Báo cáo khoa học: Small peptides derived from the Lys active fragment of the mung bean trypsin inhibitor are fully active against trypsin pptx

In addition, it was found that BBIs may act as cancer preventive and suppressing agents; for example, the soybean BBI concentrate was tested in phase II clinical Keywords Bowman–Birk inh

mung bean trypsin inhibitor are fully active against trypsin Rui-Feng Qi1, Zhi-Xue Liu2, Shao-Qiong Xu1, Ling Zhang1, Xiao-Xia Shao1and Cheng-Wu Chi1,2

1 Institute of Protein Research, Tongji University, Shanghai, China

2 Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, Shanghai, China

Introduction

Proteinase inhibitors occur ubiquitously in

microor-ganisms, plants, and animals [1] In plants, there are a

variety of serine proteinase inhibitors, which are

divided into 16 classes [2] A Bowman–Birk protease

inhibitor (BBI) was first isolated from soybean by

Bowman [3], and was later characterized by Birk et al

[4] BBIs have been found in the Fabaceae [5,6], with

two catalytic sites [7–10] The specificity of each

reactive site is dependent on the amino acid at the P1

position The structural features, molecular evolution

and potential applications of BBIs were reviewed in

our recently published article [11]

BBIs share a homologous sequence, especially in the reactive site loop, and a conserved seven disulfide bridge network [12] Because of the highly stable struc-ture of disulfide bridges, BBIs can be resistant even to cooking temperatures, and can survive in the digestive system of animals [13] Thus, one important role of BBIs is thought to be as defensive agents against insect and microbial pest attack [14,15], and plants with BBI transgenes can efficiently retard larval growth [16] In addition, it was found that BBIs may act as cancer preventive and suppressing agents; for example, the soybean BBI concentrate was tested in phase II clinical

Keywords

Bowman–Birk inhibitor (BBI); gene cloning;

gene expression; inhibitory activity; peptide

synthesis

Correspondence

C.-W Chi, Shanghai Institute of

Biochemistry and Cell Biology, Chinese

Academy of Sciences, 320 Yue Yang Road,

Shanghai 200031, China

Fax: +86 21 54921011

Tel: +86 21 54921165

E-mail: zwqi@sibs.ac.cn or

chi@sunm.shcnc.ac.cn

(Received 23 August 2009, revised

20 October 2009, accepted 4 November

2009)

doi:10.1111/j.1742-4658.2009.07476.x

The Bowman–Birk protease inhibitors have recently attracted attention for their potential as cancer preventive and suppressing agents They contain two canonical binding loops, both consisting of nine highly conserved resi-dues capable of inhibiting corresponding serine proteases In this study, we cloned the cDNA of the mung bean trypsin inhibitor, one of the most studied Bowman–Birk protease inhibitors A modified peptide, Lys33GP, with 33 residues derived from the long chain of the Lys active fragment of mung bean trypsin inhibitor, was successfully expressed in Escherichia coli as a glutathione-S-transferase fusion protein The recombinant product was obtained with a high yield, and exhibited potent inhibitory activity Mean-while, a shorter peptide composed of only 16 residues (the Lys16 peptide), corresponding to the active core of the fragment, was synthesized Both the recombinant and the synthesized peptides had the same inhibitory activity toward trypsin at a molar ratio of 1 : 1, implying that the Lys16 peptide with two disulfide bonds is possibly the essential structural unit for inhibitory activity Using site-directed mutagenesis, the P1position Lys was replaced by Phe, and the resulting mutant, Lys33K⁄ F, was determined to have potent chymotrypsin inhibitory activity Both Lys33GP and the Lys33K⁄ F mutant may be potential pharmaceutical agents for the prevention of oncogenesis

Abbreviations

Acm, acetamidomethyl; BApNA, N-benzoyl- DL -arginine-p-nitroanilide; BBI, Bowman–Birk protease inhibitor; BTEE, N-benzoyl- L -tyrosine ethyl ester; Fmoc, fluorenylmethoxycarbonyl; GST, glutathione-S-transferase; IPTG, isopropyl thio-b- D -galactoside; MBTI, mung bean trypsin inhibitor; PSP, PreScission protease; SFTI-1, sunflower trypsin inhibitor-1; SOE-PCR, splicing by overlapping extension PCR; TFA,

trifluoroacetic acid; Trt, trityl.

trials for the treatment of patients with oral

leucopla-kia [17–19] As tumor formation is related to an

abnormally high protease activity, especially the

chy-motrypsin-like protease activity, it would be desirable

to discover a small peptide drug capable of inhibiting

this enzyme

In the early 1960s, we purified and crystallized

mung bean trypsin inhibitor (MBTI) and its

com-plexes with one or two molecules of trypsin [20,21]

