THE ROLE OF FERRIC IRON UPTAKE REGULATOR (FUR) PROTEIN ON IRON REGULATION IN COXIELLA BURNETII

← The Role of Ferric Iron Uptake Regulator Fur Protein in Iron Regulation in Coxiella burnetii April 2006 Mary Jeanell Wilson Department of Biochemistry Texas A&M University Fellows Advi

Submitted to the Office of Honors Programs

& Academic Scholarships Texas A&M University

In partial fulfillment of the requirements of the

UNIVERSITY UNDERGRADUATE

RESEARCH FELLOWS

April 2006

Major: Biochemistry

A Senior Honors Thesis

by MARY JEANELL WILSON

Submitted to the Office of Honors Programs

& Academic Scholarships Texas A&M University

In partial fulfillment for the designation of

UNIVERSITY UNDERGRADUATE

RESEARCH FELLOWS Approved as to style and content by:

← The Role of Ferric Iron Uptake Regulator (Fur) Protein in Iron

Regulation in Coxiella burnetii (April 2006)

Mary Jeanell Wilson Department of Biochemistry Texas A&M University

Fellows Advisor: James E Samuel Department of Microbial and Molecular Pathogenesis

Coxiella burnetii is a gram negative, obligate intracellular bacterium It is the

etiologic agent of Q fever in a variety of species including livestock, humans and arthropods The bacterium infects the monocytes of its host and is encapsulated in the phagolysosome, an acidic vacuole meant to kill the bacterium, where it survives

and replicates C burnetii must be able to acquire all the nutrients necessary for

survival within this acidic environment In all but one species of bacteria, iron has been shown as necessary for replication as is serves as a cofactor for many cellular processes However, iron concentration must be maintained as a delicate balance Too little iron and replication is impeded, while too much iron initiates the

production of oxygen radicals which are fatal to the cell Ferric iron Uptake

Regulator (Fur) is responsible for the regulation of iron acquisition genes in many gram negative bacteria Fur acts as a transcriptional repressor of iron regulated genes These genes have a sequence within their promoter region called the “Fur box” that binds to the Fur protein when the protein is also bound to its co-repressor,

Fe2+ In E coli, Fur has been found responsible for the regulation of over 30 genes Previous work showed that C burnetii has a functional fur gene We hypothesize that C burnetii genes that contain promoters with a highly conserved consensus sequence are part of a Fur regulon Our goal is to characterize this regulon Nineteen putative Fur boxes were identified in C burnetii Fifteen of these were cloned into

the pBlue plasmid expressing beta-galactosidase These plasmids were then

co-transformed with a plasmid expressing Fur into an E.coli fur deletion strain The

β-galactosidase assay was then used to test promoter activity Eleven of these

promoters were evaluated Three promoters, for open reading frames CBU0970,

CBU0769 and feoB were found to be repressed in the presence of iron We predict that although a Fur regulon is present in C burnetii, it includes only a limited set of

genes

I would like to dedicate this work to my family for all their support and diversionthroughout the course of my efforts

ACKNOWLEDGEMENTS

I would like to acknowledge Dr Samuel for his willingness and guidance as my advisor and I would like to especially acknowledge Heather Briggs for teaching me all the techniques needed for the following work as well as thank her for her

encouragement and troubleshooting expertise Thank you to all of the Samuel Lab for your support and laughter!

This research was performed while on appointment as a U.S Department of Homeland Security (DHS) Scholar under the DHS Scholarship and Fellowship Program, a program administered by the Oak Ridge Institute for Science and

Education (ORISE) for DHS through an interagency agreement with the U.S

Department of Energy (DOE) ORISE is managed by Oak Ridge Associated

Universities under DOE contract number DE-AC05-00OR22750 All opinions expressed in this paper are the author's and do not necessarily reflect the policies and views of DHS, DOE, or ORISE."

