present study Despite the complex decay profiles, cerulean was useful as a FRET donor because it shows a higher quantum yield and extinction coefficient than other donors like CFP In addition to analysis of the decay curve of donors, we examined the decay of acceptors, and found a fluores-cence rise in the curve that inevitably results from energy transfer as shown in Figs 1–3 Simultaneous determinations of the two FRET indicators clearly demonstrate the occurrence of FRET and minimize risk due to interference from sample autofluorescence

It is also reported that reduced lifetimes of donors can occur by the strong illumination from a mercury lamp [24,25] Excitation levels at the sample surface under

Table 2 Fluorescence decay data for cerulean-linked pVHL30 and citrine-linked elongin C Data are derived from whole cell regions of inter-est and are expressed as mean ± SD a 1 and a 2 are the exponential coefficients (%) for the s 1 and s 2 decay times, respectively n, number

of cells examined.

the FLIM microscope used in the present study were

very low (approximately 15 mWÆcm)2) so that no

pho-todynamic reactions took place

FRET signals between cerulean-linked elongin B and citrine-linked elongin C can be detected in the fol-lowing donor-acceptor combinations in decreasing order: cerulean-elongin B and citrine-elongin C > cerulean-elongin B and elongin C-citrine elongin B-cerulean and elongin C-citrine FRET signals from the pair of elongin B-cerulean and citrine-elongin C were modest (Table 1) Since the rate of energy transfer depends on the inverse sixth power of the distance between donor and acceptor, this result matches with the results from the X-ray crystallography of the VBC complex [26]; the distance between the C-terminal end

of elongin B and the N-terminal end of elongin C used for the FRET pair of elongin B-cerulean and

citrine-450-500nm

0.01

1

0.1

Time/ns

550-600nm

Cerulean

Cit Ceru Cit Cerulean

Cerulean

Cerulean

Cerulean Cit

Cerulean Cit

Cit

0.01

1

0.1

Time/ns

0.01

1

0.1

Time/ns

0.01

1

0.1

Time/ns

0.01

1

0.1

Time/ns

0.01

1

0.1

Time/ns Myc-EloB

Ceru-EloC-Cit

Ceru(W66A)-EloC-Cit

Ceru-EloC-Cit(Y66A)

-+

-+ +

-+ -+

-+ -+

WB : anti-Myc

WB : anti-GFP

WB : anti-Myc

WB : anti-GFP

Elongin C

Elongin C Elongin B

Elongin B

IP : anti-Myc

Input

Ceru(W66A)-EloC-Cit + EloB

Ceru-EloC-Cit + EloB

Cerulean

Ceru-EloC-Cit + EloB

Cerulean

Ceru-EloC-Cit

Ceru(W66A)-EloC-Cit Ceru-EloC-Cit Ceru-EloC-Cit(Y66A)