We also demonstrated that MBTI contains two active

domains [22] Later, the two active fragments of

MBTI were successfully separated by restricted peptic

digestion [23], and the sequence of MBTI was

eluci-dated [24] The active fragment with Arg at the

reac-tive site P1 is composed of 27 residues, whereas the

active fragment with Lys at the reactive site is

com-posed of two peptide chains, a 26-residue long chain

being linked to a nine-residue short chain by two

in-termolecular disulfide bonds The two peptide chains

of the Lys active fragment could be separated from

each other by reduction, and the long peptide chain

still exhibited inhibitory activity after reoxidation [25]

A 22-residue peptide derived from the long chain, with

three intramolecular disulfide bonds, was synthesized,

giving two disulfide isoforms, both of which remained

active against trypsin, with Ki values of 1.2· 10)7m

and 4· 10)8m, respectively [26]

In the present article, we describe the cDNA cloning

of MBTI, and the gene expression of a 35-residue

peptide and its mutant both derived from the long chain

of the Lys active fragment of MBTI The total synthesis

of a 16-residue peptide corresponding to the core of the

active fragment and the inhibitory activity assays of all

expressed and synthetic peptides are also reported

Results

Gene cloning of MBTI

In the early 1980s, we elucidated the incomplete

pro-tein sequence of MBTI with 72 residues [24] In the

present work, based on the known amino acid

sequence, we cloned the cDNA of MBTI (GeneBank

accession number AY713305) by using 3¢-RACE and

5¢-RACE (Fig 1) The 591 bp full-length cDNA

includes a 3¢-UTR and two polyA signals (AATAAA)

located upstream of the polyA tail The 321 bp ORF

encodes a 107-residue protein that shares high

sequence homology with several BBIs from other

leguminous dicotyledons (Fig 2) The MBTI gene

(GeneBank accession number AY251011) was then

amplified from total genomic DNA, demonstrating

that there is no intron in the genomic gene sequence

The deduced MBTI sequence was compared with the previously determined sequence [24,27] and the MBTI-F reported by Wilson et al [28] (PRF accession number 0907248A) (Fig 3) The results showed that the deduced sequence was basically consistent with the determined sequence, except for six undetermined dues at the N-terminus and two additional Asp resi-dues at the C-terminus These differences can be explained by the fact that the previous sample used for sequencing was first treated with aminopeptidase M to eliminate the heterogeneity of the N-terminal part of MBTI, so the N-terminal hexapeptide (SSHHHD) was neglected Also, the two additional Asp residues were missed because they followed an Asp residue that was regarded as the terminal end of the determined sequence Therefore, the deduced sequence consists of

a 19-residue signal peptide predicted by the signalp program [29], followed by a short eight-residue peptide (GMDLNQLR) that may be a propeptide, and an 80-residue mature protein

Design and expression of the recombinant Lys33GP and Lys33K⁄ F peptides

Gene expression of the intact MBTI was unsuccessful because of mispairing of its seven disulfide bonds, and the inhibitory activity of the recombinant only accounted for 1⁄ 10 of the activity of the native MBTI (unpublished data) Subsequently, we attempted to express a smaller fragment of MBTI that may have more significant activity for potential applications Our early studies indicated that the long peptide chain of the Lys fragment (Fig 4A) still retained antitrypsin activity after air oxidation [25] The synthetic gene coding for this peptide was designed as follows: (a) as

a very small peptide is not suitable for gene expression, the gene coding for the total N-terminal part of MBTI, from residues 1 to 33, designated Lys33GP (Fig 4B) was amplified by splicing by overlap extension PCR (SOE-PCR), using synthetic primers 1 and 2 (Fig 5A); (b) in order to avoid formation of isoforms caused by disulfide mispairing, the Cys12 and Cys16 linked with the short chain of the Lys active fragment were mutated to Ser (Figs 4B and 5A); (c) two residues, Gly and Pro, were introduced before to the N-terminus of Lys33GP, as these two residues correspond to the C-terminal part of the recognition sequence for the PreScission protease (PSP) (Leu-Glu-Val-Leu-Phefl-Gly-Pro; the arrow indicates the scissile bond) used to cleave the Lys33GP fusion protein; (d) the preferential amino acid codons of Escherichia coli were used for better expression; and (e) to create the mutant Lys33K⁄ F, the reactive site Lys20 at the P1 position

Fig 1 cDNA and deduced sequences of MBTI The ORF is in capital letters, and the 3¢-UTR sequence is in small letters The sequence of the signal peptide is shaded, and the following eight residues comprise the putative prosequence The sequence corresponding to the 80-residue mature protein is in bold The two polyA signals, AATAAA, in the 3¢-UTR are underlined (a) n represents polyA GSP1, gene-specific primer 1; GSP2, gene-specific primer 2.

