Báo cáo khoa học: ATP-binding domain of heat shock protein 70 is essential for its effects on the inhibition of the release of the second mitochondria-derived activator of caspase and apoptosis in C2C12 cells potx

Previously, we have shown that heat shock pre-treatment blocked the release of the second mitochondria-derived activator of caspase Smac to the cytosol and inhibited apoptosis of C2C12 m

for its effects on the inhibition of the release of the

second mitochondria-derived activator of caspase and

apoptosis in C2C12 cells

Bimei Jiang1, Kangkai Wang1, Pengfei Liang2, Weimin Xiao1, Haiyun Wang1and Xianzhong Xiao1

1 Department of Pathophysiology, Xiangya School of Medicine, Central South University, Changsha, Hunan, China

2 Department of Burns and plastic surgery, Xiangya Hospital, Central South University, Changsha, Hunan, China

Apoptosis is characterized by specific morphological

and biochemical hallmarks, including cell shrinkage,

membrane blebbing, nuclear breakdown and DNA

fragmentation As a form of programmed cell death, it

is indispensable for many normal cellular functions,

such as embryo development, tissue homeostasis and

regulation of the immune system [1] Malfunctions of

apoptosis have been implicated in human diseases,

including myocardial infarction, neurodegenerative

dis-eases, cancer and ischemic stroke [2–4] Several factors,

including ATP depletion, calcium fluxes and reactive

oxygen species, have been proposed to cause apoptosis

and⁄ or cytochrome c release in myocytes [5,6]

Caspases, a family of cysteine proteases, are key components in mammalian apoptosis They are present

in cells as inactive precursors and are activated by proteolytic cleavage [7] In mammals, mitochondrial damage induced by diverse extracellular stress causes the release of cytochrome c from the mitochondria into the cytoplasm [8] In the cytosol, cytochrome c associates with apoptosis protease-activating factor-1 (Apaf-1) and then binds to and activates caspase-9 in the presence of dATP⁄ ATP [9] This leads to proteo-lytic activation of a common set of downstream prote-ases, including caspases-3 and -7, and subsequent cell death It has recently been shown that a novel

Keywords

apoptosis; heat shock protein 70; hydrogen

peroxide; mitochondria; Smac

Correspondence

X Xiao, Department of Pathophysiology,

Xiangya School of Medicine, Central South

University, Changsha, Hunan 410008, China

Fax ⁄ Tel: +86 731 2355019

E-mail: xianzhongxiao@126.com

(Received 8 December 2008, revised 14

February 2009, accepted 2 March 2009)

doi:10.1111/j.1742-4658.2009.06989.x

Hydrogen peroxide (H2O2) is a well known oxidative stress inducer causing apoptosis of many cells Previously, we have shown that heat shock pre-treatment blocked the release of the second mitochondria-derived activator

of caspase (Smac) to the cytosol and inhibited apoptosis of C2C12 myo-blast cells in response to H2O2 The present study aimed to elucidate the underlying mechanism by over-expressing a major stress-inducible protein, heat shock protein (HSP) 70, and characterizing the resulting cellular changes We demonstrate that HSP70 over-expression markedly inhibited the release of Smac and prevented the activation of caspases-9 and -3 and apoptosis in C2C12 cells under H2O2 treatment However, no direct inter-action between HSP70 and Smac was observed by co-immunoprecipitation Mutational analysis demonstrated that the ATP-binding domain of HSP70, rather than the peptide-binding domain, was essential for these observed HSP functions Taken together, our results provide evidence supporting the role of HSP70 in the protection of C2C12 cells from H2O2-induced and Smac-promoted apoptosis by preventing the release of Smac from mito-chondria, thereby inhibiting activation of caspases-9 and -3 This mecha-nism of HSP70 action is dependent on its ATP-binding domain but independent of its interaction with Smac protein

Abbreviations

AIF, apoptosis-inducing factor; Apaf-1, apoptotic protease activating factor-1; FITC, fluorescein isothiocyanate; HSP, heat shock protein; IAP, inhibitor of apoptosis protein; JNK, Jun kinase; PI, pyridine iodination; Smac, second mitochondria-derived activator of caspase.

mitochondrial protein, second mitochondria-derived

activator of caspase (Smac, also known as DIABLO),

is released into the cytosol in response to apoptotic

stimuli, such as UVB irradiation, etoposide and

gluco-corticoids [10,11] Smac promotes caspase activation

by eliminating inhibition of caspases by inhibitor of

apoptosis protein (IAP) and is known to be a new and

important regulator of apoptosis in a variety of cancer

cells The evidence obtained in our previous study also

revealed a vital role for Smac in the apoptosis of

myo-cytes induced by oxidative stress [12,13]

As a major stress-inducible heat shock protein, heat

shock protein (HSP) 70 has been shown to protect

cells from a number of apoptotic stimuli, including

heat shock, tumor necrosis factor, growth factor

with-drawal, oxidative stress and radiation [14,15]

Over-expression of HSP70, which is known to comprise a

major self-preservation protein in the heart, has been

reported to enhance myocardial tolerance to ischemia–

reperfusion injury in transgenic animals [16]

