Báo cáo Y học: Molecular mechanisms underlying SHP-1 gene expression potx

We also show that a 12-bp repeat in the distal SHP-1 promoter, which directs ISHP-1 expression, is of functional relevance as deletion of one copy of this E-box-containing 12-bp repeat r

Molecular mechanisms underlying SHP-1 gene expression

Hing Wo Tsui1, Kathleen Hasselblatt2, Alberto Martin3, Samuel Chi-ho Mok2and Florence Wing Ling Tsui1,4

1 Division of Cellular & Molecular Biology, Toronto Western Research Institute, University Health Network, Toronto, Ontario, Canada; 2 Laboratory of Gynecologic Oncology, Department of Obstetric Gynecology and Reproductive Biology, Brigham and Women’s Hospital, Dana-Farber Harvard Center, Boston, Massachusetts, USA;3Department of Cell Biology, Albert Einstein College

of Medicine, Bronx, New York, USA; 4 Department of Immunology, University of Toronto, Toronto, Ontario, Canada

SHP-1, a protein-tyrosine phosphatase with two

src-homology 2 domains, is expressed predominantly in

hematopoietic and epithelial cells and has been implicated in

numerous signaling pathways as a negative regulator Two

promoters direct the expression of human and murine

SHP-1, and two types of transcripts (I) and (II) SHP-1, are

initiated from each of these promoters The cDNA

sequences of (I)SHP-1 and (II)SHP-1 are identical except

in the 5¢ untranslated region and in the first few coding

nucleotides In this report, we show that promoter usage is

similar in mouse and human hematopoietic cells, but

different in epithelial cells In human epithelial cells, only

(I)SHP-1 transcripts were expressed In addition,

4b-phorbol 12-myristate 13-acetate up-regulates human

(I)SHP-1transcript expression in SKOV3 cells (an ovarian

cancer cell line) Indirect evidence suggests that nuclear factor-jB might play a role in this induction We also show that a 12-bp repeat in the distal SHP-1 promoter, which directs (I)SHP-1 expression, is of functional relevance as deletion of one copy of this E-box-containing 12-bp repeat resulted in a significant decrease in promoter activity Elec-trophoretic mobility shift assays and supershift experiments showed that the upstream stimulatory factors USF1 and USF2 hetero-dimerize and interact with this 12 bp repeat Our results suggest that USFs which have antiproliferative functions might regulate the expression of SHP-1, which itself is predominantly a negative growth regulator Keywords: cis elements; distal promoter; NFjB; promoter usage; USFs

Phosphorylation of proteins serves to alter their activity,

providing a simple and mostly reversible change in

molecular function The regulation of tyrosine

phosphory-lation is important in the control both of normal cellular

processes including cell growth, cell cycle regulation, and

differentiation, and of pathological events such as malignant

transformation Protein tyrosine kinases and phosphatases

are the key players in the regulation of protein tyrosine

phosphorylation Among the known protein tyrosine

phosphatases, SHP-1 and SHP-2 are distinguished by the

presence of two tandem src-homology 2 domains

Src-homology 2 domains interact with phospho-tyrosine

resi-dues in many growth factor receptors and thus play an

important role in directing the effects of tyrosine

phos-phorylation [1] We [2] and others [3] showed that motheaten

mice have mutations in the SHP-1 gene These mutant mice

thus provide insight into the role of SHP-1 Motheaten mice

die prematurely and have characteristics of both

immuno-deficiency and autoimmunity [4] From analyses of

moth-eatenmice and other work in cell lines, SHP-1 functions

predominantly as a negative regulator in hematopoietic

signaling pathways [5]

SHP-1 is expressed predominantly in hematopoietic and epithelial cells [6] It has recently been shown that localiza-tion of SHP-1 differs between hematopoietic and epithelial cells (i.e cytoplasmic in hematopoitic cells vs nuclear in epithelial cells) [7] Two promoters direct the expression of human [8] and murine SHP-1 [9], and two types of transcripts are initiated from the promoters Transcripts that contain the 5¢-most exon [termed (I)SHP-1] encode SHP-1 with the initial amino acid sequences being MLSRG

as compared to the MVR sequence encoded by transcripts that contain the 3¢ exon 1 [termed (II)SHP-1] As there are minor to no enzymatic differences between (I) and (II) isoforms [9], we favor the view that different forms have arisen because of a need to regulate SHP-1 transcription using distinct promoters Very little is known regarding the functionality of the two promoters and their usage in different cell types In this study, we assessed the generation

of (I) and (II) SHP-1 transcripts in various human and mouse cell lines and carried out functional deletional analyses of the distal promoter of human SHP-1 in epithelial cell lines