Fig 2 Sequence alignment of BBIs from soybean (Glycine max, P01055), kidney bean (Phaseolus vulgaris, P01060), cowpea (Vigna ungui-culata, Q1WA43), garden bean (Pisum sativum, Q41066), lentil (Lens culinaris, Q8W4Y8), and mung bean (Vigna radiata) Identical or similar residues are shaded in black or gray The potential N-terminal signal peptides are boxed; two canonical loops of nine residues are underlined; the two residues at the P1position are indicated by asterisks.

was replaced with Phe The synthetic gene of Lys33GP

flanked by EcoRI and XhoI restriction sites was then

cloned into the pGEX-4T-1 expression vector

The recombinant Lys33GP was expressed in E coli

strain BL21(DE3) (Fig 5B, lanes 1–6) as a

glutathi-one-S-transferase (GST) fusion protein, and the yield

was found to be relatively high at around 180–200 mg

per liter of culture The fusion protein GST–Lys33GP

was purified in a one-step procedure by affinity

chro-matography, using a glutathione Sepharose 4B matrix

(Fig 5B, lane 6), and successfully cleaved by PSP

(Fig 5B, lanes 6 and 7) The recombinant 35-residue

Lys33GP was then applied to an RP-HPLC C18

semi-preparative column (Fig 5C) The molecular mass of

the purified Lys33GP was determined by MS to be

3702.0 Da (Fig 5D), consistent with the theoretical

value of 3703.0 Da (Table 1) The mutant Lys33K⁄ F

was also expressed in the same system with a yield of

approximate 20–30 mg of fusion protein per liter of

culture, much lower than the yield of Lys33GP The

molecular mass of Lys33K⁄ F was determined to be

3722.0 Da, which is identical to the theoretical value

(Table 1)

Chemical synthesis of the core peptide Lys16

To determine the minimal unit necessary for the inhibi-tory activity of BBI, a linear peptide with only 16 residues (CDSSRCTKSIPPQCHC), the core sequence

of Lys33GP (from Cys13 to Cys28), was synthesized using fluorenylmethoxycarbonyl (Fmoc)-based solid-phase peptide synthesis on an ABI 433 peptide synthe-sizer After two-step selective oxidation of disulfide bonds and purification on a reverse-phase C18 semi-preparative column, the Lys16 peptide, consisting of only two conjugated loops (Fig 4C), was correctly formed and confirmed by MS The molecular mass was 1761.0 Da, which is identical to the theoretical value (Table 1)

Inhibition kinetic analysis of Lys33GP, Lys33K⁄ F, and Lys16 peptide

The inhibition kinetics of the native MBTI, Lys33GP, Lys33K⁄ F and the Lys16 peptide for bovine trypsin or chymotrypsin were studied by determining the equilib-rium dissociation constant Ki, using the Dixon plot

Fig 3 Sequence comparison of MBTI with MBTI-F (PRF: 0907248A) and the cDNA-deduced sequence MBTI (Ded.) Identical residues are shaded in black or gray The potential N-terminal signal peptides are boxed.

A

B

Fig 4 Amino acid sequence and schematic

structure of four peptides: the Lys fragment

(A), Lys33GP (B), the Lys16 peptide (C), and

SFTI-1 (D) The two shaded residues (Cys12

and Cys16) linked with the short chain of

the Lys active fragment were mutated to

Ser Gly-Pro derived from the cleavage site

of PSP is not numbered and is also shaded.

The reactive site P 1 residue is indicated by

asterisks Our residue numbering system

according to MBTI is used.

method (Table 1) The substrates

N-benzoyl-dl-argi-nine-p-nitroanilide (BApNA) for trypsin and

N-ben-zoyl-l-tyrosine ethyl ester (BTEE) for chymotrypsin

were used in the assays The Kivalue of the native MBTI

(5.24· 10)9m) was in good agreement with that

previ-ously reported (5.0· 10)9m[26,30]), and the Kivalues

of the expressed Lys33GP and the Lys16 peptide were

2.12· 10)8m and 2.28· 10)8m, respectively The

mutant Lys33K⁄ F displayed a strong inhibitory activity

toward chymotrypsin, with a Kiof 7.21· 10)9m; mean-while, it also maintained an apparent activity towards trypsin, with a Kiof 1.30· 10)6m The native double-headed MBTI is capable of inhibiting two molecules of trypsin, whereas both Lys33GP and Lys16 peptide with one reactive site, as expected, can each inhibit only one molecule of trypsin, as shown in Fig 6A, similar to the interaction between the mutant Lys33K⁄ F and chymo-trypsin (Fig 6B)