Ceru-EloC-Cit

Ceru-EloC-Cit(Y66A) + EloB

Ceru-EloC-Cit + EloB

Ceru-EloC-Cit

Ceru-EloC-Cit

+ EloB

mock Ceru-EloC-CitCeru(W66A)-EloC-CitCeru-EloC-Cit(Y66A) Cerulean

Citrine

Ceru-EloC-Cit Ceru-EloC-Cit(Y66A) Ceru(W66A)-EloC-Cit

A

B

C

D

E

Fig 3 Intramolecular FRET of elongin C conjugated with cerulean and citrine at its N- and C-termini, respectively (A) Cellular images expressing cerulean-elongin C-citrine or its mutant pro-teins Chimeric proteins, cerulean-elongin C-citrine and its mutant proteins, cerulean(W66A)-elongin citrine and cerulean-elongin C-citrine(Y66A), were transiently expressed in CHO-K1 cells by DNA transfection using the lipofection method Forty hours after trans-fection, fluorescence of cerulean and citrine moieties of the chime-ric proteins was observed with an Olympus BX50 fluorescent microscope with a filter set (Olympus U-MCFPHQ and U-MY-FPHQ) Scale bars ¼ 20 lm A typical result of western blotting for expressed proteins is shown on the right (B) FLIM analysis of cerulean-elongin C-citrine in living CHO-K1 cells CHO-K1 cells were transfected with a plasmid encoding cerulean-elongin C-citrine for FLIM analysis For comparison, the decay curve of ceru-lean-elongin C-citrine(Y66A) or cerulean(W66A)-elongin C-citrine is shown (C) FLIM analysis of cerulean-elongin C-citrine expressed with elongin B For comparison, the decay curve of cerulean-elongin C-citrine(Y66A) or cerulean(W66A)-cerulean-elongin C-citrine coex-pressed with elongin B is shown (D) Comparison of the decay curves of cerulean-elongin C-citrine expressed with or without elongin B Two decay curves of cerulean-elongin C-citrine obtained

in the absence or presence of elongin B are shown in blue and red, respectively (E) Coimmunoprecipitation analysis of cerulean-elon-gin C-citrine with eloncerulean-elon-gin B A plasmid for cerulean-eloncerulean-elon-gin C-citrine

or its mutants was introduced into CHO-K1 cells with a plasmid for myc-elongin B Whole cell extracts were treated with anti-myc serum and coprecipitated cerulean-elongin C-citrine protein or its mutants was visualized by anti-GFP serum after electrophoresis and subsequent electroblotting to a nitrocellulose membrane; 5% input is shown.

Table 3 Fluorescence decay data for elongin C-linked to cerulean and citrine Citrine(Y66A) indicates a mutated citrine with mutation of Tyr66 to Ala Data are derived from whole cell regions of interest and are expressed as mean ± SD a1and a2are the exponential coeffi-cients (%) for the s 1 and s 2 decay times, respectively n, number of cells examined.

elongin C is relatively long (4.7 nm) compared to

dis-tances (2–3 nm) between other combinations of

termi-nal ends of elongin B and elongin C, although the

effects caused by the binding of pVHL on the 3D

struc-ture of the elongin BC complex are not exactly known

The present study has clarified that conformation of

pVHL and⁄ or elongin C in the absence of elongin B

was different from that in the VBC complex and that

conformation of elongin C was changed upon binding

of elongin B The coimmunoprecipitation experiment

(Fig 2D) demonstrated that a remarkable stabilization

of elongin C was caused by the binding of elongin B

and, to a lesser extent, stabilization of pVHL was also

found as previously reported [27,28] The

conforma-tional change of elongin C may be associated with the

stabilization of the proteins To date, the role of

elon-gin B in the large E3 ubiquitin-ligase complex

includ-ing the VBC-Cul2-Rbx1 is not understood because no

direct interaction is present between elongin B and

other components except for elongin C, and the fact

that there is no obvious elongin B homologue in yeast

obscured its physiological function [29] The present

study strongly suggests that elongin B is required to

alter the conformation of elongin C that leads to

sta-bilization of elongin C and pVHL

In summary, we have shown that interactions

between components of the VBC complex can be

visu-alized in living cells by a FRET–FLIM technique

Strong FRET signals were observed between elongin B

and elongin C Conformational changes of elongin C

were caused by the binding of elongin B In the

pres-ent study, we demonstrated that the fluorescence rise

in the decay curves of acceptors can be used as a

sensi-tive indicator for the occurrence of FRET as well as

donor lifetime-based measurements

Experimental procedures

Plasmid construction

pCerulean-elongin B was constructed by inserting the

blunt-ended XspI-SmaI fragment of pCI neo-elongin B into

the blunt-ended BspEI site of C1

pCerulean-elongin C and pcitrine-pCerulean-elongin C were similarly constructed

by inserting the blunt-ended BstBI-SmaI fragment of pCI

neo-elongin C into the blunt-ended BspEI site of

pcerulean-C1 and pcitrine-pcerulean-C1, respectively For the plasmid

construc-tion for elongin C-citrine, the stop codon of elongin C

was changed to GGA by using primers 5¢-CCCAAGC

TTATGGATGGAGGAGGAGAAAAC-3¢ and 5¢-ACGT

ACCGGTCCACAATCTAGGAAGTTTGCAGC-3¢ After

digestion of the PCR fragment by EcoRI and AgeI, the

fragment was inserted into the EcoRI and AgeI sites of

pcitrine-N1 pVHL-cerulean was similarly constructed by PCR using primers 5¢-CGGAATTCCGATGCCCCGGA