Furthermore, HSP70 has been shown to exert its

anti-apoptotic function downstream of cytochrome c release

but upstream of caspase-3 activation along the

stress-induced apoptosis pathway [17] It prevents caspase-3

and stress-activated protein kinase⁄ Jun kinase (JNK)

activation [18] and mitochondrial depolarization [19],

blocks apoptosome formation and activation of

caspase-9 [20], and inhibits the release of

apoptosis-inducing factor (AIF) from mitochondria [21]

In our previous study using mouse myogenic C2C12

cells, heat shock pretreatment also prevented apoptosis

induced by oxidative stress [13] However, whether the

protective effects of HSP70 are mediated by a

mecha-nism involving the release of Smac from mitochondria

remains to be elucidated To this end, in the present

study, we over-expressed HSP70 and characterized the

subsequent cellular changes using C2C12 as an in vitro

system

Results

Over-expression of HSP70 inhibits oxidative

stress-induced release of Smac from

mitochondria in C2C12 myogenic cells

To explore the effect of the change in HSP70 protein

expression on hydrogen peroxide (H2O2)-induced

apoptosis, C2C12 myogenic cells were transfected with

an expression vector with cDNA encoding the

full-length HSP70 protein or the empty vector After

selection with G418, stably-transfected C2C12 cell

lines that constitutively expressed human HSP70 were

isolated Two clones, termed HSP70-1 and HSP70-2,

showing different levels of HSP70 proteins by immunoblot analysis were selected for further study (Fig 1A) The levels of HSP70 expression in both C2C12 lines were similar or even below the elevated endogenous HSP70 expression induced by heat stress (Fig 1A)

The levels of Smac in the soluble cytoplasm and mitochondria were analyzed by western blot before and after exposure to 0.5 mm H2O2 for 2 h In the nontransfected control cells before heat shock, Smac was detected in the motichondrial fraction but not in the cytosolic fraction, consistent with its known subcel-lular location After exposure of cells to H2O2for 2 h, Smac accumulated in the cytosol and the protein level dramatically increased by  30-fold compared to the control, as estimated by densitometry (Fig 1B), indi-cating the release of Smac from mitochondria into the cytoplasm Concordantly, the protein level in the mito-chondria was significantly decreased In the transfected cells, HSP70 over-expression inhibited the release of Smac from mitochondria into the cytosol in a dose-dependent manner Under the same conditions, the absence of another mitochondrial marker cytochrome oxidase subunit II in the cytosolic fractions indicated that mitochondrial integrity was preserved and translo-cation of Smac from mitochondria to the cytosol was not due to mitochondrial breakdown

Over-expression of HSP70 inhibits oxidative stress-induced apoptosis in C2C12 myogenic cells

We next examined the effects of HSP70 over-expres-sion on oxidative stress-induced apoptosis in C2C12 myogenic cells As shown in Fig 2, after treatment with H2O2 (0.5 mm) for different times, the vector-transfected control cells underwent apoptosis, as indi-cated by an apoptotic cell population in the flow cytometry analysis The percentages of apoptotic cells were decreased in both of the HSP70 over-expressed lines, indicating that HSP70 over-expression protected cells from H2O2-induced cytotoxicity The protective effects of HSP70 were correlated with the level of HSP70 expression because the clone with higher HSP70 expression demonstrated a more significant reduction of the apoptotic cell population (Fig 2B) Furthermore, over-expression of HSP70 displayed an inhibitory effect on the activation of caspases-9 and -3 induced by H2O2, and such inhibition was also corre-lated with the level of HSP70 expression (Fig 2A) The protective effect of HSP70 against H2O2-induced apoptosis was further verified by the decrease in DNA laddering in HSP70 over-expressed cells after H2O2 treatment (Fig 2C)

No direct interaction between HSP70 and Smac Because HSP70 inhibited the release of Smac and apoptosis induced by H2O2 in C2C12 myogenic cells,

we tested whether HSP70 inhibited the release of Smac through direct interaction As shown in Fig 3, no direct interaction between HSP70 and Smac was detected in cell-free extracts prepared either from untreated control cells or H2O2-treated (0.5 mm for

2 h) cells, indicating that interaction with Smac is not required with respect to the role of HSP70 in the inhi-bition of the release of Smac and apoptosis

The role of the ATP-binding domain of HSP70

in the prevention of the release of Smac and apoptosis after exposure to H2O2

To determine which region of HSP70 is responsible for its anti-apoptotic effects, C2C12 myogenic cells were transiently transfected with expressing plasmids pcDNA3.1-HSP70WT, and pcDNA3.1-HSP70DATP-BD

or pcDNA3.1-HSP70DPBD First, correct protein expression from all cell lysates was confirmed by western blot analysis with HSP70 antibody, showing immunoreactive bands of the expected sizes (Fig 4B) Next, whether the protective potency of HSP70 would

be annulled by deletion of the ATP-binding domain or the peptide-binding domain was investigated As shown in Fig 5, over-expression of both mutant HSP70DPDB and full-length HSP70WT similarly inhib-ited the release of Smac from mitochondria, but mutant HSP70DATP-BD lost its ability to inhibit the release of Smac These results suggest that the ATP-binding domain is required for prevention of the release of Smac from mitochondria

Similarly, over-expression of HSP70DPDB behaved similarly to full-length HSP70 (HSP70WT) in other functional assays, including the inhibition of the acti-vation of caspases-9 and -3 (Fig 6A) after exposure to