A

1.05e5

9.50e4

9.00e4

8.50e4

7.50e4

7.00e4

6.50e4

5.50e4

5.00e4

4.50e4

3.50e4

3.00e4

1.50e4

1.00e4

5000.00

2.00e4

3702.0

2000 2200 2400 2600 2800 3000 3200 3400 3600 3800 4000 4200 4400 4600 4800 5000

Mass (amu) 2073.02223.0 2503.02776.02963.0

3046.0 3212.0 3416.03723.0 3684.0 3759.0 4099.04281.04446.04627.04664.0

DMass reconstruction of +EMS: 0.738 to 1.122 min from Sample 14 (Qrf15) of 080722.wiff (Turbo Sp Max 1.1e5 cps.

Fig 5 Gene synthesis of the recombinant Lys33GP and its expression in E coli BL21(DE3) (A) Gene amplification of Lys33GP with two designed primers by SOE-PCR Two Cys residues mutated to Ser are marked by squares The flanking EcoRI and XhoI restriction sites were designed for cloning into the pGEX-4T-1 vector The boxed nucleotide acid sequence corresponds to the recognition region of PSP (the scis-sile bond between Glu and Gly is indicated by fl) (B) Expression and cleavage of the fusion protein GST–Lys33GP detected by SDS ⁄ PAGE

in a 10% polyacrylamide gel Lane M: molecular mass marker Lane 1: pre-IPTG induction Lane 2: after IPTG induction for 3 h Lane 3: the supernatant after sonication Lane 4: the unbound fraction on the GST affinity resin Lane 5: the purified GST–Lys33GP eluted from the GST resin Lane 6: GST–Lys33GP cleaved partially by PSP Lane 7: GST–Lys33GP completely cleaved with PSP, the electrophoretic band above the band of GST comes from the PSP enzyme preparation itself; compared with the molecular mass of GST, Lys33GP was too small to be detected and ran out of the gel Line 8: the PSP enzyme preparation itself (C) HPLC profile of the purified GST–Lys33GP after enzymatic cleavage with PSP (D) The sequence of purified Lys33GP and the MS profile Lys33GP contains additional Gly-Pro derived from the PSP recognition region at the N-terminus, and two Cys residues are mutated to Ser (underlined).

A reported array of BBI variants caused by

polymor-phism has been found, not only in mung bean, but

also in pea, horsegram, and other legume seeds [28,31–

33] Wilson et al reported that ungerminated seeds of

mung bean contain a main BBI protein (designated

MBTI-F), as well as several polymorphic forms

derived from MBTI-F by limited specific proteolysis at

both ends [28,34] In determining the MBTI sequence,

we encountered the same problem, in that the

N-termi-nus of MBTI was heterogeneous Thus, the purified

protein was briefly treated with aminopeptidase M

prior to sequence determination, until the N-terminal

residue could be definitely identified Not surprisingly,

as compared with the deduced MBTI peptide in this

work, some residues of the N-terminus in the

deter-mined sequence were neglected Our MBTI most likely

corresponds to the MBTI-F reported by Wilson et al

(Fig 3) in 1983 [28], one year after our sequence was

published We further confirmed that the Mr of the

native MBTI, determined by MS, was 8883.0,

consis-tent with the theoretical Mrof 8884.8 for MBTI-F

As expected, the Lys16 peptide, consisting of a

canonical nine-residue loop and a conjugated disulfide

loop (from Cys13 to Cys28 of Lys33GP), remains

active, with the same Ki value as that of the

recombi-nant Lys33GP Furthermore, it is worth pointing out

that the Lys16 peptide has the same topologic

struc-ture as the sunflower trypsin inhibitor (SFTI-1)

(Fig 4D), a native cyclic peptide with only 14 residues

In the canonical nine-residue loop, there is only one

residue difference between MBTI and SFTI-1; namely,

the Gln near the disulfide bond in MBTI is replaced

by Ile in SFTI-1, and instead of another disulfide loop,

as in MBTI, a cyclic peptide loop is formed between

the N-terminal and C-terminal residues in SFTI-1 Therefore, the SFTI-1-like Lys16 peptide should be considered as the smallest essential unit of BBI main-taining inhibitory activity

A

B

Fig 6 Inhibition curves of the native MBTI, Lys33GP, the Lys16 peptide and the mutant Lys33K ⁄ F against bovine trypsin (A) and against bovine chymotrypsin (B) MBTI, Lys33GP, the Lys16 pep-tide and Lys33K ⁄ F are indicated by open circles, open squares, filled triangles, and filled squares, respectively.