M A T E R I A L S A N D M E T H O D S

RT-PCR Reverse transcription of total RNA from cell lines, prepared

by the Trizol (BRL) method, was carried out as described previously [2] The primers (I)SHP-1-90-5¢ (5¢-AA CAGCTGTGCCACTCGATTG-3¢) and SHP-1-1859-3¢ (5¢-CCACAGGTCTCAGTCTATCGGGT-3¢); (II)SHP-1-74-5¢ (5¢-GTGCCTGCCCAGACAAACTG-3¢) and SHP-1-1859-3¢ were used in RT-PCR of (I)SHP-1 and

Correspondence to F W L Tsui, Toronto Western Hospital,

Mc14-417, 399 Bathurst Street, Toronto, Ontario M5T 2S8, Canada.

Fax: + 1 416 603 5745, Tel.: + 1 416 603 5904,

E-mail: ftsui@uhnres.utoronto.ca

Abbreviations: bGal, b-galactosidase; EMSA, electrophoretic mobility

shift assay; HPRT, hypoxanthine guanine phosphoribosil transferase

gene; PMA, 4b-phorbol 12-myristate 13-acetate.

(Received 24 October 2001, revised 10 April 2002,

accepted 7 May 2002)

(II)SHP-1transcripts, respectively Ten-fold serial dilution

of the RTproducts were used to amplify either (I)SHP-1 or

(II)SHP-1transcripts The RT-PCR products were

separ-ated by electrophoresis through 0.7% agarose gels, blotted

to nitrocellulose and probed with a 32P-labeled DNA

fragment containing sequences encoding the phosphatase

domain of SHP-1 and autoradiographed The intensity of

bands was measured by densitometry on an imager

(Bio-Rad Fluor-STMmulti-imager)

Electrophoretic mobility shift assay (EMSA)

Nuclear extracts were prepared from cell lines [10] Protein

concentrations of the nuclear extracts were determined

using the Coomassie protein assay reagent (Pierce) Five

lg of nuclear extracts were mixed with herring DNA

(BMC) and labeled oligonucleotide with and without

competitor DNA (500-fold excess) in a buffer containing

25 mM Tris/HCl pH 7.5, 50 mM KCl, 0.6 mM

dithiothre-itol, 1 mM EDTA, 0.5 mM spermidine, 12% glycerol for

20 min at room temperature For supershift experiments,

the nuclear extracts were incubated with 2 lg of the

antibody for 30 min at room temperature before adding

the labeled oligonucleotide The reaction was subjected to

electrophoresis on a 6% native polyacrylamide gel in Tris/

glycine buffer (25 mMTris pH 7.7, 200 mMglycine, 1 mM

EDTA) The gels were dried and exposed to

phospho-screens and the images were visualized on a

phosphoi-mager (Bio-Rad) Quantitation of bands was carried out

using the QUANTITY-ONE software Antibodies to the

upstream stimulatory factors USF1, USF2, Max, NFjB

p50 were from Santa Cruz Biotech Inc.; antibody to

NFjB p65 (RelA) was from Upstate Biotechnology

Generation of reporter constructs

An 845-bp BamHI–PvuII DNA segment containing the

(I)SHP-1promoter and 83 bp of the 5¢ UTR [without the

(I)SHP-1 AUG] was isolated from a SHP-1-containing

cosmid clone (LL12NCOIN 143H6, a gift from P

Mary-nen, Leuven, Belgium) and inserted upstream of the

luciferase reporter gene in the pGL2-Basic vector (Promega)

(construct A) For generation of construct B, a 420-bp KpnI

segment was removed from construct A, followed by

re-circularization of the vector For generation of construct

C, a 610-bp SmaI segment was removed from construct A,

followed by re-circularization of the vector In the 12 bp

repeat sequences, there is an SstI site in each of the 12-bp

segments By deleting the 12 bp SstI–SstI fragment in either

construct A or B and re-circularizing the constructs, one

copy of the 12-bp repeat was removed from each of the two

constructs to form constructs A)12 bp and B)12 bp

Analysis of promoter function

SKOV3 cells were cotransfected with the (I)SHP-1

pro-moter–luciferase constructs and pSV2bGal (pCH110) by

lipofection using Fugene 6 (Roche Molecular Biochem)