CAATCTCCCATCCGTTGATGTG-3¢, and pcerulean-N1 pBOS-HA was constructed by insertion of the annealed fragment of the synthesized oligonucleotides, 5¢-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACC CGGGATATCGGCGTAGTCGGGCACGTCGTAGGGG TACATGGTGGT-3¢, into the XbaI site of pBOS Vector pBOS-Myc and pBOSFlag were constructed similarly by using the synthesized oligonucleotides 5¢-CTAGACCA CCATGGAGGAACAGAAGCTGATCAGTGAGGAAG ACCTGGATATCCCGGGTTAACT-3¢ and 5¢-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTCACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACCCGG GATATCTTTATCGTCATCGTCTTTGTAGTCCATGG TGGT-3¢, respectively pBOS-HA-pVHL was constructed

by inserting the blunt-ended XhoI-AgeI fragment of pVHL-cerulean into the HpaI site of pBOS-HA PBOS-FLAG-elongin C was constructed by inserting the blunt ended BstBI-SmaI fragment of pCIneo-elongin C into the SmaI site of pBOS-FLAG PBOS-Myc-elongin B was constructed

by inserting blunt-ended XhoI-SmaI fragment of pCIneo-elongin B into the HpaI site of pBOS-Myc pCerulean-elon-gin C-citrine was constructed by inserting the EcoRV-HpaI fragment of the plasmid for elongin C-citrine into the EcoRV-HpaI site of pcerulean-elongin C pCerulean (W66A)-C1 was constructed by site-directed mutagenesis, using the primers 5¢-CGTGACCACCCTGACCGCGGG CGTGCAGTGCTTC-3¢ and 5¢-GAAGCACTGCACGCC

pCerulean(W66A)-elongin C-citrine was constructed by inserting the BsrGI-EcoRI fragment of pcerulean-elongin C and the EcoRI-HpaI fragment of elongin C-citrine into the BsrGI-HpaI site of pcerulean(W66A)-C1 pcitrine(Y66A)-N1 was similarly constructed by site-directed mutagenesis, using the

GTGCTTCG-3¢ and 5¢-CGAAGCACATCAGGCCGGCG CCGAAGGTGGTCACGA-3¢ pCerulean-elongin C-citrine (Y66A) was constructed by inserting the BsrGI-AgeI frag-ment of pcerulean-elongin C-citrine and the AgeI-HpaI fragment of pcitrine(Y66A)-N1 into the BsrGI-HpaI site of pcerulean-C1

Cell culture and DNA transfection

CHO-K1 cells were provided by the Cell Resource Center for Biomedical Research (Institute of Development, Aging and Cancer, Tohoku University, Japan) and grown on poly

d-lysine coated glass bottom culture dishes (35 mm, MatTeK Corporation, Ashland, MA, USA) in phenol red-free

Dulbecco’s modified Eagle’s medium (Invitrogen, Carlsbad,

CA, USA) supplemented with 10% fetal bovine serum, 1%

nonessential amino acid solution (Invitrogen), 2 mm

l-gluta-mine (Sigma, Saint Louis, MO, USA) and 40 lgÆmL)1

kana-mycin DNA (0.5 lg) consisting of equal amounts of each

expression plasmid was introduced into CHO-K1 cells by the

lipofection method using FuGene 6 reagent (Roche, Basel,

Switzerland) Cells were incubated 40 h after transfection

and observed by a FLIM microscope The transfected cells

were fixed with 4% formaldehyde and the cells were observed

by fluorescence microscope as described previously [30]