Table 1 The relative molecular masses (M r ) and inhibition

con-stants (K i ) of the native MBTI, Lys33GP, the Lys16 peptide, and

the mutant Lys33K⁄ F Each K i value represents the mean ±

stan-dard deviation determined from three independent experiments

(MBTI was identical to MBTI-F [28] as clarified by this work).

Inhibitor

Calculated Determined Antitrypsin Antichymotrypsin

· 10 –9

Lys33GP 3703.0 3702.0 (2.12 ± 0.24)

· 10 –8

Lys16

peptide

1761.0 1761.0 (2.28 ± 0.52)

· 10 –8

Lys33K⁄ F 3722.0 3722.0 (1.30 ± 0.31)

· 10 –6

(7.21 ± 0.18)

· 10 –9

BBIs may act as cancer preventive agents to

suppress abnormally high protease activity, especially

the chymotrypsin-like protease activity in the tumor

[17–19] Regarding therapeutic applications, BBIs are

given only orally as an extract from soybeans It will

be desirable to have a small and stable peptide drug

that is capable of inhibiting chymotrypsin or trypsin,

or even elastase From this point of view, our

success-ful expression of the potently active Lys33GP and the

mutant Lys33K⁄ F demonstrated that it may be

feasi-ble to produce BBI-derived anticarcinogenic

pharma-ceuticals on a large scale for clinical therapy or

treatment

Experimental procedures

Materials

The 3¢-RACE and 5¢-RACE kit and TRIzol Reagent were

from Life Technologies (Gaithersburg, MD, USA) Taq

DNA polymerase, the PCR preps DNA purification system,

the Minipreps DNA purification system and the pGEM-T

Easy vector system were from Promega (Madison, WI,

USA) E coli strain DH5a was used for transformation of

pGEM-T Easy vector, and E coli BL21(DE3) for

expres-sion of the GST fuexpres-sion protein T4 DNA polymerase was

from TaKaRa Biotechnology Co Ltd pGEX-4T-1

expres-sion vector, GST affinity resin (glutathione Sepharose 4B)

and PSP were purchased from Amersham Biosciences

(Uppsala, Sweden) The ZORBAX 300 SB-C18

semiprepar-ative column was from Agilent Technologies (Santa Clara,

CA, USA) Trifluoroacetic acid (TFA) and acetonitrile were

from Merck (Darmstadt, Germany) All Fmoc amino acids

were obtained from Applied Biosystems (Foster City, CA,

USA) Fmoc-Cys [trityl (Trt)]

hydroxymethylphenoxy-methyl polystyrene resin was obtained from PE (Rockford,

IL, USA) Bovine trypsin was from Sigma (St Louis, MO,

USA) The chromogenic substrate BApNA was from

Shanghai Bio Life Science & Technology Co Ltd Other

solvents and reagents were of analytical grade

cDNA cloning of MBTI

About 1 g of mung bean seeds at the late germinating stage

was ground to fine powder in liquid nitrogen, and the total

RNA was then extracted with TRIzol reagent (Invitrogen),

according to the user manual 3¢-RACE and 5¢-RACE were

performed as previously described [35] About 5 lg of

RNA were taken to convert mRNAs into cDNAs, using

Superscript II reverse transcriptase and a universal

oligo(dT)-containing adapter primer Gene-specific primer 1

[5¢-AT(T ⁄ C ⁄ A)CC(A ⁄ G ⁄ C ⁄ T)CC(A ⁄ G ⁄ C ⁄ T)CA(A ⁄ G)TG

(T⁄ C)CA(T ⁄ C)-3¢], corresponding to the N-terminal

sequence (IPPQCH) of BBI, was paired with the abridged

universal amplification primer The 3¢-end partial cDNA of BBI was then amplified by PCR The PCR product contain-ing a polyA tail was directly cloned into the pGEM-T Easy vector for sequencing On the basis of the 3¢-end partial cDNA sequence of BBI, the antisense gene-specific primer 2 (5¢-TCGTGTACACATACAGGA-3¢), corresponding to residues 48–53, was designed and synthesized With the same strategy as described previously [35], the 5¢-end cDNA

of MBTI was then amplified and sequenced

Construction of recombinant Lys33GP and mutant Lys33K⁄ F expression vector The gene coding for Lys33GP was constructed by the SOE-PCR strategy, using primer 1 (5¢-GTGAATTCCTGGAAG TTCTGTTCCAGGGGCCCAGCAGCGATGAACCGAG CGAAAGCAGCGAACCGAGCTGCGATAGCAGC-3¢) and primer 2 (5¢-GTCTCGAGTTACAGGCGAATATCG GCGCAATGGCACTGCGGCGGAATGCTTTTGGTGC AGCGGCTGCTATCGCAGCTCGG-3¢) The underlined region in the primer 1 sequence corresponds to the PSP cleavage site The SOE-PCR product was gel-purified, and digested with EcoRI and XhoI, and the resulting fragment was then ligated into the expression vector pGEX-4T-1 The pGEX–Lys33K⁄ F construct was reconstructed by using a pair of primers for site-directed mutagenesis: the forward and reverse primers were 5¢-CGCTGCACCTT TAGCATTCCG-3¢ and 5¢-CGGAATGCTAAAGGTGC AGCG-3¢, respectively