TABLE OF CONTENTS

Page

ABSTRACT……… iii

DEDICATION……… …….……… v

ACKNOWLEDGEMENTS……… … vi

TABLE OF CONTENTS……… … vii

LIST OF FIGURES……… … ix

LIST OF TABLES……… x

INTRODUCTION……… 1

Coxiella burnetii: Life in the Monocyte……… 2

Iron & Iron Regulation… ……… …… 4

Summary & Objectives:… ……… … ……… 8

MATERIALS & METHODS……… 10

RESULTS & DISCUSSION……….……… 18

Cloning Results……… 18

Beta-Galactosidase Assay Results……… 23

Real Time PCR Results……… 35

Conclusions……… 39

Future Work……… 40

REFERENCES……… 42

CURRICULUM VITA……….… 44

LIST OF FIGURES

1 Schematic of Fur-Fe2+ Transcriptional Repression 7

3 C burnetii Fur Complementation of an E coli fur deletion 20

5 Comparison of C burnetii putative Fur Boxes to the E coli

2 List of all plasmids used in Cloning and Beta-Galactosidase Assays 15

3 Beta-Galactosidase Assay Results in Miller Units 26

Many pathogens are known to live within a host’s cellular compartments These bacteria successfully elude the host’s immune system in various ways Much research has been done to elucidate those mechanisms by which these bacteria override the host’snormal activity to survive as well as acquire the nutrients needed for replication and

proliferation Coxiella burnetii is one of these pathogens, residing in the very

compartment meant to destroy intracellular organisms

Coxiella burnetii is a gram negative, obligate intracellular bacterium It is the

etiologic agent of Q fever in a variety of species including livestock, humans andarthropods It manifests in two forms: acute and chronic disease Acute disease patientsusually exhibit flu like symptoms, including debilitating fever, headache, myalgia andchills, 1-2 weeks post infection The chronic form may manifest as hepatitis orendocarditis with significant mortality The disease is endemic in some South Americancountries where livestock production is high The livestock act as reservoirs of thebacteria and individuals working with the livestock are easily infected Disease is

1 This thesis follows the style and format of the American Society of Microbiology Journals

generally acquired by aerosol infection and is represents an occupational hazard.Resolution of acute infection can be enhanced by treatment with doxycycline whilechronic disease has a poor prognosis with the best outcome through long termcombination therapy of doxycycline plus chloroquine

Characteristics of C burnetii infection including the debilitating symptoms and

aerosol route of infection have made the bacterium a prime candidate for a biological weapon Many groups have worked to develop a mechanism for releasing the bacterium

into the air of enemy troops This work has led the US government to label C burnetii as

a Category B select agent This classification along with the widespread problem of Q fever in developing countries has led to a call for research to find a vaccine to prevent

the spread of the disease and to relieve the threat C burnetii poses as a biological

weapon Basic research is now in progress to understand the mechanisms of C burnetii

infection in order to uncover better vaccine options

Coxiella burnetii: Life in the Monocyte

Upon infection, the bacterium is engulfed by monocytes of the host andtrafficked to the phagolysosome The phagolysosome is an acidic vacuole meant to kill

the bacterium However, instead of being destructive, this vacuole actually activates C.

burnetii (Hackstadt 1983) The host actively removes several necessary nutrients from

the bacterium as well as lowering the pH in the vacuole However, as the pH is lowered,

instead of being killed, C burnetii actually begins to replicate It is undefined how this

bacterium evades the defenses of the host and attains all the nutrients necessary tosurvive Many studies have been conducted in recent years to determine the ways in

which C burnetii achieves this feat For example, Shannon, et al (2005) demonsdtrated that the presence of liposaccharides on virulent C burnetii may mask the ligands of tol-

like receptors from recognition by dendritic cells This may allow the bacterium to entermonocytes without triggering an immune response

Because C burnetii is an intracellular pathogen, infection would be predicted to

activate a Type I (Th1) or cell-mediated response in which interferon-gamma (IFN-γ)activates the infected monocytes to destroy the pathogen The Th1 response can besuppressed by Interleukin-10 (IL-10) Ghigo et al (2001) found that during chronic

Coxiella infection, IL-10 production is increased as high as tenfold while TNFα production is suppressed This combination of events may culminate in the ability of C burnetii to evade destruction by countering the protective cell-mediated response with

increased IL-10 production

Ghigo et al (2002) later suggested that within an infected monocyte that is notactivated, the phagolysosomes containing the bacterium do not mature This lack ofmaturation may allow the pathogen to evade destruction However, the addition of IFN-γcounteracted this subterfuge activity, activating the monocyte and allowing maturationand alkalization of the phagosome This alkalization could be responsible for the death

of the organism as it is active only within an acidic environment It should be noted thatthis mechanism has not been confirmed by other investigators

