Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot

Braslavsky1, Kurt Schaffner1, Nicole Tandeau de Marsac3and Wolfgang Ga¨rtner1,2 1 Max-Planck-Institut fu¨r Strahlenchemie, Mu¨lheim an der Ruhr, Germany;2Max-Planck-Institut fu¨r Biochem

Two independent, light-sensing two-component systems

in a filamentous cyanobacterium

Helena J M M Jorissen1, Benjamin Quest2, Anja Remberg1, The´re`se Coursin3, Silvia E Braslavsky1, Kurt Schaffner1, Nicole Tandeau de Marsac3and Wolfgang Ga¨rtner1,2

1

Max-Planck-Institut fu¨r Strahlenchemie, Mu¨lheim an der Ruhr, Germany;2Max-Planck-Institut fu¨r Biochemie, Martinsried, Germany;3Unite´ des Cyanobacte´ries, De´partement de Microbiologie Fondamentale et Me´dicale, Institut Pasteur (URA-CNRS 2172), Paris, France

Two ORFs, cphA and cphB, encoding proteins CphA and

CphB with strong similarities to plant phytochromes and to

the cyanobacterial phytochrome Cph1 of Synechocystis sp

PCC 6803 have been identified in the filamentous

cyano-bacterium Calothrix sp PCC7601 While CphA carries a

cysteine within a highly conserved amino-acid sequence

motif, to which the chromophore phytochromobilin is

co-valently bound in plant phytochromes, in CphB this position

is changed into a leucine Both ORFs are followed by rcpA

and rcpB genes encoding response regulator proteins similar

to those known from the bacterial two-component signal

transduction In Calothrix, all four genes are expressed under

white light irradiation conditions, albeit in low amounts For

heterologous expression and convenient purification, the

cloned genes were furnished with His-tag encoding

sequences at their 3¢ end and expressed in Escherichia coli

The two recombinant apoproteins CphA and CphB bound

the chromophore phycocyanobilin (PCB) in a covalent and a

noncovalent manner, respectively, and underwent

photo-chromic absorption changes reminiscent of the Prand Pfr

forms (red and far-red absorbing forms, respectively) of the

plant phytochromes and Cph1 A red shift in the absorption maxima of the CphB/PCB complex (kmax ¼ 685 and

735 nm for Pr and Pfr, respectively) is indicative for a noncovalent incorporation of the chromophore (kmaxof Pr,

Pfrof CphA: 663, 700 nm) A CphB mutant generated at the chromophore-binding position (Leu246fi Cys) bound the chromophore covalently and showed absorption spectra very similar to its paralog CphA, indicating the noncovalent binding to be the only cause for the unexpected absorption properties of CphB The kinetics of the light-induced Pfr formation of the CphA–PCB chromoprotein, though sim-ilar to that of its ortholog from Synechocystis, showed dif-ferences in the kinetics of the Pfrformation The kinetics were not influenced by ATP(probing for autophosphorylation)

or by the response regulator In contrast, the light-induced kinetics of the CphB–PCB complex was markedly different, clearly due to the noncovalently bound chromophore Keywords: Calothrix sp strain PCC 7601; flash photolysis; heterologous expression; phytochrome-like apoproteins CphA and CphB; response regulators RcpA and RcpB

A precise qualitative and quantitative measurement of the surrounding light is essential to photosynthetic organisms in order to either adapt to the environmental light conditions

or, in the case of motility, to proceed towards a favorable habitat Higher plants have developed the phytochromes, a chromoprotein family, which absorb light in the long-wavelength region and regulate numerous photomorpho-genetic processes [1–3] In cyanobacteria, the presence and molecular structure of comparable sensory system(s) have long been debated It has been suggested that the photo-synthetic apparatus itself or blue-light- and/or other non-characterized light-absorbing photoreceptors might fulfil these functions [4–7]

The complete sequencing of the genome of the cyano-bacterium Synechocystis sp [8] has afforded some clues on the components putatively involved in light sensing Probing this genome with phytochrome consensus sequences has yielded an ORF (slr0473) encoding a protein of 85 kDa (Cph1) that exhibits in its N-terminal part strong homol-ogies to the phytochromes of higher plants [9] Besides this particular ORF, also others with lower similarities to phytochromes have been identified in Synechocystis sp [10] and in Fremyella diplosiphon (rcaE) [11], a mutant of Calothrix sp [12], as well as in other phototrophic and heterotrophic prokaryotes [13–15]

Correspondence to W Ga¨rtner, Max-Planck-Institut fu¨r

Strahlenchemie, Postfach 10 13 65, D-45413 Mu¨lheim an der Ruhr,

Germany.

Fax: + 49 208 306 39 51, Tel.: + 49 208 3 06 36 93,

E-mail: gaertner@mpi-muelheim.mpg.de or N Tandeau de Marsac,

Unite´ des Cyanobacteries, De´partement de Microbiologie

Fondamentale et Medicale, Institut Pasteur (URA-CNRS 2172), 28

rue du Docteur Roux, F-75724 Paris Cedex 15, France.