Forty-eight hours after transfection, fractions of each cell

extract were used for the b-galactosidase (bGal) [11] and

luciferase [12] assays The conditions used for the luciferase

assay were within the linear range of the assay for the

promoters tested in this study Each construct was tested in

three different transfection experiments, with triplicates for each experiment

R E S U L T S

Differential expression of SHP-1 isoform transcripts

in human vs murine cell lines

In mouse as well as in human, SHP-1 proteins are detected

in both hematopoietic and epithelial cells As the two SHP-1 protein isoforms only differ in the first few amino acids, it is difficult to distinguish the two protein isoforms Thus, it is unclear whether the SHP-1 proteins are translated from the (I)SHP-1 or (II)SHP-1 transcripts or both To assess whether both SHP-1 promoters are transcriptionally active

in hematopoietic and epithelial cells, we used RT-PCR to specifically amplify either the (I)SHP-1 or (II)SHP-1 transcripts Expression of (I)SHP-1 and (II)SHP-1 tran-scripts were assessed using the primers (I)SHP-1-90-5¢ and SHP-1-1859–3¢ vs (II)SHP-1-74-5¢ and SHP-1-1859–3¢, respectively We determined the relative abundance of the two isoform transcripts using a quantitative RT-PCR assay

We previously [13] showed that the (I)SHP-1 and (II)SHP-1 isoforms were amplified to a similar extent using isoform specific primers, as mentioned above As explained in the legend to Fig 1, a serial dilution of the initial RTreaction mixture was used to amplify type (I)SHP-1 and (II)SHP-1 cDNAs Blots of the electro-phoresed RT-PCR products were probed with P32-labeled sequences of the SHP-1 phosphatase domain, and the intensity of the autoradiographed bands was measured by densitometry We analysed six human hematopoietic cell lines (K562, Raji, HL60, BL-JC, CEM and U937) and six human epithelial cell lines (HeLa, CAOV3, SKOV3, MDA453, Calu 1 and HT1080) as well as eight mouse hematopoietic cell lines (BW5147, M1, NFS-5C1, J774, IC21, 70Z/3, J558L and A20) and four mouse epithelial cells (Y1, L cells, LA-4 and MMT060562) (Table 1) In both human [8] and mouse SHP-1 [9], alternative transcripts (both longer and shorter than the major transcripts) have been reported and except for one human splice variant [14], most of these variant transcripts contain premature stop codons ([9] and our unpublished results for the human variants) and therefore cannot be translated into functional phosphatases Thus, in this study, we only quantified the major transcripts Fig 1 shows representative profiles of SHP-1isoform transcripts expressed in both human and mouse cell lines and the relative abundance of these isoforms are summarized in Table 1 In most human (4/6) and mouse (6/8) hematopoietic cell lines, both SHP-1 isoform transcripts were detected However, some cell lines expressed only one of the two isoforms (Table 1) Of the cell lines that expressed both isoforms, the ratio of (II)SHP-1

to (I)SHP-1 transcripts ranged from 0.3 : 1 to 63 : 1 (human) and 28 : 1 to 110 : 1 (mouse) Similarly, in mouse epithelial cell lines (3/4), both isoform transcripts were present, although the ratio of (II)SHP-1 to (I)SHP-1, which ranged from 1.3 : 1 to 2 : 1 is much lower than that found in hematopoietic cells However, in human epithelial cell lines (5/6), only (I)SHP-1 transcripts were detected

As all the cell lines used for this study are transformed, we asked whether the SHP-1 promoter usage is similar in untransformed hematopoietic cells For human, we used

tonsillar Tcells grown in the presence of

phytohemagglu-tinin (TON-phytohemaggluphytohemagglu-tinin) and for mouse, we used

splenic Tcells as well as thymus In all three cases,

both (II)SHP-1 and (I)SHP-1 transcripts were detected,

with the former isoform being the predominant species

(Table 1)

(I)SHP-1 transcripts were up-regulated by 4b-phorbol

12-myristate 13-acetate (PMA) in HL60 and SKOV3 cells

As human epithelial cells expressed only (I)SHP-1

tran-scripts, these cells (such as SKOV3, an ovarian cancer cell

line) are ideal for the study of the distal promoter function of

SHP-1 We first wished to identify agent(s) that can

modulate the expression of (I)SHP-1 transcripts Nuclear

run-on experiments showed that PMA treatment increased

SHP-1transcription in HL60 cells [15] However, it is unclear

which promoter is responsible for the increase in SHP-1

transcription We used RT-PCR to assess the relative

abundance of (I)SHP-1 and (II)SHP-1 transcripts

[nor-malized to hypoxanthine guanine phosphoribosil transferase

(HPRT)] in untreated vs PMA treated (48 and 72 h) HL60

cells We observed that the relative levels of (I)SHP-1 and

(II) SHP-1 transcripts were up-regulated 48-fold and

fivefold, respectively, when the cells were treated with

PMA (Fig 2A) SHP-1 proteins were increased

 5-fold in PMA treated HL60 cells (data not shown)