Iron & Iron Regulation

Regardless of the mechanism by which it evades destruction, C burnetii must be

able to acquire all the nutrients necessary for survival within this acidic environment Inall but one species of pathogenic bacteria, iron has been shown to be necessary forreplication as is serves as a cofactor for many cellular processes Because they are often

in harsh environments, such as the potentially fatal phagolysosome, nutrients are scarceand must be scavenged from the host The ways by which iron is obtained by otherintracellular pathogens has been studied by numerous researchers

Escolar et al (1999) describes three major mechanisms by which iron isscavenged One mechanism, the use of siderophores, is common within environmental

bacteria Siderophores are extracellular ferric chelators that the organism releases into itssurroundings The chelator binds iron which diffuses back to the bacteria with its cache.This mechanism was later found to work similarly in many biological environments.Another scavenging mechanism is the expression of iron transporters such as FeoBwhich act as a pump to move iron into vacuole where the bacterium subsists The lastmajor mechanism of iron acquisition occurs by the complexing of the host’s ironresources In this way, the pathogen captures iron from the iron rich molecules in the

host such as transferrin or hemoglobin While studying iron acquisition in Legionella, (the phylogenetically closest relative to Coxiella) it was found that activated

macrophages controlled infection by downregulating transferrin receptors by up to 73

percent By corralling the iron stores, the macrophage is able to prevent Legionella from

acquiring the iron necessary for its survival

One of the problems associated with these iron acquisition methods is that toomuch iron can cause the production of highly reactive oxygen radicals by Fentonchemistry In order to prevent radical production while still obtaining the iron needed formetabolism, bacteria have developed ways of regulating iron acquisition genes such as

feoB Delany et al (2001) demonstrates that one of these regulatory methods includes the

use of the ferric uptake regulator (Fur) protein The Fur protein has been demonstrated towork in various bacteria by binding intracellular iron as well as a sequence in thepromoter region of Fur-Fe2+ regulated genes These genes are primarily iron acquisitiongenes that are down regulated when iron levels within the cell are sufficient Fur proteinbinds the promoter only when sufficient iron is present within the cell This bindingcauses a conformational change that prevents transcription of the regulated gene, thusacting as a repressor When iron levels fall, Fe2+ dissociates from the Fur protein which

then falls off the promoter and restores transcription See Figure 1 In previous work, C.

burnetii was shown to express Fur at levels detectable by Western Blot and the fur gene was shown to complement an E coli fur deletion

Figure 1 Schematic of Fur-Fe 2+ Transcriptional Repression.

Diagrammatic model of transcription of a Fur regulated gene in (A) the presence of and (B) the absence of iron With the addition of iron, transcription of the gene is repressed

as the Fur-Fe2+ complex binds to the Fur Box and impedes RNA polymerase

Summary & Objectives:

Coxiella burnetii is a compelling mystery to scientists This bacterium not only

survives but replicates in the compartment meant to kill invading pathogens This anomaly has led many researchers to characterize the mechanisms by which nutrients areacquired and destruction evaded Understanding these mechanisms could lead to better drug design or vaccine production targeting key virulence factors For example, a

vaccine could charge the immune system to recognize the very liposaccharides this organism may use for evasion Drugs that destroy the organism’s ability to acquire the necessary nutrients, such as iron, without harming the host could revolutionize treatmentoptions These possibilities could eventually culminate in a drastic decrease in the

virulence of C burnetti, creating much safer working conditions for individuals in the

cattle industry

The mechanisms of iron acquisition and regulation within the pathogen Coxiella burnetti were studied in an attempt to reveal a model of this activity Through the

understanding of iron use in the cell, it may be possible to procure a new arsenal of

vaccines and treatment for C burnetti infection, perhaps more effective than those in use

currently

Using the knowledge that the Fur-Fe2+ complex works in other bacteria by binding to the promoter regions of genes containing a Fur-box to repress transcription,

we studied putative iron regulated genes in Coxiella burnetii C burnetti promoters with

a potential Fur box were studied by transcriptional fusion experiments in a heterologous system under iron limiting and iron replete conditions with expression of beta-

galactosidase as the readout Those promoters that showed regulation of lacZ in the

presence of iron and Fur protein were considered Fur regulated and studied at the RNA

level RNA was isolated from Phase II C burnetti grown on axenic medium The RNA

was converted to cDNA by reverse transcriptase and analyzed by quantitative RT-PCR The objective of the first stage of experiments is to determine whether the proposed Fur boxes are capable of transcriptional regulation by Fur The second stage will reveal whether the gene is being actively transcribed in the bacterium and confirm repression identified in the heterologous expression systems