Fax: + 33 1 40613042, Tel.: + 33 1456 88415,

E-mail: ntmarsac@pasteur.fr

Abbreviations: Anabaena sp., Anabaena/Nostoc sp strain PCC 7120;

Calothrix sp., Calothrix sp strain PCC 7601; CphA and CphB,

recombinant phytochrome-like apoproteins of Calothrix sp.;

CphA-PCB and CphB/PCB, chromoproteins obtained by covalent

binding of CphA to PCB and by noncovalent complexing of CphB to

PCB, respectively; PCB, phycocyanobilin; P r and P fr , red and far-red

absorbing forms of phytochrome, respectively; Synechocystis sp.,

Synechocystis sp strain PCC 6803.

Note: The sequences reported in this paper have been deposited in the

GenBank database (accession nos AF309559 for cphA-rcpA,

AF309560 for cphB-rcpB.

(Received 12 November 2001, revised 20 March 2002,

accepted 12 April 2002)

The strong similarity of slr0473 to the genes of the plant

phytochromes is also evident when the amino-acid sequences

and properties of the corresponding recombinant proteins

are compared The cyanobacterial apoprotein (Cph1) binds

to both the chromophores of the plant phytochromes,

phytochromobilin, and to the closely related

phycocyanobi-lin (PCB) Moreover, the assembled chromoproteins can be

cycled between Prand Pfrforms in a way reminiscent of the

plant phytochromes [kmax668 nm (Pr) and 717 nm (Pfr) with

phytochromobilin as a chromophore, and 654 nm (Pr) and

706 nm (Pfr) with PCB] [16–18] This discovery of a new

group of light-sensing signal transduction proteins has also

raised new questions on their function as putative

photo-receptors In particular, as in the case of the gene product of

rcaE of Fremyella diplosiphon, the covalent binding of a

chromophore by the recombinant protein is still

question-able Therefore, functional assays [18] were performed which

revealed signal transduction in Synechocystis sp once the

photoreceptor is activated by absorption of a photon While

the N-terminal part of the phytochrome-like protein of

Synechocystis sp incorporates the chromophore, its

C-terminal part exhibits sequence motifs with a strong

similarity to the well-characterized two-component system

of other bacteria [19,20] As found in the bacterial system,

this process of signal transduction functions via

auto-phosphorylation of a conserved histidinyl residue in the

receptor molecule (Cph1) and transphosphorylation to an

aspartate of a response regulator (Rcp1) The target amino

acids for both reactions, the autophosphorylation and

the phosphate transfer could be identified in vitro for

the recombinant Synechocystis proteins by site-directed

mutagenesis [18]

Extensive search for DNA sequences similar to those

found in Synechocystis sp has revealed further members of

this protein family in a number of other cyanobacteria and

eubacteria [14,21] Some of these proteins even lack the

covalent-binding forming cysteine, but nevertheless undergo

light-induced signal transduction via a Schiff base bonded

biliverdin chromophore (covalent bond to a histidine

residue) [14] The widespread presence of this signal

transduction principle is further supported by the finding

that the ORFs of all these receptors are accompanied by a

coding sequence for a response regulator protein capable of

transferring the biological signal into the cell interior

Here, we describe the biochemical and spectral

charac-terization of two independently functioning, light-sensing

receptor proteins and their cognate corresponding response

regulators as new members of the two-component signal

transduction protein family from the filamentous

cyano-bacterium Calothrix sp PCC 7601

M A T E R I A L S A N D M E T H O D S

Strain and growth conditions

The axenic strain Calothrix sp strain PCC 7601 (this strain

has also been named Fremyella diplosiphon UTEX 481 and

Tolypothrixsp., however, in order not to cause confusion we

wish to remain with Calothrix sp PCC 7601 [22]) was grown

at 30C in liquid BG-11 medium containing 0.4 mM

Na2CO3 and supplemented with 10 mM NaHCO3 The

culture was stirred with a magnetic bar under a continuous

stream of air/CO (99 : 1, v/v) White light of fluorescent

tubes (Universal White) provided a photosynthetic photon flux density of 50 lmol photonsÆm)2Æs)1 (measured with

a LICOR LI-185B quantum/radiometer/photometer equipped with a LI-190SB quantum sensor)

The purity of the cultures was checked on plates of medium BG-11 [22], supplemented with glucose and casamino acids (0.2% and 0.02% w/v, respectively) and solidified with Difco Bacto agar (1% w/v)

Plasmids were maintained in the E coli strain DH5a F¢ Recombinant E coli strains were grown at 37C in a Luria–Bertani medium supplemented with 100 lgÆmL)1 ampicillin