Because HL60 is a hematopoietic cell line, we asked whether

PMA induces a similar effect in epithelial cells We treated

SKOV3 cells, which expressed only (I)SHP-1 transcripts,

with PMA and compared the relative abundance of this

isoform transcript in treated vs untreated cells after

normalization with HPRT We found a lower but significant increase in the relative level of (I)SHP-1 transcripts (twofold

to fourfold) in PMA treated SKOV3 cells (Fig 2B) Thus, in both hematopoietic and epithelial cells, PMA can up-regulate the expression of (I)SHP-1 transcript

Role of NFjB in the expression of(I)SHP-1 transcripts

As we found that PMA up-regulates the expression of human (I)SHP-1 transcripts (Fig 2), we were interested in identifying potential activator(s) of the human distal SHP-1 promoter PMA is a known nonphysiological activator of NFjB In the distal promoter of human SHP-1, there is a putative NFjB site at )314 (GGGATTTTCC) We first asked whether NFjB proteins can bind to this putative NFjB consensus sequence We carried out EMSAs using SKOV3 nuclear extracts and a double-stranded oligonucle-otide containing this consensus sequence as a probe We detected two specific DNA–protein complexes (Fig 3, lane 2), both of which can be super-shifted using anti-NFjB Ig (p50) and anti-NFjB Ig (p65) (Fig 3, lanes 3 and 4) If (I)SHP-1transcription is increased because PMA activated NFjB, we would expect to find more NFjB binding to this NFjB site located in the distal SHP-1 promoter We thus carried out EMSA using equal amounts of untreated and PMA-treated SKOV3 nuclear extracts As expected, we found that nuclear extracts from PMA treated SKOV3 cells had a 4–5-fold higher NFjB activity than those from untreated cells (Fig 3, compare lane 8 with lane 6) These data suggest that the up-regulation of (I)SHP-1 transcrip-tion by PMA is mediated via the NFjB site in the distal promoter of SHP-1

Fig 1 Relative abundance of (I)SHP-1 and (II)SHP-1 transcripts in human vs mouse cell lines Raji is a Burkitt’s Lymphoma cell line (i.e hematopoietic); HeLa and HT1080 are human epithelial cancer cell lines BW5147 is a mouse T-cell line and L cell are a mouse epithelial cell line RNA from the cell lines were reverse transcribed, and serial dilutions (shown below each lane) of the RTmixture were used in PCR for (I)SHP-1 with primer pair (I)SHP-1-90-5¢ and SHP-1-1859-3¢, or (II)SHP-1 with primer pair (II)SHP-1-74-5¢ and SHP-1-1859-3¢ The RT-PCR products were separated by electrophoresis, transferred to nitrocellulose and probed with 32 P-labeled sequences of the phosphatase domain for SHP-1 Arrows denote the SHP-1 transcripts which are translatable into proteins [9,13] Densitometry was performed on this species of SHP-1 transcripts Bottom panels: Schematics showing the generation of (I)SHP-1 vs (II)SHP-1 transcripts from the SHP-1 gene.

Table 1 Relative abundance of (II) vs (I)SHP-1 transcripts in human (A) and mouse (B) cell lines and untransformed cells.

(II)SHP-1 (I)SHP-1 Ratio(II) : (I)SHP-1 Human cells

Epithelial cell lines

Hematopoietic cell lines

Hematopoietic cells

TON-photohaemagglutinin 193 69 3 : 1

Mouse cells

Epithelial cells lines

Hematopoietic cell lines

Hematopoietic cells

Fig 2 Up-regulation of SHP-1 expression in PMA treated HL60 (A) and SKOV3 (B) cells Relative abundance of (I)SHP-1 and (II)SHP-1 transcripts in untreated or PMA treated cells was estimated by quantitative RT-PCR (as in Fig 1).

Functional deletional analyses of the distal promoter

of human SHP-1 in epithelial cells

To characterize further the distal promoter, we needed to

obtain a genomic segment containing the distal promoter

From a human SHP-1-containing cosmid clone

(LL12NCOIN 143H6), we isolated the 5¢ flanking region

upstream of the first exon of (I)SHP-1 We sequenced the

region 986 bp upstream of the transcription initiation site,

and the sequence was identical to the published one [8] To

test the functionality of the human SHP-1 distal promoter,

we generated three deletion constructs (A, B and C) which were adjoined to a luciferase reporter gene (Fig 4) These constructs contained different amounts of 5¢ flanking DNA and lacked the (I)SHP-1 AUG They were individually transfected into SKOV3 cells, and lysates were assayed for luciferase activities A bGal construct was cotransfected with each deletion construct and bGal activities were used to normalize the efficiency of each transfection The promo-terless vector, pGL2-basic (D), was included as a negative control The pGL2-control vector with both the SV40 promoter and enhancer (E) was included as a positive control As shown in Fig 4, maximal (I)SHP-1 activity was observed with construct A [845 bp of the (I)SHP-1 5¢ flanking region including 83 bp of 5¢UTR] Deletion construct B (425 bp 5¢ flanking region) and C (235 bp 5¢ flanking region) produced less luciferase activities in SKOV3 transfections (47% and 30% of construct A, respectively)