Western blotting and immunoprecipitation

Whole cell extracts were prepared from CHO-K1 cells

transfected with plasmids encoding chimeric fluorescent

proteins by mixing 10 mm Tris⁄ HCl buffer, pH 7.5,

con-taining 1 mm EDTA, 0.15 m NaCl, 1 mm dithiothreitol,

1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS,

10 lm MG132 and protease inhibitor cocktail (Roche)

Pro-teins were resolved by 12% SDS⁄ PAGE, and transferred to

a nitrocellulose membrane (GE Healthcare, Piscataway, NJ,

USA) Polyclonal anti-GFP serum (Clontech, Mountain

View, CA, USA) diluted 1 : 1000 and donkey anti-rabbit

horseradish peroxidase linked IgG (GE Healthcare) diluted

1 : 10000 were used as the first and second antibodies,

respectively The membrane was developed using the ECL

plus detection system (GE Healthcare) CHO-K1 cells were

transfected with plasmids for HA-tagged pVHL,

Flag-tagged elongin C and myc-Flag-tagged elongin B, harvested,

lysed and exposed to Flag-affinity agarose beads (Sigma)

that had been pretreated with anti-Flag serum Proteins

bound to washed beads were eluted, boiled and separated

by 15% SDS⁄ PAGE After electrophoresis, the proteins

were blotted onto a nitrocellulose membrane and probed

with anti-FLAG (Sigma), anti-HA (MBL, Nagoya, Japan)

or anti-Myc (MBL) sera Coimmunoprecipitation of

elon-gin B and cerulean-elonelon-gin C-citrine was similarly

per-formed

Measurement of fluorescence lifetime

Techniques to measure FRET include FLIM to detect

decreases in the lifetime of donor fluorescence and

fluores-cence rise in the acceptor decay curve that are accompanied

by FRET FLIM measurements were conducted on the live

cells at 37C after the culture medium was replaced with

fresh medium The emission lifetimes of fluorescent cells

were measured on an inverted microscope (Axiovert 135,

· 100 oil immersion objective with NA ¼ 1.3; Carl Zeiss,

Oberkochen, Germany) equipped with a disk-anode

microchannel-plate photomultiplier (Europhoton, Berlin,

Germany), which can detect photons in a time- and

space-resolved fashion by using a time correlated single photon

counting technique Spatial resolution can be obtained with

a quadrant-anode, the details of which are provided else-where [31,32] The excitation source was a 410 nm picosec-ond diode laser (FWHM 78 ps, LDH-P-C-400; PicoQuant, Berlin, Germany), which illuminates a relatively large area

of approximately 100 lm in diameter and was operated at

a repetition rate of 10 MHz Average excitation power was estimated to be approximately 15 mWÆcm)2, which is equiv-alent to the single photon counting level Fluorescence from live cell samples was sequentially collected within the same cells at 475 ± 25 nm for cerulean and 575 ± 25 nm for citrine by band-pass filters Fluorescence lifetime data were analyzed using global analysis with multiexponential decays [33] Peak values of photon counting were approximately

2000 counts CCD images of cells were obtained with an Olympus DP70 CCD camera (Olympus, Tokyo, Japan)

Acknowledgements

This work was supported in part by Grant-In-Aid for research from the Ministry of Education, Culture, Sports, Science and Technology of Japan

References

1 Latif F, Tory K, Gnarra J, Yao M, Duh FM, Orcutt

ML, Stackhouse T, Kuzmin I, Modi W, Geil L et al (1993) Identification of the von Hippel–Lindau disease tumor suppressor gene Science 260, 1317–1320

2 Chen F, Kishida T, Yao M, Hustad T, Glavac D, Dean

M, Gnarra JR, Orcutt ML, Duh FM, Glenn G et al (1995) Germline mutations in the von Hippel–Lindau disease tumor suppressor gene: correlations with pheno-type Hum Mutat 5, 66–75