Cloning of phytochrome- and response regulator-encoding DNAs

Calothrixsp genomic DNA was extracted from a culture grown to an D750value of 0.8, using the Nucleobond for the isolation of genomic DNA of bacteria (Macherey–Nagel) Total genomic DNA digested with NheI or HindIII gave strong hybridization signals (5.5 and 6 kb, respectively) with the PCR products [21] corresponding to a portion of the cphA and cphB genes, respectively Two partial libraries were constructed by ligating NheI and HindIII DNA fragments of 6 kb into the dephosphorylated pBluescript

SK–vector digested with XbaI and HindIII, respectively, as described previously [23] Ligated DNA was transformed by electroporation (Bio-Rad, GENE PULSER) into the E coli strain DH5a F¢ [24] The clones carrying the proper inserts were selected by colony hybridization with either the cphA

or cphB PCR products as probes The recombinant plasmid DNAs were purified with the QIA filters (Qiagen kit 12262) according to manufactors’ instructions, and they were sequenced ( 3200 nucleotides) on both strands (Genome Express, Paris, France)

The full-length DNAs encoding the cyanobacterial phytochrome-like proteins and their respective response regulators were synthesized with an octadecamer oligonu-cleotide at their 3¢ end encoding for six histidine residues and with restriction sites for cloning into the E coli vector pMEX8 (Medac) For cphB and rcpA the putative trans-lation start codons TTG and GTG, respectively, were replaced by ATG The cphA gene was cloned between the NcoI and SalI sites of the vector The cphB, rcpA and rcpB genes were cloned between the EcoRI and SalI sites of the vector The following primers (5¢ to 3¢) were used (restriction sites and sequences coding for a His6 tag are underlined, start and stop codons are given in bold, and gene-specific sequences in italics): cphA: forward, GCGATACCATGG

ACTCAGTGATGGTGGTGATGGTGTCCTCGACC AAAAAGATC; rcpA: forward, GCGATAGAATTCATG

GTCGACTCAGTGATGGTGGTGATGGTGCTCCG ACGGCAATGTCG; cphB: forward, GCGATAGAATTC ATGACGAATTGCGATCGCGA and reverse, ACCCGG GTCGACTCAGTGATGGTGGTGATGGTGTTTGAC CTCCTGCAATGT; cphBlong: forward, GCGATAGAA TTCATGTTGCAGTTAATTTATAACAATT; the reverse primer was identical to that used for cphB; rcpB: forward, GAGGCTGAATTCATGGTAGGAAACGCTACTCAAC; reverse, CGAAGCTTGTCGACTCAGTGATGGTGGT GATGGTGACCCATCTCAGGAAGTACAAC

Total RNA extraction, cDNA synthesis

and specific mRNA detection

Total RNA from white light-grown cells from Calothrix

PCC 7601 was extracted as described previously [25] with

the following modifications: cells were resuspended in BG11

medium to a D750 of 50 and disrupted in a Mickle

desintegrator six times for 1 min at 4C The

ethanol-precipitated total RNA pellets were taken up in 50 lL of

sterile water containing 0.1% (v/v) DEPC and directly

treated with DNAse I ribonuclease-free as follows A

sample of total RNA (300 lg) was resuspended in a buffer

containing 50 mMTris/HCl pH 7.5, 10 mMMgCl2, 0.1 mM

dithiothreitol and treated twice with 200 U of DNase I

ribonuclease-free (Boehringer Mannheim) for 45 min at

37C After two phenol/chloroform treatments, total RNA

was ethanol-precipitated for 12 h at 20C and resuspended

in 50 lL of DEPC-treated water As a control for RNA

purity, a DNase I-treated sample (1 lg) of total RNA was

amplified by PCR with the primers used for further cDNA

detection No amplification product was obtained

confirm-ing the absence of DNA in the RNA preparations

A pool of total cDNAs was synthesized using random

primers with the SuperScriptTM First-Strand Synthesis

System for reverse transcriptase PCR amplifications (Gibco

BRL) as recommended by the manufacturer A second set

of specific cDNAs was synthesized using the following

primers specific of the cphA, rcpA, cphB and rcpB genes:

CTC-3¢; rcpA primer: 5¢-GCTGGCTCAGGTTGCGAGA

TTTGGTG-3¢; cphB primer: 5¢-CGCGATGGTTAGCCC

TGCACCCG-3¢; rcpB primer: 5¢-GTCTGAACCGTCTC

GGTGAGACG-3¢

Total RNA (5 lg) was incubated with 120 pmoles of

each of the primers specific of the cphA, rcpA, cphB and

rcpBgenes in 12 lL of DEPC-treated water for 10 min at

70C Samples were cooled down on ice and incubated with

the SuperScriptTM First-Strand buffer (Gibco BRL)