Identification of an activator(s) that binds to a 12-bp repeat

Located in both constructs A and B, about 190 bp upstream of the distal SHP-1 initiation site, is a 12-bp repeat As direct repeats in promoter regions usually represent important regulatory elements, we asked whe-ther this 12-bp repeat contributes to (I)SHP-1 promoter activity We generated two additional constructs: construct A)12 bp differs from construct A by 12 bp (one copy of the 12 bp repeat was deleted from construct A) and likewise construct B)12 bp differs from construct B by the same 12 bp Transfection studies using both sets of constructs (A vs A)12 bp and B vs B)12 bp; Fig 4) showed that deletion of one copy of the 12-bp sequences

in both cases resulted in a significant decrease in the luciferase activity Construct A)12 bp had 75% of construct A activity, and construct B)12 bp had only 16% of construct B activity (Fig 4) suggesting that an activator(s) binds to this 12-bp repeat The reasons for a much larger effect on construct B will be considered in the Discussion

Fig 3 EMSA and supershift analyses The NFjB site (T GT T AGG

GATTTCCTTA) from (I)SHP-1 promoter was used as a probe.

Lanes: 1 and 5, no nuclear extracts present in the reaction mix; lanes 2

and 6, two specific complexes (A and B) formed when the reaction mix

contains both nuclear extracts and labeled probe The lowest shifted

band is nonspecific, as it cannot be competed out with excess unlabeled

oligonucleotide in the reaction mix (lane 7); Both complexes A and B

were supershifted when either anti-NFjB Ig, p50 or p65 (Rel A) were

included in the reaction mix; lane 8, more complexes A and B

were formed when nuclear extracts from PMA treated SKOV3 cells

were used.

Fig 4 Schematic of the (I)SHP-1 deletion

constructs and luciferase activities of these

constructs in SKOV3 cells Constructs A, B

and C contain various lengths of (I)SHP-1

promoter region Construct D is promoterless

and was used as a negative control Construct

E is a luciferase construct driven by the

SV40 promoter and enhancer; it served as a

positive control Both copies of the 12-bp

repeat are present in constructs A and B, while

only one copy of the repeat is present in either

construct A )12 bp or B)12 bp K, KpnI;

S, SstI.

USF1 and USF2 bind to the 12-bp repeat in the(I)SHP-1

promoter

We were interested in identifying the nuclear factor(s) that

bind to the 12-bp repeat and activates (I)SHP-1 expression

Within the 12-bp sequences, there is an E-box (GAG

CTCCAGGTG) Using this 12-bp repeat as a probe for

binding factors in nuclear extracts from SKOV3 (an ovarian

cancer cell line) and MDA453 (a breast cancer cell line)

(Fig 5, lanes 2 and 7) for EMSA, we detected several shifted

bands One band (U) was completely inhibited with

500-fold excess of the same unlabeled probe (Fig 5, lanes 1 and 6)

but not by an excess amounts of mutated oligonucleotide

(GAGCTCCAGGGA; Fig 5, lane 5), indicating that the

protein complex binds to the E-box sequences in the 12-bp

repeat Two other shifted bands (a doublet X, and Y) were

only partially inhibited in the presence of 500-fold excess of

unlabeled probe (Fig 5, lanes 1 and 6), and were not

detectably competed with excess mutated oligonucleotide

(Fig 5, lane 5) These findings indicate that proteins in the

X and Y complexes also have specificity to the E-box within

the 12-bp repeat sequences

c-Myc and Max proteins are known E-box binding

proteins [16] We therefore tested whether antibody to Max

can supershift the protein complex We first used a known

Myc–Max consensus probe and Ramos (a Burkitt’s

Lym-phoma cell line) nuclear extract to check whether the

anti-Max Ig can be used for supershift experiments We detected

two protein complexes, one of which can be supershifted by

the Max Ig (Fig 5, lane 12) However, the same

anti-Max Ig failed to supershift the protein complexes formed

using the wild-type 12-bp repeat oligonucleotide and nuclear

extracts from both SKOV3 and MDA453 cells (Fig 5, lanes

2 and 7) As Myc hetero-dimerizes with Max, the inability of

anti-Max Ig to supershift the complex would imply that

Myc, like Max, does not bind to the E-box sequences in the

12-bp repeat

USFs are also known E-box binding proteins [17] We

therefore asked whether the protein complexes formed,

contain USF1 and/or USF2 using the 12-bp repeat

oligonucleotide and nuclear extracts from SKOV3 and MDA453 cells As shown in Fig 5 (lanes 3, 4, 8 and 9), one