H2O2 for 8 h, as well as the inhibition of H2O2 -induced apoptosis as assessed by the percentage of apoptotic cells (P < 0.05) (Fig 6B) and cell viability (Fig 6C) By contrast, in these experiments conducted under the same treatment conditions, HSP70DATP-BD over-expression abolished the function of full-length HSP70 (P < 0.05) No toxic effects were observed after transfection with the vectors described above

Discussion

Our previous study demonstrated that heat shock pre-treatment led to the up-regulation of HSP70 expression and the inhibition of H2O2-mediated Smac release and

pcDNA3.1

A

B

HSP70-1 HSP70-2 HS

HSP70

GAPDH

*

HSP70-1 HSP70-2 pcDNA3.1

pcDNA3.1

0

pcDNA3.1 HSP70-1 HSP70-2 HS

Ratio of HSP70 to GAPDH 2

4

6

8

10

12

14

H2O2

Smac

COXII

Loading control

*

#

#

Cyto

60

pcDNA3.1

pcDNA3.1 + H2O2

HSP70-1 + H2O2

HSP70-2 + H2O2

50

40

30

20

10

0

Mit Cyto Mit Cyto Mit Cyto Mit

Fig 1 Over-expression of HSP70 inhibited H2O2-induced Smac

release in C2C12 cells (A) Cell lysates from C2C12 clones

over-expressing HSP70 or vector control plasmid (pcDNA3.1) were

immunoblotted with monoclonal anti-HSP70 serum Immunoblot

analysis of b-actin was used as the loading control A representative

experiment is shown Hybridization signals were quantified and

nor-malized to GAPDH signals and are presented as the fold increase

over the respective controls HS, Heat stress (B) Vector control

(pcDNA3.1) and HSP70-over-expressing (HSP70-1, HSP70-2) C2C12

cells were either kept untreated or treated with 0.5 m M of H2O2for

2 h, then harvested, lysed under conditions that kept mitochondria

intact, and centrifuged to obtain a supernatant (Cyto) and a pellet

fraction (Mit) as described in the Experimental procedures The

presence of Smac in the different fractions was determined by

immunoblot analysis Mitochondrial protein cytochrome oxidase

subunit II was used as a marker of mitochondrial protein and

Ponceau S staining was used as the loading control Hybridization

signals were quantified and normalized to GAPDH signals and are

presented as the fold increase over the respective controls

*Signifi-cant difference (P < 0.05) compared to the pcDNA3.1 control group.

apoptosis in C2C12 myogenic cells [12], although the

correlation between the two events remains unknown

In the present follow-up study, we engineered two

C2C12 cell lines with constitutive HSP70 expression at

a level similar to that of the endogenous proteins

induced by heat shock This system mimics the

anti-apoptotic effects of heat shock and is very

instrumen-tal with respect to our investigation of the role of HSP70 The results demonstrate that H2O2 treatment induced C2C12 cell apoptosis; however, HSP70 over-expression significantly prevented such stress-induced apoptosis Because these effects were similar to those

of our previous observations for the same cells under-going heat-shock, HSP70 is most likely to be the key

0

Caspase-3

pcDNA3.1

pcDNA3.1 + H2O2

10 1

10 0

45

Annexin V-FITC

40

35

30

25

20

15

10

5

0

*

#

#

pcDN

A3.1 HSP70-1 HSP70-2

pcDN A3.1 + H

2

O 2

HSP70-1 + H

2

O 2

HSP70-2 + H

2

O 2

10 2 10 3 10 4 10 0 10 1 10 2 10 3 10 4 10 0 10 1 10 2 10 3 10 4

Q1 Q2

Q4 Q3

Q1 Q2

Q4 Q3

Q1 Q2 Q4 Q3

Q1 Q2 Q4 Q3

Q1 Q2 Q4 Q3

Q1 Q2 Q4 Q3

HSP70-1

HSP70-1 + H2O2

HSP70-2

HSP70-2 + H2O2

Caspase-9

HSP70 HSP70

1 2

500 bp

300 bp

100 bp

HSP70-1 HSP70-2

0.5

1

1.5

2

2.5

3

3.5

A

B

C

*

*

#

#

Fig 2 Over-expression of HSP70 inhibited H 2 O 2 -induced apoptosis in C2C12 cells (A) Cells over-expressing HSP70 and its deletion mutants were treated with or without 0.5 m M of H 2 O 2 for 8 h Cells were harvested and cell lysates were assayed for protease activity of caspases-9 or -3 using caspase fluorescent assay kits, and apoptotic cells were identified by elevated activation of caspases-9 and -3 The experiment was repeated three times, with similar results being obtained in each case Data are the mean ± SEM of triplicate samples (B) Cells were exposed to 0.5 m M H 2 O 2 for 24 h Cells were then processed for annexin V-FITC and pyridine iodination (PI) co-staining and ana-lyzed by flow cytometry Q3 cells were regarded as control cells, whereas Q4 cells were considered as a measure of early apoptosis, Q2 cells were considered as cells at late apoptosis and Q1 cells were considered as being under necrosis Next, quantitation of apoptotic cells was determined Results are representative of three independent experiments Data are the mean ± SEM of triplicate samples *Significant difference (P < 0.05) compared to the pcDNA3.1 control group; #Significant difference (P < 0.05) compared to the group (*) that was signifi-cantly different from the pcDNA3.1 control group (C) Cytosolic DNA was extracted from control and H2O2-exposed (24 h) C2C12 cells DNA samples (4 lg) were electrophoresed on agarose gels to visualize DNA laddering M, DNA marker.