con-taining 10 mMdithiothreitol and 0.5 mMdNTPfor 2 min at

42C After addition of 200 U of SuperScript II RNase H–

reverse transcriptase and incubation for 50 min at 42C,

followed by 15 min at 70C, 2 lL of cDNA containing

samples were used for PCR amplifications in the presence of

5 U of rTaq polymerase (Amersham Pharmacia) and

different combinations of the following forward and reverse

primers (170 pmol of each): cphA gene: primer 1, 5¢-GGTA

GAGTGATATTTACAG-3¢ (forward); primer 2, 5¢-CGCT

TCATTGGGATTACC-3¢ (reverse); cphB gene: primer 3,

5¢-CCCTATGAAATCCGTAGCG-3¢ (forward); primer 4,

5¢-GGTAGAGATTGTCGCTGCAC-3¢ (reverse); primer

5, 5¢-CAAACAGCCGCGCCTGTAGC-3¢ (reverse); rcpA

gene: primer 6, 5¢-GCTGATATCCGCTTAATCC-3¢

(for-ward); primer 7, 5¢-GACGTGTAAGTCGTAGCTATG-3¢

(reverse); rcpB gene: primer 8, 5¢-GGAAACGCTACTCAA

CCGTTGC-3¢ (forward); primer 9, 5¢-TCCCGCCCATCA

GTTCCTGG-3¢ (reverse)

The program for PCR (Robocycler gradient 40,

Strata-gene) was one cycle for 5 min at 95C, 1 min at 55 C and

30 s at 72C, 40 cycles at the same temperatures for 1 min,

1 min 30 s and 1 min, respectively, and one cycle for 1 min,

1 min and 5 min, respectively The PCR products were

analyzed by electrophoresis (1.2% (w/v) agarose gels, Tris/

borate buffer) [23]

Generation of the Leu246fi Cys mutant of CphB

A point mutation was introduced into cphB, converting the leucine-encoding codon into TGT, encoding for cysteine, thus principally allowing covalent chromophore binding Forward primer: 5¢-CACTCGGTACTCCGCAGCGTTT CGCCGTGTCACATTGAATATTTGCACAATATGG -3¢; reverse primer: 5¢-CCATATTGTGCAAATATTCAA TGTGACACGGCGAAACGCTGCGGAGTACCGAG TG-3¢ Sequences different from the wild-type CphB sequence are given in bold

Expression of (apo)proteins, chromoprotein assembly and affinity purification

This followed recently published procedures [26] In brief, the E coli strain C600 was used as a host (for expression of CphB L246C mutant, E coli BL21DE3RIL from Strata-gene was used), and was grown at 37C in Luria–Bertani medium [23] containing penicillin (150 lgÆmL)1) to

D600 ¼ 1.8 BL21DE3RIL cells were induced with IPTG following the instructions of the manufacturer Cells were harvested by centrifugation (2200 g, 10 min, 4C) and opened at liquid nitrogen temperature by treatment with an Ultraturrax (Jahnke & Kunkel T25, 10 000 r.p.m.) The cellular debris was pelleted by centrifugation (39 000 g,

30 min, 4C) The supernatant was cleared by ultracentrif-ugation (200 000 g, 45 min, 4C) After readjusting the pH

to 8.0, the cleared crude extract was incubated with PCB The amount of assembled chromoprotein was determined from the difference spectrum (Pr) Pfr), based on the Pr absorption coefficient of the recombinant phytochrome-like protein of Synechocystis sp (emax 85 000M )1Æcm)1 at

656 nm [27]) Purification of the assembled chromoproteins was accomplished by affinity chromatography on a Talon metal affinity resin (Clontech) The analysis of protein content and purity was performed by polyacrylamide gel electrophoresis and Western blotting (PHAST system, Pharmacia) employing an anti Penta-His antibody from Qiagen

Assembly kinetics, determination of absorption maxima/ difference spectra, Pfr stability, and Pr-to-Pfrkinetics For the determination of the assembly kinetics, the apoproteins were purified as described for the assembled chromoproteins and were incubated in the dark with a 10-fold excess of PCB The assembly kinetics was followed

at 10C and at room temperature In addition to normal buffer, deuterated buffers were also used for these meas-urements For CphA–PCB, the absorption rise at 663 (kmax

of Pr) and 700 nm was recorded For the CphB/PCB complex, spectra were run from 600 to 750 nm, and the absorption rise at 685 nm (kmaxof Pr) was determined The fully assembled chromoproteins were subjected to repetitive red and far-red irradiations [interference filter at

658 ± 7 nm and cut-off filter > 715 nm, Schott] for Pfr and Pr formation, respectively Absorption spectra were recorded with a Shimadzu spectrophotometer UV-2102/ 2402PC For the determination of the thermal stability of the Pfrform, the samples were irradiated at 658 nm until

a maximum of Pfr was formed Subsequently, the spectral changes of the sample during the storage at room

temperature in the dark were recorded by measuring spectra

(500–800 nm) at various time intervals

The laser flash-induced Pr-to-Pfrformation was followed

in the time range from 1 ls to 5 s essentially as described

previously [28] In some experiments, ATPwas added to a

final concentration of 1.5 mM When the response regulator

was added during the measurements, it was used in about

eight-fold molar excess over the amount of phytochrome

Recorded data were averaged and treated by a global fit

analysis as described previously [28]