3 Foster K, Prowse A, van den Berg A, Fleming S, Huls-beek MM, Crossey PA, Richards FM, Cairns P, Affara

NA, Ferguson-Smith MA et al (1994) Somatic muta-tions of the von Hippel–Lindau disease tumour suppres-sor gene in non-familial clear cell renal carcinoma Hum Mol Genet 3, 2169–2173

4 Gnarra JR, Tory K, Weng Y, Schmidt L, Wei MH, Li

H, Latif F, Liu S, Chen F, Duh FM et al (1994) Muta-tions of the VHL tumour suppressor gene in renal carci-noma Nat Genet 7, 85–90

5 Iliopoulos O, Ohh M & Kaelin WG Jr (1998) pVHL19

is a biologically active product of the von Hippel–Lin-dau gene arising from internal translation initiation Proc Natl Acad Sci USA 95, 11661–11666

6 Schoenfeld A, Davidowitz EJ & Burk RD (1998) A sec-ond major native von Hippel–Lindau gene product, ini-tiated from an internal translation start site, functions

as a tumor suppressor Proc Natl Acad Sci USA 95, 8817–8822

7 Bradsher JN, Jackson KW, Conaway RC & Conaway

JW (1993) RNA polymerase II transcription factor SIII

I Identification, purification, and properties J Biol

Chem 268, 25587–25593

8 Aso T, Lane WS, Conaway JW & Conaway RC (1995)

Elongin (SIII): a multisubunit regulator of elongation

by RNA polymerase II Science 269, 1439–1443

9 Brower CS, Shilatifard A, Mather T, Kamura T, Takagi

Y, Haque D, Treharne A, Foundling SI, Conaway JW

& Conaway RC (1999) The elongin B ubiquitin

homol-ogy domain Identification of elongin B sequences

important for interaction with elongin C J Biol Chem

274, 13629–13636

10 Kamura T, Sato S, Haque D, Liu L, Kaelin WG Jr,

Conaway RC & Conaway JW (1998) The elongin BC

complex interacts with the conserved SOCS-box motif

present in members of the SOCS, ras, WD-40 repeat,

and ankyrin repeat families Genes Dev 12, 3872–3881

11 Feldman DE, Thulasiraman V, Ferreyra RG &

Fryd-man J (1999) Formation of the VHL-elongin BC tumor

suppressor complex is mediated by the chaperonin

TRiC Mol Cell 4, 1051–1061

12 Melville MW, McClellan AJ, Meyer AS, Darveau A &

Frydman J (2003) The Hsp70 and TRiC⁄ CCT

chaper-one systems cooperate in vivo to assemble the von

Hip-pel–Lindau tumor suppressor complex Mol Cell Biol

23, 3141–3151

13 Bruick RK & McKnight SL (2001) A conserved family

of prolyl-4-hydroxylases that modify HIF Science 294,

1337–1340

14 Epstein AC, Gleadle JM, McNeill LA, Hewitson KS,

O’Rourke J, Mole DR, Mukherji M, Metzen E, Wilson

MI, Dhanda A et al (2001) C elegans EGL-9 and

mam-malian homologs define a family of dioxygenases that

regulate HIF by prolyl hydroxylation Cell 107, 43–54

15 Ivan M, Kondo K, Yang H, Kim W, Valiando J, Ohh

M, Salic A, Asara JM, Lane WS & Kaelin WG Jr

(2001) HIFa targeted for VHL-mediated destruction by

proline hydroxylation: implications for O2sensing

Sci-ence 292, 464–468

16 Jaakkola P, Mole DR, Tian YM, Wilson MI, Gielbert

J, Gaskell SJ, Kriegsheim AV, Hebestreit HF, Mukherji

M, Schofield CJ et al (2001) Targeting of HIF-a to the

von Hippel–Lindau ubiquitylation complex by O2

-regu-lated prolyl hydroxylation Science 292, 468–472