Gene expression and purification of the recombinant Lys33GP and Lys33K⁄ F

E coli strain BL21(DE3) was transformed with the recom-binant plasmid GST–Lys33GP and grown in 500 mL of

LB⁄ ampicillin medium (5 gÆL)1 tryptone, 10 gÆL)1 yeast extract, 5 gÆL)1NaCl, 100 mgÆL)1ampicillin) at 37C with shaking, until A600reached 0.5 The culture was induced with 0.5 mm isopropyl thio-b-d-galactoside (IPTG), and the incubation was continued for another 3 h The cells were harvested by centrifugation at 8000 g for 5 min, resus-pended in 50 mL of 1· NaCl ⁄ Pi (140 mm NaCl, 2.7 mm KCl, 10 mm Na2HPO4, 1.8 mm KH2PO4, pH 7.3) contain-ing 1 mm phenylmethanesulfonyl fluoride, and lysed by sonication on ice The debris was removed by centrifuga-tion at 12 000 g for 10 min The purificacentrifuga-tion of the recom-binant protein was conducted according the GST gene fusion system handbook from Amersham Biosciences The fusion protein was cleaved at 4C for about 5 h with PSP The cleaved Lys33GP was loaded onto an HPLC ZOR-BAX C18 semipreparative column (9.4· 250 mm) equili-brated with buffer A (0.1% TFA), and then eluted with a two-step gradient of 0–30% buffer B (acetonitrile in 0.1% TFA) in 5–20 min and 30–100% buffer B in 20–25 min at

a flow rate of 2 mLÆmin)1 The mutant Lys33K⁄ F was also

expressed and purified with the same procedure The

puri-fied Lys33GP and Lys33K⁄ F were lyophilized for

inhibi-tory activity assays

Peptide synthesis

The linear Lys16 peptide (CDSSRCTKSIPPQCHC) was

synthesized using an ABI 433 peptide synthesizer, starting

from Fmoc-Cys (Trt) hydroxymethylphenoxymethyl

polystyrene resin (wang resin) The protected amino acids

are: Fmoc-Arg

(2,2,4,6,7-pentamethyldihydrobenzofuran-5-sulfonyl), Fmoc-Lys (t-butoxycarbonyl), Ser (t-butyl),

Fmoc-Cys (Trt, Acm), Fmoc-His (Trt), and Fmoc-Glu

(Trt) For selective oxidation of disulfide bonds, two-step

oxidation of S-Trt⁄ S-Acm was adopted [36] The

TFA-labile Trt protecting group was used for Cys13 and Cys28

(outer conjugated loop), and the TFA-stable Acm

protect-ing group for Cys18 and Cys26 (inner canonical loop)

After completion of solid-phase synthesis, the resin was

cleaved by TFA containing 5% p-cresol and a few drops of

triethylsilane and thioanisole for 1.5 h at room

tempera-ture After removal of TFA, the product was washed with

diethyl ether and extracted with 0.1% TFA containing 20%

acetonitrile The extract was then lyophilized and purified

on a Sephadex G-15 column equilibrated with 0.1% TFA

The eluted peptide fraction was lyophilized and further

purified on an RP-HPLC ZORBAX C18 semipreparative

column (9.4· 250 mm) equilibrated with buffer A (0.1%

TFA) at a flow rate of 2 mLÆmin)1 The peptide was eluted

by a two-step gradient system: 0–18% buffer B (70%

aceto-nitrile⁄ 0.1% TFA) in 6 min, and 18–28% buffer B in

6–26 min The purified peptide was characterized by MS

All protecting groups except Acm were removed The

deprotected Cys13 and Cys28 were oxidized to form the

first disulfide bond in 50 mm Tris⁄ HCl (pH 8.7) at room

temperature in air for 1.5 h; the peptide was then acidified

with 50% TFA and lyophilized After being desalted on a

Sephadex G15 column and purified by RP-HPLC, the

pep-tide was dissolved in 0.1% TFA and treated with 5 mm

iodine (1 : 5 molar ratio of the peptide to I2) to remove the

Acm protecting group and allow the formation of another

disulfide bond (Cys18 and Cys26) [36] The two disulfide

bonds were then correctly paired, and the peptide was

puri-fied on a ZORBAX C18 semipreparative column

equili-brated with buffer A (0.1% TFA) at a flow rate of

2 mLÆmin)1 with a two-step gradient system: 0–25% buffer

B (70% acetonitrile⁄ 0.1% TFA) in 8 min, and 25–30%

buf-fer B in 8–28 min The synthetic peptide was again

charac-terized by MS

MS

The expressed and synthetic peptides were analyzed in the

scan type of Enhanced MS by Qtrap (Applied Biosystems,

Foster City, CA, USA) The mass spectrometer, equipped with a TurboIonSpray Source, was operated in positive ionization mode