R E S U L T S

Two ORFs of the cyanobacterium Calothrix sp., cphA (2304

nucleotides, GenBank accession number AF309559) and

cphB(2298 nucleotides, AF309560), initially cloned in part

by using the same PCR primer sets [21], have now been fully

characterized Both ORFs encode proteins with strong

sequence similarities to plant phytochromes and to Cph1 of

Synechocystissp., the first phytochrome protein identified in

cyanobacteria However, despite a particularly high

sequence degree of similarity in the chromophore region

for both the CphA and CphB proteins of Calothrix sp

(Fig 1), in the latter protein the chromophore-binding

cysteine is replaced by a leucyl residue (position 246; Fig 1)

A comparison of their complete amino-acid sequences with

those of the cyanobacterial phytochromes available to date

(Table 1, see also gene sequences deposited at GenBank)

confirms the membership of the new Calothrix proteins to

this protein family, the highest score being found between

Calothrix sp CphA and Anabaena sp AphA (GenBank

accession no AB028873)

The translation starting point of cphA is identified by the

putative Shine–Dalgarno sequence, GAGGA at nucleotide

positions 33–37 (Fig 2), and the ATG at position 46

indicating the first amino-acid residue For the cphB gene,

there are two possible translation initiation sites The first

one is at position 28 (TTG, coding for leucine and preceded

by a stop codon) with a putative Shine–Dalgarno sequence

AAGG at positions 18–21 Another one is located at

position 118 (TTG) with a putative Shine–Dalgarno

sequence GAGG at positions 109–112 In both cases, a leucine is encoded as the first amino acid, which for heterologous expression was replaced by methionine (ATG)

In addition to the high sequence similarity to the phytochromes in the N-terminal half, a motif (ASHDL) reminiscent of the histidine kinases of the two-component signal transduction were found in the C-terminal parts of CphA and CphB with the histidinyl residues prone to autophosphorylation (positions 538, CphA, and 526, CphB) The response regulator-encoding genes rcpA and rcpB (447 and 450 nucleotides, respectively, corresponding to 148 and 149 amino acids) were found downstream from cphA and cphB, respectively (Fig 2) The sequence of rcpA over-laps by more than 50 nucleotides with that of cphA, assuming an operon-like arrangement In the case of cphB and rcpB, the stop codon of the receptor gene and the ATG

of the response regulator gene are separated by four nucleotides A comparison of the deduced amino-acid sequences of response regulators reveals a high degree of conservation: RcpA is 66% identical with its Synechocystis

sp ortholog and 39% with its Calothrix paralog All motifs common to the two-component response regulators, in particular those involved in the phosphate transfer from the receptor, are conserved and can readily be identified (Fig 3)

Fig 1 Sequence alignment of the

chromo-phore-binding domain of phytochrome-like

proteins of cyanobacteria (Calothrix sp CphA

and -B, Synechocystis sp Cph1, and Anabaena

sp AphA and AphB, GenBanknumbers

AB028873 and AB034952), Arabidopsis

thali-ana (At phyA and -C) and Solanum tuberosum

(St phyA and -B) Grey boxes: amino acids

identical in no more than eight of the nine

sequences The position of covalent

chromo-phore attachment (in case a cysteinyl residue is

present) is indicated by an asterisk.

Table 1 Percentage of sequence identity of prokaryotic phytochrome-like apoproteins.

7601CphB 6803Cph1 7120AphA 7120AphB a

Phytochrome-like apoproteins of: a Anabaena sp (Genebank accession no AB028873), b Calothrix sp., c Synechocystis sp [8]., and d Anabaena sp (GenBank accession no AB034952).

A transcription analysis indicated that both the

receptor-and the response regulator-encoding ORFs are expressed,

albeit in low yields as the transcripts could not be detected

by Northern hybridizations but only by PCR amplification

of either pools of total cDNAs or of cDNAs specific of the

cphA, rcpA, cphB and rcpB genes In each case, the size of

PCR products obtained were as expected from the

combi-nation of the primers used for the amplification (Fig 4)

Moreover, a PCR product was obtained when the specific

primers 1 and 2 were used to amplify cphA from the cDNA

synthesized with the rcpA primer (Fig 4) This

demonstra-ted that cphA and rcpA form an operon In contrast, no

PCR product was obtained when the specific primers 3 and

4 were used to amplify cphB from the cDNA synthesized with the rcpB primer, suggesting that cphB and rcpB are transcribed independently