MATERIALS & METHODS

The first step in analyzing a Fur regulon within a species is to identify genes thatmay contain a Fur box in their promoter A bioinformatics screen of the bacterialgenome was performed to search for sequences within promoters containing at least 50%

homology with the known E coli Fur box consensus (Figure 2.) The 19 promoters

found by this method were then further characterized to determine whether Fur protein isacting as a repressor of the genes containing promoters with putative Fur Boxes

Figure 2 Fur Box Consensus Sequence

This figure contains the Fur Box consensus of 33 different bacteria The y-axis is a measure of the relative frequency of all four bases at each position

Cloning

Primers for the 19 promoters containing putative Fur Boxes were designed using

MacVector and produced by Integrated DNA Technologies Laboratory (Table 1) PCR

was performed using 23 uL PCR Supermix with High Fidelity Taq Polymerase

(Invitrogen), 0.5uL each of 10mM forward and reverse primer, and 1uL C burnetii

purified genomic DNA for a total of 25uL per reaction Negative controls contained 1uL either forward or reverse primer instead of 0.5uL both primers [94-1m |94-1m 50-1m 72-7m|36 72-6m]

10uL PCR product were run on 1% agarose gel in 6x buffer with a 100bp

standard marker to ensure amplification These amplicon products were then ligated to TOPO pBlue vector The plasmids were transformed into TOP10 chemically competent

E coli The Invitrogen TOP10 protocol for ligation was followed using 4uL of PCR

product Carbinomycin plates were employed to select for positive transformants

Successful colonies were grown in 5mL Luria Broth + Carb50 at 37C overnight with shaking and then plasmids were isolated according to the Eppendorf Fast Plasmid Miniprep Protocol

Plasmids were digested with HindIII 37C for 1hour to digest plasmid and

separate cloned inserts The digest were run on a 1% agarose gel to confirm the presence

of an insert Positives clones were analyzed by Texas A&M Gene Technologies Lab by sequencing to confirm orientation of insert.

Table 1 Putative Fur Box Primers.

List of all primers used for cloning of promoters containing putative Fur boxes Primers

were designed using MaxVector and produced by Intergrated Gene Technologies

Laboratory

Beta-Galactosidase Assay

Cloned plasmids were electroporated into either BN4020 pMH15 or BN4020

pNP104 electrocompetent cells to form two plasmid heterologous systems (Table 2)

Successful systems were selected by plating on the appropriate antibiotic plates

CBU0216 forward ACTGTAAGTCGTCATCACACTGTCCBU0216 reverse CGCCCTCATCGTCTAAATCGCBU0280 forward TGAATGGTTGCGTATTGCCGCBU0280 reverse ACGAGATAGCCGATTGGACACCCBU0395 forward GCGCGCGCCATCGTT

CBU0395 reverse CCATCACCAGCGACCTTAACACBU432 forward TTCGCTACCATCCGCCCTTTAG

CBU0769 reverse AATCATACGACTTCTGCGTGGCCBU0968 forward TCATTTACCTCCGATCCTATTGCCBU0968 reverse CCAACACTTTAACTCCGCGTTTCBU1106 forward GCGAGATCAAACCCGAACA

CBU1477 forward TTTGTAATGGTGAACGACCTCAACCBU1477 reverse GAACGCGCAAAACCTCTTG

CBU1493 forward CACCACACGTCGCATCCTTACBU1493 reverse GCCCACAGCAGGACCTAGATATCBU1556 forward TTTGCTGGCGCTTTGTACTTACCBU1556 reverse TCGATAGCGCCTTTTTCCACBU1695 forward TTCAGACCCTGCCAAAATGATGCBU1695 reverse TCGTTTCCCTTCAGTCGCTG