Inhibition kinetic analysis The assay for trypsin inhibitory activity of the native MBTI, Lys33GP, Lys33K⁄ F and the Lys16 peptide was performed in 3 mL of 0.05 m Tris⁄ HCl (pH 7.8) and

10 mm CaCl2, containing 5 lgÆmL)1 trypsin and various amounts of the sample, using BApNA (500 lm) as a sub-strate All assays were carried out at 25C The enzyme was first incubated with the inhibitor for 5 min to allow equilibrium to be reached, and the BApNA was then added The residual trypsin activity was measured at

410 nm with a U-2800 spectrophotometer (Hitachi, Tokyo, Japan) The assay for chymotrypsin inhibitory activity of Lys33K⁄ F used BTEE as a substrate at a concentration

of 90 lm and 5 lgÆmL)1 chymotrypsin The residual activ-ity was measured at 259 nm The inhibition constants (Ki) for trypsin or chymotrypsin were determined by Dixon plot (1⁄ V against I), using two different concentrations of substrate, 300 and 600 lm for BApNA, and 50 and

100 lm for BTEE

Acknowledgements

We thank Z.-Y Guo for helpful discussions We also would like to thank J.-B Han for her generous assis-tance in this work

References

1 Laskowski M Jr & Kato I (1980) Protein inhibitors of proteinases Annu Rev Biochem 49, 593–626

2 Ryan CA (1990) Protease inhibitors in plants: genes for improving defenses against insects and pathology Annu Rev Phytopathol 28, 425–449

3 Bowman I (1946) The millionth map of Hispanic Amer-ica Science 103, 319–323

4 Birk Y, Gertler A & Khalef S (1963) A pure trypsin inhibitor from soya beans Biochem J 87, 281–284

5 Norioka S & Ikenaka T (1983) Amino acid sequence of

a trypsin–chymotrypsin inhibitor, B-III, of peanut (Arachis hypogaea) J Biochem 93, 479–485

6 Tanaka AS, Sampaio MU, Marangoni S, de Oliveira B, Novello JC, Oliva ML, Fink E & Sampaio CA (1997) Purification and primary structure determination of a Bowman–Birk trypsin inhibitor from Torresea cearensis seeds Biol Chem 378, 273–281

7 Odani S, Koide T & Ono T (1986) Wheat germ trypsin inhibitors Isolation and structural character-ization of single-headed and double-headed inhibitors