Both receptor-encoding ORFs were furnished at their 3¢ end with a His6-encoding octadecanucleotide tail and were cloned into the E coli vector pMEX8 for heterologous expression For cphB, two different starting sites were used (Fig 2) While the expression of cphA was sufficiently high (based on Western blot analysis, and also estimated from incubation experiments with linear tetrapyrrole chromo-phores, see above), the yield of the gene product of cphB was considerably lower, irrespective of which of the two cphB constructs was expressed, and a large amount of the protein was found in inclusion bodies

Fig 3 Sequence alignment of the cyanobacte-rial response regulators 7601RcpA and -B (of Calothrix sp.), and 6803Rcp1 (of Synechocystis sp.) Grey boxes: amino acids identical in two out of the three sequences The phosphate-accepting aspartate (Asp69 in RcpA) is indi-cated by an asterisk, and the other amino acids generating the binding site (Glu13, Asp14, Thr99, Lys121) are marked by a diamond.

Fig 4 Expression of the cphA, rcpA, cphB and rcpB genes in Calothrix PCC 7601 cells grown under 50 lmol photonsÆm)2Æs)1of white light PCR products of the cDNA specific of cphA amplified with primers 1 and 2 specific of cphA (450 bp, line 1), of the cDNA specific of cphB with primers 3 and 5 specific of cphB (200 bp, line 4), of the cDNA specific of rcpA amplified with primers 1 and 2 specific of rcpA (450 bp, line 2), of the cDNA specific of rcpB amplified with primers 3 and 4 specific of rcpB (no detectable product, line 5), and of the cDNA pool with primers 6 and 7 specific of rcpA (290 bp, line 3) or primers 8 and 9 specific of rcpB (230 bp, line 6).

Fig 2 Genomic arrangement of phytochrome and response regulator

ORFs of Calothrix sp showing the start and stop regions of the genes.

Putative Shine–Dalgarno sequences and start positions of the coding

regions are underlined For cphB both putative starting sequences are

indicated In all cases, the nucleotides encoding leucine/valine at

position one of the protein were changed for heterologous expression

into methionine (ATG codons).

Incubation of the crude mixture of the recombinant CphA

protein obtained from the lysis of the E coli cells with PCB

led to the appearance of an absorption band with

kmax ¼ 663 nm (Fig 5) This assembly process was very

rapid and primarily afforded an intermediate with a

red-shifted absorption maximum at around 700 nm On the

time scale of the observation, more than 50% of this

intermediate formed within less than 1 min (at 10C),

indicating an unresolved, much more rapid primary

reac-tion The 700-nm intermediate then converted into the

660-nm Pr-like band The decay of the 700-nm species and

the formation of the 660-nm species remained nearly

unchanged when performed in deuterated buffer The decay

of the primary 700-nm species showed, however, a strong

temperature dependence (Fig 5) In order to investigate

possible effects of protonation changes on the absorption

maximum, the pH stability of the CphA-PCB

chromopro-tein in its Prform was determined The holoprotein proved

stable in the broad range of pH 6–10 without showing

strong shifts of the absorption maximum, and started to denature irreversibly beyond these pH values

This novel cyanobacterial phytochrome exhibits spectral features similar to those of the plant phytochromes, i.e irradiation with red light caused formation of a red-shifted absorption band (kmax710 nm), close to the Pfrabsorption

of Synechocystis sp phytochrome [9] This photochemical behavior was fully reversible and reproducible Monitoring

of the thermal stability of the Pfrform of CphA in the dark revealed practically no spectral change within 10 days The light-induced Pr-to-Pfr conversion of CphA was followed by laser flash photolysis (Fig 6 and Table 2; it should be kept in mind that the data presentation shows decay processes with positive amplitudes, whereas the formation of an absorbance is presented with a negative amplitude) In the time window of up to 1 ms two kinetic processes were identified The immediate absorbance increase (kmax 680 nm), which is not time-resolved, but appears instantaneous on this time scale, decays with a lifetime of 22 ls, and a new absorbance appears at kmax

700 nm with a lifetime of 1.0 ms, this one being the major

Pfr-forming process The subsequent reaction with a lifetime

of 9.4 ms shows the absorbance decrease in the range of the

Pr form (670 nm), and a concomitant absorbance rise at around 720 nm Slower processes of very low intensity and

Fig 6 Lifetime-associated difference spectra of the CphA–PCB chro-moprotein Flash photolysis was performed at 10 C Note that pos-itive amplitudes in the difference spectra refer to an absorbance decay related to the process observed, and negative amplitudes indicate an absorbance rise The solid curve without symbols shows the residual absorbance at the end of the observation time, i.e the P r ) P fr differ-ence spectrum.

Fig 5 Assembly kinetics of CphA + PCB at various temperatures and

buffer conditions and absorption (difference, P r – P fr ) spectra of the

CphA-PCB chromoprotein at ambient temperature Top: filled squares

are H 2 O, ambient temperature; open squares are D 2 O, ambient

tem-perature; triangles are D 2 O, 10 C.