player mediating the anti-apoptotic effects, which is

consistent with the general functional role of the

chap-erone protein Our previous studies demonstrated that

H2O2 at 0.5 mmolÆL)1 induced apoptosis significantly,

but only affected a minimal number of cells

(approxi-mately 10%) In the present study, we demonstrated

that the levels of HSP70 protein expression in C2C12

myogenic cells stably transfected with the gene for

HSP70 were as high as those in cells pretreated with

heat shock, and that the ectopic expression of

wild-type HSP70 inhibited not only H2O2-mediated Smac release, but also H2O2-induced apoptosis in transfected C2C12 cells Furthermore, there was no direct interac-tion between HSP70 and Smac proteins, and the ATP-binding domain of HSP70, rather than the pep-tide-binding domain, was essential for this specific function of the protein Recent studies have revealed that HSP70-mediated protection is essential for cells aiming to combat stress and avoid cell death [14,22]

As three key modulators responsible for apoptosis, cytochrome c, AIF and Smac are released into the cytosol during stress, where they activate the caspase cascade and subsequently cause cell death HSP70 can inhibit the release of cytochrome c and AIF from mitochondria and prevent subsequent cell death [21,23] In the present study, we demonstrated that HSP70 inhibited Smac release and the activation of caspases-9 and -3, thereby preventing DNA fragmenta-tion and apoptosis in cells under H2O2-induced oxida-tive stress This is similar to the protecoxida-tive effects of another heat-shock protein, HSP27, against apoptosis,

as previously reported [24]

The molecular chaperone HSP70 has been shown

to inhibit stress-induced apoptosis by interacting with apoptotic-associated factors For example, HSP70 directly interacts with JNK, resulting in the suppression of JNK-mediated apoptosis [25] HSP70 physically interacts with Apaf-1, blocking Apaf-1⁄ cytochrome c-mediated caspase activation [20] HSP70 also binds to and antagonizes AIF, thereby inhibiting

IB: HSP70

IB: Smac

Fig 3 No interaction was found between HSP70 and Smac

Vec-tor control (C2C12-C) and HSP70-over-expressing (C2C12-HSP70)

cells were either kept untreated or treated with 0.5 m M of H 2 O 2 for

2 h Cells were harvested and lysed Next, whole-cell lysates were

immunoprecipitated with polyclonal HSP70 or polyclonal

anti-Smac sera Immunoprecipitations were further analyzed by

immu-noblots probed with Smac antibody or polyclonal HSP70 antibody,

respectively.

A

B

ATP-BD

EEVD

C

C

C

EEVD

EEVD

N

N

70 kDa

IB: Hsp70

52 kDa

28 kDa

IB: Actin

PBD

PBD

Fig 4 Deletion mutants of HSP70 were constructed and

transf-ected A schematic drawing is shown of the HSP70 deletion

mutants employed in the present study (A) Deleted amino acids

are indicated by the dotted lines ATP-BD, 1-383AA, 42 kDa; PBD,

384-542AA, 18 kDa (B) Western blot analysis demonstrated the

levels of expression of the HSP70 proteins after deletion mutants

of HSP70 were transfected.

Cyto Mit Cyto Mit Cyto Mit Cyto Mit pcDNA3.1 HSP70 WT HSP70 ΔATP-BD HSP70 ΔPBD

H2O2 2 h

Smac

COX II

Loading control

Fig 5 The ATP-binding domain of HSP70 is the essential region for inhibition of Smac release Cells over-expressing HSP70 or its deletion mutants were treated with 0.5 m M of H2O2for 2 h, har-vested, lysed under conditions that kept mitochondria intact, and then centrifuged to obtain a supernatant (Cyto) and a pellet fraction (Mit) as described in the Experimental procedures Protein protein contents were determined by the Bradford assay (Bio-Rad, Hercules, CA, USA), and equal amounts of proteins (10–20 lg) were loaded in each lane and separated by SDS-PAGE Levels of Smac in the different fractions were determined by immunoblot analysis Cytochrome oxidase subunit II (COX II) was used as a marker of mitochondrial protein and Ponceau S staining was used

to visulize equal protein loadings.

caspase-independent apoptosis [23] However, the results obtained in the present study suggest that the inhibitory effect of HSP70 on the release of Smac and

H2O2-mediated and Smac-promoted apoptosis is not attributable to a direct physical interaction between HSP70 and Smac

HSP70 contains three functional regions: the ATP-binding domain, the peptide-ATP-binding domain, and the EEVD motif Although the EEVD motif is considered

to be involved in the chaperone function of HSP70, and was assumed to mediate cytoprotection by restor-ing damaged or unfolded proteins under stress, the roles of other domains of HSP70 in anti-apoptosis remain highly controversial Some studies have pro-posed that the ATP-binding domain of human HSP70

is not required in HSP70-mediated JNK suppression, inhibition of cytochrome c release and caspase activa-tion, and protection of cells from injury [26] By con-trast, other studies have shown that the ATP-binding domain of HSP70 is essential for its anti-apoptotic role For example, deletional analysis demonstrated that the ATP-binding domain is essential for inhibiting the release of cytochrome c from mitochondria [27]