of the Bowman–Birk type J Biochem 100, 975–983

8 Tashiro M, Hashino K, Shiozaki M, Ibuki F & Maki

Z (1987) The complete amino acid sequence of rice

bran trypsin inhibitor J Biochem 102, 297–306

9 Tashiro M, Asao T, Hirata C, Takahashi K &

Kanamori M (1990) The complete amino acid sequence

of a major trypsin inhibitor from seeds of foxtail millet

(Setaria italica) J Biochem 108, 669–672

10 Prakash B, Selvaraj S, Murthy MR, Sreerama YN, Rao

DR & Gowda LR (1996) Analysis of the amino acid

sequences of plant Bowman–Birk inhibitors J Mol Evol

42, 560–569

11 Qi RF, Song ZW & Chi CW (2005) Structural features

and molecular evolution of Bowman–Birk protease

inhibitors and their potential application Acta Biochim

Biophys Sin (Shanghai) 37, 283–292

12 Odani S & Ikenaka T (1973) Studies on soybean trypsin

inhibitors 8 Disulfide bridges in soybean Bowman–

Birk proteinase inhibitor J Biochem 74, 697–715

13 Voss RH, Ermler U, Essen LO, Wenzl G, Kim YM &

Flecker P (1996) Crystal structure of the bifunctional

soybean Bowman–Birk inhibitor at 0.28-nm resolution

Structural peculiarities in a folded protein

conforma-tion Eur J Biochem 242, 122–131

14 Domoney C (1999) Inhibitors of Legume Seeds Kluwer

Academic Publishers, Dordrecht

15 Richardson M (1991) Seed Storage Proteins: the

Enzyme Inhibitors, Vol 5 Academic Press, New York

16 Falco MC & Silva-Filho MC (2003) Expression of

soybean proteinase inhibitors in transgenic sugarcane

plants: effects on natural defense against Diatraea

saccharalis Plant Physiol Biochem 41, 761–766

17 Kennedy AR (1998) The Bowman–Birk inhibitor from

soybeans as an anticarcinogenic agent Am J Clin Nutr

68, 1406S–1412S

18 Armstrong WB, Kennedy AR, Wan XS, Taylor TH,

Nguyen QA, Jensen J, Thompson W, Lagerberg W &

Meyskens FL Jr (2000) Clinical modulation of oral

leukoplakia and protease activity by Bowman–Birk

inhibitor concentrate in a phase IIa chemoprevention

trial Clin Cancer Res 6, 4684–4691

19 Malkowicz SB, McKenna WG, Vaughn DJ, Wan XS,

Propert KJ, Rockwell K, Marks SH, Wein AJ &

Kennedy AR (2001) Effects of Bowman–Birk inhibitor

concentrate (BBIC) in patients with benign prostatic

hyperplasia Prostate 48, 16–28

20 Chu HM, Lo SS, Jen MH, Chi CW & Tsao TC (1965)

The relationship between trypsin inhibitors A and B from

mung bean (Phaseolus aureus Roxb.) and some chemical

characteristics of the inhibitors Sci Sin 14, 1454–1463

21 Chu HM & Chi CW (1965) The isolation and

crystalli-zation of two trypsin inhibitors of low molecular weight

from mung bean (Phaseolus aureus Roxb.) Sci Sin 14,

1441–1453

22 Chu HM & Chi CW (1965) Divalency of the mung

bean inhibitor and the crystallization of two

corre-sponding inhibitor–trypsin compounds Acta Biochim Biophys Sin (Shanghai) 5, 519–528

23 Tan F & Chi CW (1982) Active domains in mung bean trypsin inhibitor Sci Sin [B] 25, 160–167

24 Zhang Y, Luo S, Tan F, Qi Z, Xu L & Zhang A (1982) Complete amino acid sequence of mung bean trypsin inhibitor Sci Sin [B] 25, 268–277

25 Tan FL, Shi QL, Wang LX & Chi CW (1984) Studies

on the mung bean trypsin inhibitor: reduction and reox-idation of the disulfide bonds of Lys active fragment Sci China Ser B-Chem 27, 918–925

26 Li Y, Huang Q, Zhang S, Liu S, Chi C & Tang Y (1994) Studies on an artificial trypsin inhibitor peptide derived from the mung bean trypsin inhibitor: chemical synthesis, refolding, and crystallographic analysis of its complex with trypsin J Biochem 116, 18–25

27 Lin G, Bode W, Huber R, Chi C & Engh RA (1993) The 0.25-nm X-ray structure of the Bowman–Birk-type inhibitor from mung bean in ternary complex with por-cine trypsin Eur J Biochem 212, 549–555

28 Wilson KA & Chen JC (1983) Amino acid sequence of mung bean trypsin inhibitor and its modified forms appearing during germination Plant Physiol 71, 341–349

29 Bendtsen JD, Nielsen H, von Heijne G & Brunak S (2004) Improved prediction of signal peptides: SignalP 3.0 J Mol Biol 340, 783–795

30 Tan F, Lo SS, Chi CW, Xu L & Zhu D (1981) Studies

on the mung bean trypsin inhibitor Characterization of the N-terminal active fragment Acta Biochim Biophys Sin (Shanghai) 13, 407–416

31 Clementea A & Domoney C (2006) Biological signifi-cance of polymorphism in legume protease inhibitors from the Bowman–Birk family Curr Protein Pept Sci 7, 201–216

32 Domoney C, Welham T, Sidebottom C & Firmin JL (1995) Multiple isoforms of Pisum trypsin inhibitors result from modification of two primary gene products FEBS Lett 360, 15–20

33 Kumar P, Sreerama YN & Gowda LR (2002) Forma-tion of Bowman–Birk inhibitors during the germinaForma-tion

of horsegram (Dolichos biflorus) Phytochemistry 60, 581–588

34 Lorensen E, Prevosto R & Wilson KA (1981) The appearance of new active forms of trypsin inhibitor in germinating mung bean (Vigna radiata) seeds Plant Physiol 68, 88–92

35 Wu JJ, Dai L, Lan ZD & Chi CW (1999) Genomic organization of three neurotoxins active on small con-ductance Ca2+-activated potassium channels from the scorpion Buthus martensi Karsch FEBS Lett 452, 360–364

36 Nielsen JS, Buczek P & Bulaj G (2004) Cosolvent-assisted oxidative folding of a bicyclic alpha-conotoxin ImI J Pept Sci 10, 249–256