of the protein complexes was supershifted using either anti-USF1 Ig or anti-USF2 Ig Therefore, both anti-USF1 and USF2 proteins form a stable complexes with the 12 bp repeat

We have not identified the proteins involved in the formation of complexes X and Y

D I S C U S S I O N

Differential usage ofSHP1 promoters in mouse vs human epithelial cell lines

A previous report [8] showed that a few human hemato-poietic cell lines expressed only (II)SHP-1 transcripts Contrary to their finding that HL60 cells expressed only (II)SHP-1transcripts, we found that HL60 cells not only express (I)SHP-1 transcript, but also can be stimulated by PMA to express up to 48-fold more (I)SHP-1 mRNA In addition, we found that most human (5/7) and mouse (8/10) hematopoietic cells, expressed both SHP-1 transcript isoforms, albeit with (II)SHP-1 transcripts being the predominant species In mouse hematopoietic cell lines (II)SHP-1 transcripts were always much more abundant than (I)SHP-1 transcripts However, the relative difference between (II)SHP-1 and (I)SHP-1 transcripts was less pronounced in human hematopoietic cell lines In both human and mouse, similar ratios were found in untrans-formed vs transuntrans-formed hematopoietic cells

The relative abundance of the SHP-1 transcript isoforms

in epithelial cells was different from that of hematopoietic cells In mouse epithelial cell lines, both SHP-1 transcript isoforms are of similar abundance However, no (II)SHP-1 transcripts were detected in most human epithelial cell lines Thus, the control of SHP-1 promoters appears to be different in mouse vs human epithelial cell lines It is not clear whether this species difference is due to cis-elements or trans-activating factors that regulate the SHP-1 promoters

It has recently been shown that in human epithelial cells (such as HeLa, A549 and MCF-7), SHP-1 proteins were

Fig 5 EMSA and supershift analyses Either the 12-bp repeat from (I)SHP-1 promoter (TTGAGCTCCAGGTGGAGCTCCAG GTG; E-box consensus sequences are in bold)

or a Myc–Max consensus (TTAAGCA GACCAC GTGGTCTGCAACC) was used

as a probe Nuclear extracts from SKOV3 (an ovarian cancer cell line) or MDA453 (a breast cancer cell line) or Ramos (a Burkitt’s Lym-phoma cell line) were used To show specificity

of the shifted bands, a 500-fold excess of either cold 12-bp repeat oligonucleotide (lanes 2 and 6) or cold 12-bp repeat mutant oligonu-cleotide (TTGAGCTCCA GGGAGAG CTCCAGGGA; lane 5) was included in the reaction mix for EMSA.

localized in the nuclei [7] As we showed that only (I)SHP-1

transcripts were expressed in human epithelial cells, it

appears that SHP-1 proteins derived from human

(I)SHP-1transcript are localized in the nuclei and thus

might have different signaling substrates compared to that

of the cytoplasmic (II)SHP-1 proteins In support of this

notion, tyrosine-phosphorylated stat-5b and SHP-1

com-plex has been detected in the nuclei of growth hormone

stimulated liver cells in culture [18]