3

A

*

*

# #

# # 2

2.5

1

1.5

0.5

0

Caspase-3

70

60

50

*

pcDNA3.1 pcDNA3.1 + H2O2 HSP70 + H2O2 HSP70ΔATP-BD + H2O2 HSP70ΔPBD + H2O2

30

20

10

0

Time (h)

B

a

b

pcDNA3.1

2 O2

Caspase-9

pcDNA3.1 pcDNA3.1 + H2O2 HSP70 + H2O2 HSP70ΔATP-BD + H2O2

C 1.2

*

1

0.8

0.6

0.4

0.2

0

pcDNA3.1

pcDNA3.1 + H

2 O 2

Hsp70 + H

2 O 2

Hsp70

ΔATP-BD

+ H

2 O 2

Hsp70

ΔPBD

+ H

2 O 2

HSP70ΔPBD + H2O2

Fig 6 ATP-binding domain of HSP70 is essential for the inhibition

of H 2 O 2 -induced activation of caspases-9 and -3 and apoptosis (A) The effects of HSP70 and its deletion mutant proteins on the acti-vation of caspases-9 and -3 were analyzed Cells over-expressing HSP70 and its deletion mutants were treated with or without 0.5 m M of H2O2for 8 h Cells were harvested and cell lysates were assayed for protease activity of caspases-9 or -3 using caspase fluorescent assay kits Data of caspase fluorescent assay were obtained from four independent experiments *Significant differ-ence (P < 0.05) compared to the pcDNA3.1 control group; #Signifi-cant difference (P < 0.05) compared to the group (*) that was significantly different from the pcDNA3.1 control group (n = 8) (B) Measurement of percentages of apoptotic cells Twenty-four hours after transfer, cells were treated with 0.5 m M H 2 O 2 for 12 or 24 h, and then stained with Hoechst 33258 Under a fluorescence micro-scope, apoptotic cells, which contained condensed chromatin frag-ments, were scored and expressed as a percentage of the total cell number counted Data are the mean ± SEM *Significant differ-ence (P < 0.05) compared to the pcDNA3.1 control group; #Signifi-cant difference (P < 0.05) compared to the group (*) that was significantly different from the pcDNA3.1 control group (n = 5) (a–f) Cells incubated with H2O2for 24 h (C) Determination of cell viability Approximately 2000 cells were plated in each well of 96-well plates After 24 h of incubation, 0.5 m M of H 2 O 2 was added and cell viability was measured by an 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide assay after exposure to H2O2for

24 h The experiment was repeated three times, with essentially the same results being obtained in each case Data are the mean ± SEM of triplicate samples *Significant difference (P < 0.05) compared to the pcDNA3.1 control group; #Significant difference (P < 0.05) compared to the group (*) that was signifi-cantly different from the pcDNA3.1 control group (n = 5).

The ATP-binding domain of HSP70 is important

for the interaction of HSP70 with apoptosis

signal-regulating kinase 1 (ASK1) and the inhibition of

ASK1-induced apoptosis in vitro [28] Furthermore, the

ATP-binding domain of HSP70 is critical for

sequester-ing AIF in the cytosol [29] In the present study, we

demonstrated that the ATP-binding domain of HSP70

was indispensable for inhibition of Smac release from

mitochondria as well as apoptotic events in C2C12

myogenic cells

The molecular mechanism by which HSP70 and

HSP70DPBD interfere with Smac release and apoptosis

induced by oxidative-stress is still not fully understood

The mitochondrial pathway of cell death is controlled

by Bcl-2 family proteins, a group of anti-apoptotic and

pro-apoptotic proteins that regulate the passage of

small molecules such as cytochrome c, Smac⁄ DIABLO

and apoptosis-inducing factor (which activate caspase

cascades) through the mitochondrial transition pore

[30] Bcl-2 is the prototype of the bcl-2 family of

proteins and is distributed in the mitochondria,

endoplasmic reticulum and nuclear envelope With a

well-established role with respect to protecting cells

against a variety of apoptotic stimuli, it mainly acts at

the mitochondrial level [31] A previous study [32]

demonstrated that HSP70 inhibits heat-induced

apop-tosis by preventing Bax translocation Furthermore,

over-expression of HSP70 was associated with reduced

apoptotic cell death and an increased expression of the

anti-apoptotic protein, Bcl-2 [33] On the basis of the

available evidence, HSP70 and HSP70DPBD may also

suppress Smac release and apoptosis by regulating the

expression of these pro-apoptotic or anti-apoptotic

bcl-2 family proteins

In summary, using the H2O2-induced oxidative stress

model, the present study has revealed an important

anti-apoptotic role of HSP70, which comprises a

mechanism that involves the inhibition of Smac release

from mitochondria, and the suppression of caspase

activation Such a mechanism is independent of the

interaction of HSP70 with Smac but requires the

ATP-binding domain of the protein However, it

remains to be determined how these findings are connected with the known functions of many other cellular molecules

Experimental procedures

Cell culture and treatment C2C12 myogenic cells were cultured in DMEM supple-mented with 10% heat-inactivated fetal bovine serum at