The β-galactosidase assay was performed as described by Miller et al (1972) to

be used as a test of promoter activity A promoter region was cloned into the pBlueplasmid expressing β-galactosidase, an enzyme that normally cleaves lactose In theassay however, Ortho-nitrophenyl-β-D-galactopyranoside (ONPG) is used instead oflactose as the substrate for β-galactosidase The promoter containing plasmid was

transformed into BN4020, a fur deletion strain of E coli, and grown under differing

conditions After growing the samples to the same OD600, the cells are lysed and thecolorless ONPG substrate is added β-galactosidase hydrolyzes ONPG and produces acolor change proportional to the amount of the enzyme expressed This expression isconsidered proportional to the promoter activity Miller (1972) demonstrated in yeastthat the β-galactosidase assay is a quantitative measurement This means that the assayassigns a numerical value to the amount of repression provided by Fe-fur regulation

Colonies were grown in 5mL Luria broth with antibiotics at 37°C for overnight These cultures were then subcultured in 5mL media with either 50uM ferrous chloride or200uM deferoxamine, an iron chelator until an OD600 of 0.45-0.55 was reached and the assay performed

Plasmids/Strain Description Source

pMH15 pACYC184 with E coli fur

pBlue TOPO TA cloning vector, promoter trap Invitrogen

pNP104 pACYC184 with complete C burnetii fur This work

Table 2 List of all plasmids used in Cloning and Beta-Galactosidase Assays

The table lists all plasmids and bacterial strains used in the Cloning and

Beta-Galactosidase portions of this work as well as a description and their sources

Real-Time PCR

The second objective of this proposal, the study of RNA transcript levels of each

gene, was studied by extracting RNA from cultures of Phase II C burnetti (nonvirulent

form) containing various concentrations of iron and using real time PCR to measuretranscriptional levels within each system The total RNA in each sample was converted

to cDNA using reverse transcriptase The cDNA is then analyzed in a gene specific basisusing Real-Time PCR This assay is relatively new technology in the laboratory and has

frequently cited in recent literature as it allows the quantitative evaluation of multiplegenes of interest Nielsen and Boye (2005) demonstrated that RT-PCR can be used to

analyze the expression of genes under iron-replete conditions in Actinobacillus pleuropneumoniae This assay can theoretically be used to evaluate genes in any

bacterium that are transcribed at different rates when iron availability is altered Phase II

is a strain of C burnetti that can be worked with in a normal laboratory setting (BSL2)

as it lacks virulence in animals compared with Phase 1, a select agent, requiring BSL3containment

C burnetti ,being an obligate intracellular pathogen, is unable to replicate outside

of a host, however, in an acid activation buffer, it is metabolically active (Howe, 1999) Phase II cultures were purified from a persistently infected L929 macrophage-like cellline 200ug of bacteria were incubated at 37°C for 2 hours in 1mL of acid activationbuffer (2x RPMI Amino Acid Solution, 2x L-glutamine, 2x pyruvate, 2x RPMI VitaminSolution, 98mM KH2PO4, 270mM KCl, 26.8mM NaCl, 40mM MgCl, 0.2mM glucose,2x spermine, 2x erythritol, 2x para-aminobenzoic acid, 2x NADH, 2x adenine, 2xhypoxanthine, 2x uracil) (Beare, personal communication) with 0uM, 10uM or 50uMiron sulfate After incubation, RNA extraction was performed using the Quiagen RNeasy

Kit with the addition of the QiaShredder Column to remove excess proteins Afterextraction, the samples were treated twice with DNase according to the Ambionprotocol Reverse transcription PCR was then performed to form cDNA 0.25ug ofRNA was used in each 25uL reaction Every sample was run with and without reversetranscriptase to account for any DNA contamination [25-10m 48-30m 95-5min]

Real Time primers were designed using Primer Express and produced by

Integrated DNA Technologies Laboratory Controls included com1 and no template

controls and the reverse transcriptase negative samples Each reaction contained 12.5uLSYBR green solution, 8uL ddH20, 1 uL or each primer and 2.5uL template or water

RESULTS & CONCLUSIONS

Cloning

The genomic screen searched for sequences with no less than 50%

homology with the E coli Fur box consensus in promoter regions of genes The E coli consensus was used because no work has been done to elucidate a C burnetii consensus and C burnetii Fur has been shown previously to complement an E coli Fur deletion.

(Figure 3) Promoter regions were defined as regions that were no more than 100 base

pairs from a translational start codon, which signals the mRNA polymerase to begin