Activators of the distal promoter of humanSHP-1

Our deletional analyses of the distal promoter of SHP-1 (in

an ovarian cancer cell line, SKOV3) showed less promoter

activity with sequential deletion of the 5¢ flanking region

This suggests that the distal promoter of SHP-1 is regulated

by multiple activators Indeed, we found two motifs within

the distal promoter that were important for promoter

activity One such motif was an E-box containing a 12-bp

repeat Deletion of one copy of the repeat resulted in

significantly lower promoter activity (Fig 4) The additional

region I (420 bp) in construct A presumably contains

redundant regulatory elements, thus masking the

contribu-tion of the 12-bp repeats in the comparison of construct A

vs construct A)12 bp activities It appears that the two

tandem E-boxes separated by 6 bp are crucial for

presum-ably high affinity binding of the activator(s) involved

EMSA and supershift experiments showed that USF1 and

USF2 hetero-dimerize and interact with this 12-bp repeat

USFs are thought to have anti-proliferative functions as

their over-expression inhibited growth of numerous cancer

cell lines [19] As SHP-1 is predominantly a negative

regulator of growth, it is possible that USFs mediate their

anti-proliferative functions via the regulation of SHP-1

expression To confirm whether USF proteins bind to the

12 bp repeat in the (I)SHP-1 promoter, in vivo binding of

USF proteins can be assessed by formaldehyde cross-linking

followed by chromatin immunoprecipitation and PCR

amplification of the (I)SHP-1 promoter In addition, it

will be of interest to assess whether cotransfection of USF

dominant negative mutants and a (I)SHP-1 promoter–

luciferase construct would down-regulate luciferase activity

in SKOV3 cells

In our EMSA analyses, aside from the shifted band that

contained USF1 and USF2, we observed other shifted

bands (X and Y) As bands X and Y were only partially

inhibited by 500-fold excess of unlabelled wild-type

oligo-nucleotide, we propose that the proteins involved in these

complexes have very low ÔonÕ rates, resulting in an

ineffi-cient, albeit stable binding to the oligonucleotides Our

finding that an oligonucleotide bearing a mutated E-box

competed less than the wild-type oligonucleotide suggests

that the proteins involved in the X and Y complexes

recognize sequences in the E-box However, we have not

identified the proteins involved in the formation of

complexes X and Y

The second motif in the distal promoter of SHP-1 which

might contribute to the regulation of SHP-1 expression is a

NFjB site located 105 bp upstream of the E-box containing

12-bp repeat EMSA and supershift experiments show that

NFjB p50 and p65 bind this NFjB consensus sequence

(GGGATTTTCC) It was previously shown that PMA

treatment of HL60 cells increased SHP-1 transcription [15]

We found that (I)SHP-1 transcripts were upregulated by PMA in HL60 and SKOV3 cells Furthermore, PMA-treated SKOV3 nuclear extracts showed more NFjB binding activity (fourfold to fivefold; Fig 3) than those from untreated cells Thus, it is likely that PMA activates NFjB proteins which in turn leads to higher expression of (I)SHP-1 transcripts Confirmation of this result can be achieved by deleting the NFjB site in the promoter construct and assessing whether this will render transfected cells unresponsive to PMA

Our analyses of the deletion constructs transfected into SKOV3 cells indicated that deletion of the region I (the 5¢

420 bp sequences, Fig 4) from the promoter construct (construct B) resulted in a 54% reduction of luciferase activity Interestingly, no consensus sequences for known nuclear factors are found in region I This result indicates that there might be novel nuclear factors (activators) which contribute to (I)SHP-1 promoter activity

Contrary to our results (i.e progressively less promoter activity with sequential deletion of the 5¢ flanking region), a recent deletional study of the same distal promoter in MCF7 cells (a breast cancer cell line), showed a dramatic drop of promoter activity to  15% using a deletion construct with 5¢ flanking sequences up to 60 bp upstream

of the 12-bp repeat [20] It is possible that the vast difference

in the level of SHP-1 transcripts expressed in SKOV3 vs MCF7 cells might account for the discrepancy in the results between the two deletional analyses We found that MCF7 expressed at least 10-fold more 1 transcripts and

SHP-1 proteins than SKOV3 cells (unpublished data) It has also been reported that SHP-1 was up-regulated in MCF7 cells,

as in human breast cancers [21] We showed previously that SKOV3 expressed SHP-1 levels similar to normal ovarian epithelial cells [22] and thus our deletional analysis in SKOV3 might reflect a more physiological (and not pathological) situation of SHP-1 expression Although we favor the above explanation, we cannot rule out the possibility that the control of SHP-1 expression might differ in ovarian vs mammary cells

A C K N O W L E D G E M E N T S

This work was funded by the National Cancer Institute of Canada We thank Dr P Marynen for the generous gift of the SHP-1 containing cosmid clone, and Dr M Shulman for a critical review of the manuscript.

R E F E R E N C E S

1 Koch, C.A., Anderson, D., Moran, M.F., Ellis, C & Pawson, T (1991) SH2 and SH3 domains: elements that control interactions

of cytoplasmic signaling protein Science 252, 668–672.

2 Tsui, H.W., Siminovitch, K.A., de Souza, L & Tsui, F.W.L (1993) Motheaten and viable motheaten mice have mutations in the haematopoietic cell phosphatase gene Nat Genet 4, 124–129.

3 Shultz, L.D., Schweitzer, P.A., Rajan, T.V., Yi, T., Ihle, J.N., Matthews, R.J., Thomas, M.L & Beier, D.R (1993) Mutations at the murine motheaten locus are within the heamtopoietic cell protein-tyrosine phosphatase (Hcph) gene Cell 73, 1445–1454.