37C in the presence of 5% CO2under a humidified atmo-sphere H2O2 diluted in NaCl⁄ Pi (137 mm NaCl, 2.68 mm KCl, 10 mm Na2HPO4, 1.76 mm KH2PO4, pH = 7.4) was used in the medium at a final concentration of 0.5 mm

Heat shock treatment Subconfluent cultured cells in 50-mm dishes were subjected

to hyperthermia of 42 ± 0.3C for 1 h in a water bath before being allowed to recover for 12 h at 37C in a humidified atmosphere containing 5% CO2 As a control, cells were cultured under normal conditions without hyper-thermia

Construction of HSP70 and its truncated mutants Full-length human HSP70 cDNA was obtained as a gener-ous gift from I Benjemin (University of Utah Health Sciences Center, Salt Lake City, UT, USA) It was direc-tionally cloned between KpnI and BamHI sites into the mammalian expression vector pcDNA3.1(-)-His-myc At the same time, this cDNA was used as the template for PCR amplification of two HSP70 truncated mutants with deletion of the ATP-binding domain (HSP70DATP-BD) or the peptide-binding domain (HSP70DPBD) using primer pairs (Table 1) All DNA digested fragments were purified using a gel purification kit (Invitrogen, Carlsbad, CA, USA), and subsequently ligated into pcDNA3.1(-)-His-myc vector overnight at 4C with T4 DNA polymerase (Pro-mega, Madison, WI, USA) The correct insets were verified

by sequencing and digestion The final constructs were named pcDNA3.1-HSP70WT, pcDNA3.1-HSP70DATP-BD or pcDNA3.1-HSP70DPBD(Fig 4A)

Table 1 Sequences of primers used to construct pcDNA3.1-HSP70WT, pcDNA3.1-HSP70 DATP-BD or pcDNA3.1-HSP70 DPBD plasmids.

Sense of pcDNA3.1-HSP70 DATP-BD

AAAAGGATCCAAAGTCCGAGAACTGGCAGGAC

Lipofectamine-mediated gene transfection

C2C12 myogenic cells were cultured to sub-confluence and

transfected with each of the expression plasmids

manufac-tured as described in the above steps, or the empty vector

without the cDNA (control) with a Lipofectamine-mediated

method (Lipofectamine 2000, Invitrogen), as described

previously [13]

Preparation of mitochondrial and cytosolic

fractions

The subcellular fractions of C2C12 myogenic cells treated

with or without H2O2were isolated as described previously

[13]

Western blot analysis

Western blotting with anti-HSP70 and anti-Smac sera was

performed as described previously [34]

Caspase activity assay

Caspase activation was determined according to the method

described previously [13]

Flow cytometric analysis

Both adherent and floating cells were collected after

treat-ment, washed with ice-cold NaCl⁄ Pi, and stained with

fluorescein isothiocyanate (FITC)-conjugated annexin V

(BD Biosciences, Franklin Lakes, NJ, USA) and pyridine

iodination (PI) for 20 min at room temperature in the dark

The stained cells were then analyzed by a flow cytometer

(Beckman Coulter, Fullerton, CA, USA) FITC-conjugated

annexin V binds to phosphatidylserine molecules present

only at the surface of apoptotic cells but not non-apoptotic

cells due to the loss of plasma membrane asymmetry early

in apoptosis Cells were simultaneously stained with PI to

discriminate membrane-permeable necrotic cells from

FITC-labeled apoptotic cells Apoptotic cells were identified as

those with positive staining only to annexin V-FITC and

not to PI, and the results were expressed as the proportion

of these cells among the total number of cells analyzed

Hoechst 33258 staining

Hoechst 33258 staining was performed as described

previ-ously [12,13]

Detection of DNA fragmentation

Floating and adherent cells (5· 107

) were combined and pelleted by centrifugation at 400 g for 5 min, and washed

twice with NaCl⁄ Pi Cell pellets were resuspended in 200 lL

of lysis buffer [10 mm Tris–HCl (pH 8.0), 10 mm EDTA, 0.5% Triton X-100 and 0.1 mgÆmL)1 RNase A] and incu-bated at 37C for 1 h Cell lysates were then treated with protease K (0.2 mgÆmL)1) at 54C for 30 min The genomic DNA was isolated by two with two rounds of phenol–chlo-roform extraction followed by an additional chlophenol–chlo-roform extraction DNA pellet was then washed in 70% ethanol and resuspended in 1 mm EDTA and 10 mm Tris–HCl (pH 8.0) at a final concentration of 20 lgÆmL)1 Aliquots were electrophoresed on a 1.5% agarose gel containing ethi-dium bromide, and photographed under UV illumination A GeneRuler 100 bp DNA ladder (MBI Fermentas, Hanover,

MD, USA) was utilized as DNA size marker

Co-immunoprecipitation assay For co-immunoprecipitation, transiently transfected C2C12 cells were lyzed with pre-cold RIPA buffer (150 mmolÆL)1 NaCl, 1% NP40, 0.5% deoxycholic acid sodium salt, 0.1% SDS, 50 mmolÆL)1Tris pH 8.0, 1 mm phenylmethanesulfo-nyl fluoride and complete protease inhibitor tablet) at 4C for 5 min To reduce nonspecific combination, lysates con-taining 500 lg of total protein were pre-immunized with