Table 2 Lifetimes for the light-induced P r -to-P fr conversion of CphA-PCB The values in column one are those from Fig 6 Lifetimes were determined by global analysis The concentration of ATPwas 1.5 m M , and the molar ratio [CphA-PCB]:[RcpA]  1 : 8.

CphA-PCB

CphA-PCB + ATP

CphA-PCB + RcpA

CphA-PCB + ATP+ RcpA

lifetimes of 42 ms, 290 ms and 33 s exhibit almost no absorbance changes in the 660-nm range, but only an increase of absorbance at around 720 nm As an auto-phosphorylation has been described for the corresponding protein of Synechocystis sp., the measurements were also performed in presence of ATP, and upon addition of the response regulator RcpA Neither the presence of ATPnor RcpA had any significant effect on the kinetics of Pfr formation (Table 2), although the light-induced phospho-relay between receptor and their cognate response regulator had recently been demonstrated for these proteins [29] It should be taken into account that these experiments were not performed under quantitative conditions, i.e no proof was performed for the extent of phosphorylation

CphB Incubation of the soluble amounts of CphB apoprotein with PCB, as described for the CphA, surprisingly yielded also a

Pr-like absorption spectrum (kmax685 nm) as found for its paralog, despite the absence of the chromophore-binding cysteinyl residue contained in phytochrome (-like proteins) (Fig 7, top) A biexponential kinetics with lifetimes of 15 and 103 s was determined, but no instantaneous formation

of an initial red-shifted intermediate analogous to the 700-nm species was observed as in the assembly of CphA with PCB Irradiation of the CphB/PCB complex led to the formation of a far-red shifted species with an absorption maximum at 735 nm, reminiscent of a Pfr state (Fig 7 middle, trace A) The incorporation of the chromophore without covalent binding became evident upon the purifi-cation via metal-affinity chromatography The elution of the affinity-bound protein from the resin resulted in the collection of only the apoprotein, i.e in a complete loss of the chromophore (Fig 7 middle, trace B) Yet, when PCB was added to this eluted protein, the Pr-like absorption appeared again and photoreversibility identical to that of the unpurified complex was re-established (Fig 7, middle, trace C)

The time-resolved measurement of Pr-to-Pfr photoconver-sion of the CphB/PCB complex followed only biexponential kinetics with lifetimes of 1.9 and 12.8 ms, both reactions showing a decrease in absorption at 680–690 nm and a concomitant increase at around 730 nm (Fig 8) Contrary to

Fig 7 Assembly kinetics of CphB + PCB at 10 °C, determined at

685 nm (top), and proof of noncovalent binding of PCB by CphB (middle

and bottom) Middle, CphB + PCB assembly probe: (A) incubation of

the crude lysate after cell harvest, (B) after elution of the CphB/PCB

complex from the affinity column, (C) after addition of fresh PCB to

eluate (B) Note the different total volumes for the various spectra.

Bottom, difference absorption spectra at various stages of purification

of the L246C mutant of CphB: affinity chromatography before (solid

lines) and after addition of PCB (dashed lines) The dashed curves

show the spectra after addition of PCB to the assembled chromprotein.

The apparent rise of the absorbances is due to the underlying broad

absorbance of unbound PCB (see for comparison the identical

dif-ference spectra).

Fig 8 Lifetime-associated difference spectra of the CphB/PCB com-plex For details see caption to Fig 6.

CphA-PCB and other phytochromes, microsecond and

longer millisecond-to-second kinetics do not appear

In addition to the above recombinant CphB, another

construct with the earliest possible translation starting site

was cloned and expressed in E coli (Fig 2) This long

CphB apoprotein exhibited no differences to the results

discussed above regarding expression level, noncovalent

assembly with PCB, and Prand Pfrabsorption spectra (data

not shown)

The capability of apo-CphB to induce a

phytochrome-like photochemistry in noncovalently bound tetrapyrrole

chromophores prompted us to generate a point mutation

introducing a potentially covalently binding cysteinyl

resi-due This mutant apoprotein (CphB L246C), when

incuba-ted with PCB, formed a Pr-like absorption band with an

absorption maximum at 653 nm, and showed

photochem-ical reactivity with the formation of a Pfr-like absorption

band with kmaxat 697 nm, very similar to the absorption

maxima of CphA (Fig 7, bottom, solid lines) Also similar

to the behavior of CphA and different to the CphB/PCB

complex, the mutant protein, when assembled with PCB,

did not loose the chromophore upon affinity

chromatogra-phy Accordingly, no absorbance increase could be

observed when additional PCB was added to the eluted

protein (dashed curves in Fig 7, bottom)