17 Hirota K & Semenza GL (2005) Regulation of

hypoxia-inducible factor 1 by prolyl and asparaginyl

hydroxylas-es Biochem Biophys Res Commun 338, 610–616

18 Masson N & Ratcliffe PJ (2003) HIF prolyl and

aspar-aginyl hydroxylases in the biological response to

intra-cellular O(2) levels J Cell Sci 116, 3041–3049

19 Suhling K, French PM & Phillips D (2005)

Time-resolved fluorescence microscopy Photochem Photobiol

Sci 4, 13–22

20 Wallrabe H & Periasamy A (2005) Imaging protein

mole-cules using FRET and FLIM microscopy Curr Opin

Biotechnol 16, 19–27

21 Becker W, Bergmann A, Hink MA, Konig K, Benndorf

K & Biskup C (2004) Fluorescence lifetime imaging by time-correlated single-photon counting Microsc Res Tech 63, 58–66

22 Millington M, Grindlay GJ, Altenbach K, Neely RK, Kolch W, Bencina M, Read ND, Jones AC, Dryden DTF & Magennis SW (2007) High-precision FLIM-FRET in fixed and living cells reveals heterogeneity in a simple CFP-YFP fusion protein Biophys Chem 127, 155–164

23 Rizzo MA, Springer GH, Granada B & Piston DW (2004) An improved cyan fluorescent protein variant useful for FRET Nat Biotechol 22, 445–449

24 Bae JH, Rubini M, Jung G, Wiegand G, Seifert MH, Azim MK, Kim JS, Zumbusch A, Holak TA, Moroder

L et al (2003) Expansion of the genetic code enables design of a novel ‘gold’ class of green fluorescent pro-teins J Mol Biol 328, 1071–1081

25 Tramier M, Zahid M, Mevel JC, Masse MJ & Coppey-Moisan M (2006) Sensitivity of CFP⁄ YFP and

GFP⁄ mCherry pairs to donor photobleaching on FRET determination by fluorescence lifetime imaging micros-copy in living cells Microsc Res Tech 69, 933–939

26 Stebbins CE, Kaelin WG Jr & Pavletich NP (1999) Structure of the VHL-elongin C-elongin B complex: implications for VHL tumor surppressor function Science 284, 455–461

27 Schoenfeld AR, Davidowitz EJ & Burk RD (2000) Elongin BC complex prevents degradation of von Hip-pel–Lindau tumor suppressor gene products Proc Natl Acad Sci USA 97, 8507–8512

28 Kamura T, Brower CS, Conaway RC & Conaway JW (2002) A molecular basis for stabilization of the von Hippel–Lindau (VHL) tumor suppressor protein by components of the VHL ubiquitin ligase J Biol Chem

277, 30388–30393

29 Koth C, Botuyan MV, Moreland RJ, Jansma DB, Conaway JW, Conaway RC, Chazin WJ, Friesen JD, Arrowsmith CH & Edwards AM (2000) Elongin from Saccharomyces cerevisiae J Biol Chem 275, 11174–11180

30 Sato F, Yasumoto K, Numayama-Tsuruta K & Sogawa

K (2005) Heterodimerization with LBP-1b is necessary for nuclear localization of LBP-1a and LBP-1c Genes Cells 10, 861–870

31 Kemnitz K, Pfeifer L, Paul R & Coppey-Moisan M (1997) Novel detectors for fluorescence lifetime imaging

on the picoscecond time scale J Fluoresc 7, 93–98

32 Kemnitz K, Pfeifer L & Ainbund MR (1997) Detector for multichannel spectroscopy and fluorescence lifetime imaging on the picosecond timescale Nucl Instr Meth Phys Res A 387, 86–87

33 Beechem JM (1989) A second generation global analysis program for the recovery of complex inhomogeneous fluorescence decay kinetics Chem Phys Lipids 50, 237– 251