25 lL of a slurry of protein A⁄ G coupled to agarose beads (Invitrogen) overnight at 4C on a rotating wheel Aliquots

of the pre-cleared supernatants were then each incubated with 2 lg of appropriate mouse monoclonal anti-HSP70 serum, polyclonal rabbit anti-Smac serum (R&D Systems, Minneapolis, MN, USA), normal mouse immunoglobu-lin G (control for anti-HSP70) or normal rabbit serum (control for anti-Smac) added into 25 lL of protein A⁄ G slurry coupled to agarose beads (Invitrogen) for 5 h at 4C

on a rotating wheel Protein A⁄ G beads were collected by centrifugation at 4C followed by a total of four additional washes lysis buffer containing 200 mm NaCl Immune com-plexes were eluted by twice by sample buffer (2% SDS, 2 m 2-mercaptoethanol) after boiling at 100C for 10 min Proteins were separated by electrophoresis on SDS-PAGE followed by immunoblotting with polyclonal anti-HSP70 and anti-Smac sera, as described previously [24] As the controls of total antigens in the lysates before co-immuno-precipitation, portions of lysates (1 : 20) were also resolved

on SDS-PAGE and immunoblotted with anti-HSP70 or anti-Smac sera

Cell viability assay

To determine cell viability, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (0.5 mg) was added to

1 mL of cell suspension (1· 106cellsÆmL)1 in 24-well plates) After 4 h of incubation, cells were washed three times with NaCl⁄ Pi (pH 7.4) The insoluble formazan product was dissolved in dimethylsulfoxide and D490 of each culture well was then measured using a microplate reader (Titertek Multiskan Plus, Flow Laboratories,

McClean, VA, USA) The attenuance of formazan

formed in control cells was considered as 100% viability

Statistical analysis

Data are expressed as the mean ± SEM of the indicated

number of separate experiments Differences between two

groups were analyzed using an unpaired Student’s t-test

Differences among three or more groups were analyzed by

one-way analysis of variance followed by the

Student–New-man–Keuls post-hoc test P < 0.05 was considered

statisti-cally significant

Acknowledgements

This study was supported by the grants from the

National Basic Research Program of China

(2007CB512007), the National Natural Science

Foun-dation of China (30700290) and Special Funds for

PhD Training from the Ministry of Education of

China (20060533009)

References

1 Steller H (1995) Mechanisms and genes of cellular

suicide Science 267, 1445–1449

2 Shishido T, Woo CH, Ding B, McClain C, Molina CA,

Yan C, Yang J & Abe J (2008) Effects of

MEK5⁄ ERK5 association on small ubiquitin-related

modification of ERK5: implications for diabetic

ventric-ular dysfunction after myocardial infarction Circ Res

102, 1416–1425

3 Burke RE (2008) Programmed cell death and new

dis-coveries in the genetics of parkinsonism J Neurochem

104, 875–890

4 Engel T, Kannenberg F, Fobker M, Nofer JR, Bode

G, Lueken A, Assmann G & Seedorf U (2007)

Expression of ATP binding cassette-transporter

ABCG1 prevents cell death by transporting

cytotoxic 7beta-hydroxycholesterol FEBS Lett 581,

1673–1680

5 Yaglom JA, Ekhterae D, Gabai VL & Sherman MY

(2003) Regulation of necrosis of H9c2 myogenic cells

upon transient energy deprivation Rapid deenergization

of mitochondria precedes necrosis and is controlled by

reactive oxygen species, stress kinase JNK, HSP72 and

ARC J Biol Chem 278, 50483–50496

6 Dougherty CJ, Kubasiak LA, Frazier DP, Li H, Xiong

WC, Bishopric NH & Webster KA (2004)

Mitochon-drial signals initiate the activation of c-Jun N-terminal

kinase (JNK) by hypoxia-reoxygenation FASEB J 18,

1060–1070

7 Thornberry NA & Lazebnik Y (1998) Caspases:

enemies within Science 281, 1312–1316

8 Sun XM, MacFarlane M, Zhuang J, Wolf BB, Green

DR & Cohen GM (1999) Distinct caspase cascades are initiated in receptor-mediated and chemical-induced apoptosis J Biol Chem 274, 5053–5060

9 Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M, Alnemri ES & Wang X (1997) Cytochrome

c and dATP-dependent formation of Apaf-1⁄ caspase-9 complex initiates an apoptotic protease cascade Cell

91, 479–489

10 Du C, Fang M, Li Y, Li L & Wang X (2000) Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition Cell 102, 33–42

11 Verhagen AM, Ekert PG, Pakusch M, Silke J, Connolly

LM, Reid GE, Moritz RL, Simpson RJ & Vaux DL (2000) Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins Cell 102, 43–53

12 Jiang B, Xiao W, Shi Y, Liu M & Xiao X (2005) Role

of Smac⁄ DIABLO in hydrogen peroxide-induced apop-tosis in C2C12 myogenic cells Free Radic Biol Med 39, 658–667

13 Jiang B, Xiao W, Shi Y, Liu M & Xiao X (2005) Heat shock pretreatment inhibited the release of Smac⁄ DIA-BLO from mitochondria and apoptosis induced by hydrogen peroxide in cardiomyocytes and C2C12 myogenic cells Cell Stress Chaperones 10, 252–262