4 Shultz, L.D., Coman, D.R., Bailey, C.L., Beamer, W.G & Sidman, C.L (1984) ÔViable motheatenÕ, a new allele at the moth-eaten locus Am J Pathol 116, 179–192.

5 Neel, B.G (1997) Role of phosphatases in lymphocyte activation Curr Opin Immunol 9, 405–420.

6 Plutzky, J., Neel, B.G & Rosenberg, R.D (1992) Isolation of a src

homology 2-containing tyrosine phosphatase Proc Natl Acad.

Sci USA 89, 123–1127.

7 Cragg, G & Kellie, S (2001) A functional nuclear localization

sequence in the C-terminal domain of SHP-1 J Biol Chem 276,

23719–23725.

8 Banville, D., Stocco, R & Shen, S.H (1995) Human protein

tyrosine phosphatase 1C (PTPN6) gene structure: alternate

pro-moter usage and exon skipping generate multiple transcripts.

Genomics 27, 165–173.

9 Martin, A., Tsui, H.W., Shulman, M.J., Isenman, D & Tsui,

F.W.L (1999) Murine SHP-1 splice variants with altered src

homology 2 (SH2) domains: implications for the SH2-mediated

intramolecular regulation of SHP-1 J Biol Chem 274,

21725–21734.

10 Dignam, J.D., Lebovitz, T.M & Roeder, R.G (1983) Accurate

transcription initiation by RNA polymerase II in a soluble extract

from isolated mammalian nuclei Nucleic Acids Res 11,

1475–1489.

11 Rosenthal, N (1987) Identification of regulatory elements

of cloned genes with functional assays In Methods in

Enzy-mology Vol 152 (Berger, S.L & Kimmel, A.R., eds)

pp 704–720.

12 Alam, J & Cook, J.L (1990) Reporter genes: application to the

study of mammalian gene transcription Anal Biochem 188,

245–254.

13 Martin, A., Tsui, H.W & Tsui, F.W.L (1999) SHP-1 variant

proteins are absent in motheaten mice despite presence of splice

variant transcripts with open reading frames Mol Immunol 36,

1029–1041.

14 Jin, Y.J., Yu, C.L & Burakoff, S.J (1999) Human 70-kDa

SHP-1L differs from 68-kDa SHP-1 in its C-terminal structure and

catalytic activity J Biol Chem 274, 28301–28307.

15 Uchida, T., Matozaki, T., Matsuda, K., Suzuki, T., Matozaki, S., Nakano, O., Eada, K., Konda, Y., Sakamoto, C & Kasuga, M (1993) Phorbol ester stimulates the activity of a protein tyrosine phosphatase containing SH2 domains (PTP1C) in HL-60 leuke-mia cells by increasing gene expression J Biol Chem 268, 11845– 11850.

16 Cole, M.D & McMahon, S.B (1999) The myc oncoprotein: a critical evaluation of transactivation and target gene regulation Oncogene 18, 2916–2924.

17 Gregor, P.D., Sawadogo, M & Roeder, R.G (1990) The adeno-virus major late transcription factor USF is a member of the helix-loop-helix group of regulatory proteins and binds to DNA as a dimer Genes Dev 4, 1730–1740.

18 Ram, P.A & Waxman, D.J (1997) Interaction of growth hor-mone-activated STATs with SH2-containing phosphotyrosine phosphatase SHP-1 and nuclear JAK2 tyrosine kinase J Biol Chem 272, 17694–17702.

19 Luo, X & Sawadogo, M (1996) Antiproliferative properties of the USF family of transcription factors Proc Natl Acad Sci USA

93, 1308–1313.

20 Xu, Y., Banville, D., Zhao, H.-F., Zhao, X & Shen, S.-H (2001) Transcriptional activity of the SHP-1 gene in MCF7 cells is dif-ferentially regulated by binding of NF-Y factor to two distinct CCAAT-elements Gene 269, 141–153.

21 Yip, S.S., Crew, A.J., Gee, J.M.W., Hui, R., Blamey, R.W., Robertson, J.F.R., Nicholson, R.I., Sutherland, R.L & Daly, R.J (2000) Up-regulation of the protein tyrosine phosphtase SHP-1 in human breast cancer and correlation with grb2 expression Int J Cancer 88, 363–368.

22 Mok, S.C., Kwok, T.T., Berkowitz, R.S., Barrett, A.J & Tsui, F.W.L (1995) Overexpression of the protein tyrosine phospha-tase, nonreceptor type 6 (PTPN6), in human epithelial ovarian cancer Gynecol Oncol 57, 299–303.