14 Lui JC & Kong SK (2007) Heat shock protein 70 inhib-its the nuclear import of apoptosis-inducing factor to avoid DNA fragmentation in TF-1 cells during erythro-poiesis FEBS Lett 581, 109–117

15 Zhao Y, Wang W & Qian L (2007) Hsp70 may protect cardiomyocytes from stress-induced injury by inhibiting Fas-mediated apoptosis Cell Stress Chaperones 12, 83– 95

16 Jayakumar J, Suzuki K, Khan M, Smolenski RT, Farrell

A, Latif N, Raisky O, Abunasra H, Sammut IA, Mur-tuza B et al (2000) Gene therapy for myocardial protec-tion: transfection of donor hearts with heat shock protein

70 gene protects cardiac function against ischemia-reper-fusion injury Circulation 102, III302–III306

17 Li CY, Lee JS, Ko YG, Kim JI & Seo JS (2000) Heat shock protein 70 inhibits apoptosis downstream of cyto-chrome c release and upstream of caspase-3 activation

J Biol Chem 275, 25665–25671

18 Lee JS, Lee JJ & Seo JS (2005) HSP70 deficiency results

in activation of c-Jun N-terminal kinase, extracellular signal-regulated kinase, and caspase-3 in

hyperosmolarity-induced apoptosis J Biol Chem 280, 6634–6641

19 Creagh EM, Carmody RJ & Cotter TG (2000) Heat shock protein 70 inhibits caspase-dependent and -inde-pendent apoptosis in Jurkat T cells Exp Cell Res 257, 58–66

20 Saleh A, Srinivasula SM, Balkir L, Robbins PD &

Alnemri ES (2000) Negative regulation of the Apaf-1

apoptosome by Hsp70 Nat Cell Biol 2, 476–483

21 Ravagnan L, Gurbuxani S, Susin SA, Maisse C, Daugas

E, Zamzami N, Mak T, Ja¨a¨ttela¨ M, Penninger JM,

Garri-do C et al (2001) Heat-shock protein 70 antagonizes

apoptosis-inducing factor Nat Cell Biol 3, 839–843

22 Feng X, Bonni S & Riabowol K (2006) HSP70

induc-tion by ING proteins sensitizes cells to tumor necrosis

factor alpha receptor-mediated apoptosis Mol Cell Biol

26, 9244–9255

23 Didelot C, Schmitt E, Brunet M, Maingret L, Parcellier

A & Garrido C (2006) Heat shock proteins: endogenous

modulators of apoptotic cell death Handb Exp

Phar-macol 26, 171–198

24 Chauhan D, Li G, Hideshima T, Podar K, Mitsiades C,

Mitsiades N, Catley L, Tai YT, Hayashi T, Shringarpure

R et al (2003) Hsp27 inhibits release of mitochondrial

protein Smac in multiple myeloma cells and confers

dexa-methasone resistance Blood 102, 3379–3386

25 Park HS, Lee JS, Huh SH, Seo JS & Choi EJ (2001)

Hsp72 functions as a natural inhibitory protein of c-Jun

N-terminal kinase EMBO J 20, 446–456

26 Mayer MP & Bukau B (2005) Hsp70 chaperones:

cellu-lar functions and molecucellu-lar mechanism Cell Mol Life

Sci 62, 670–684

27 Mosser DD, Caron AW, Bourget L, Meriin AB,

Sher-man MY, Morimoto RI & Massie B (2000) The

chaper-one function of hsp70 is required for protection against

stress-induced apoptosis Mol Cell Biol 20, 7146–7159

28 Park HS, Cho SG, Kim CK, Hwang HS, Noh KT, Kim MS, Huh SH, Kim MJ, Ryoo K, Kim EK et al (2002) Heat shock protein hsp72 is a negative regulator

of apoptosis signal-regulating kinase 1 Mol Cell Biol

22, 7721–7730

29 Ruchalski K, Mao H, Li Z, Wang Z, Gillers S, Wang

Y, Mosser DD, Gabai V, Schwartz JH & Borkan SC (2006) Distinct hsp70 domains mediate apoptosis-induc-ing factor release and nuclear accumulation J Biol Chem 281, 7873–7880

30 Kim R (2005) Recent advances in understanding the cell death pathways activated by anticancer therapy Cancer

103, 1551–1560

31 Scorrano L & Korsmeyer SJ (2003) Mechanisms of cytochrome c release by proapoptotic BCL-2 family members Biochem Biophys Res Commun 304, 437– 444

32 Stankiewicz AR, Lachapelle G, Foo CP, Radicioni SM

& Mosser DD (2005) Hsp70 inhibits heat-induced apop-tosis upstream of mitochondria by preventing Bax translocation J Biol Chem 280, 38729–38739

33 Yenari MA, Liu J, Zheng Z, Vexler ZS, Lee JE & Giff-ard RG (2005) Antiapoptotic and anti-inflammatory mechanisms of heat-shock protein protection Ann N Y Acad Sci 1053, 74–83

34 Liang P, Jiang B, Yang X, Xiao X, Huang X, Long J, Zhang P, Zhang M, Xiao M, Xie T et al (2008) The role of peroxisome proliferator-activated receptor-beta⁄ delta in epidermal growth factor-induced HaCaT cell proliferation Exp Cell Res 314, 3142–3151