D I S C U S S I O N

Initially based on sequence alignments, and followed by the

characterization of recombinant proteins, a new type of

signal transduction components has been identified in

cyanobacteria and other, nonphotosynthetic prokaryotes

The discovery of proteins with sequence similarity and the

capability to bind tetrapyrrole chromophores in a manner

reminiscent of the plant phytochromes, and their

interac-tion, via autophosphorylation upon an incoming stimulus

and phosphate transfer to a response regulator, connects the

light perception known from plants to the well characterized

two-component signal transduction of bacteria [19] The

similarities of the prokaryotic photoreceptors with plant

phytochromes relate to the kinase motifs in the C-terminal

domain and to large portions of the proteins in the

N-terminal part that include the chromophore-binding

domain [8–11,13,14,16,21]

The interesting case in the results presented here is the

finding that Calothrix comprises two bacterial

phyto-chromes, one binding the chromophore covalently, and

the other, only tested under in vitro conditions, incorporates

the chromophore noncovalently Yet, as shown by

func-tional studies, both chromoproteins undergo light-induced

auto- and trans-phosphorylation One of the new proteins

(CphA of Calothrix sp.) and the previously characterized

photoreceptor of the cyanobacterium Synechocystis sp [9]

exhibit strong sequence similarities In contrast, its paralog,

CphB, lacks the chromophore-binding cysteinyl residue,

carrying a leucyl residue instead, and it shows lower

sequence similarities The same codon change occurs also

in the sequence of the phytochrome-like protein AphB of

the cyanobacterium Anabaena sp., the genome of which has

recently been sequenced completely (GenBank accession no

AB034952) It is not yet known whether these

phyto-chrome-like proteins in the cyanobacterial cell contain any

chromophore at all or, if not, whether they would be

capable of covalently binding a chromophore (of the linear tetrapyrrole type or of any other structure) if incubated

in vitro This is of particular interest in conjunction with some other phytochrome-like proteins, the chromophore-protein binding domains of which also deviate markedly from the plant phytochromes Several groups [11,13,14] have reported naturally occurring phytochrome-like chromoproteins which lack the cysteinyl and/or other amino-acid residues close to the binding site essential in plant phytochromes for the covalent chromophore attach-ment In fact, the investigation of factors being essential for inducing a phytochrome-like photochemistry is currently performed with strong activity [14,15,30] These studies become of even stronger interest after the recent demon-stration that this induction of photochemistry is apparently not restricted to the prokaryotic phytochromes, but also a plant phytochrome apoprotein (apo-phyA of oat) can incorporate a PCB-like chromophore with photochemical activity, even when the binding capability of the chromo-phore has been inactivated chemically [31] The lack of the chromophore-binding cysteine in some of the above-men-tioned phytochrome-like proteins has triggered investiga-tions on the type of interaction between chromophore and protein Based on studies on D radiodurans [14,15], also lacking the cysteinyl residue for covalent binding of a tetrapyrrole, but carrying a histidine at a position similar to that of CphB, a covalent bond formation between the biliverdin and the histidinyl residue via a Schiff base has been proposed Similar experiments performed with CphB, which was incubated with biliverdin IXa, show that no stable bond formation can be detected, yet, a photochem-istry similar to that of the phytochromes can be induced [30]

Nevertheless, the possibility that, despite their sequence similarities to the chromophore-binding domain of other receptors of this class, AphB and CphB may monitor a different type of external stimulus, can a priori not be excluded

The fact that both the cphA and cphB genes are expressed

in Calothrix sp., the sequence similarity throughout the total ORFs, and the similar genome structure (i.e the presence of

a response regulator directly downstream from the receptor gene) strongly suggest, however, that the two gene products

of Calothrix sp and the Synechocystis chromoprotein belong indeed to the same two-component signal-transduc-ing receptor category In the experiments reported here, both recombinant apoproteins, CphA and CphB, were able

to incorporate PCB as a chromophore, and to undergo reversible Pr-to-Pfrphotoconversions The question whether either of these proteins is associated also in vivo with a chromophore, and with which type of chromophore, however, remains open at this time, and is currently very difficult to answer due to the low concentration of these proteins in the cyanobacterial cells, although in the case of Cph1 from Synechocystis, PCB could be identified as the

in vivoincorporated chromophore [32]

For the in vitro generated CphB/PCB complex one should note several distinct differences to other cyanobac-terial phytochrome-like chromoproteins with respect to the red shifts of the Pr-and Pfr-like absorption maxima, kinetics

of chromophore incorporation and Pfr formation upon irradiation (Figs 7 and 8), evidently reflecting the altered chromophore–protein interactions The results from the

CphB L246C mutant that shows spectra very similar to

those from CphA give strong evidence that the exchange of

solely the covalently binding residue converts CphB into a

normal cyanobacterial phytochrome The loss of the

phytochrome-like absorbance during affinity

chromatogra-phy of the CphB/PCB complex, taken together with the

absolute stability of the point-mutated (L246C) protein

under the same experimental conditions, is a clear proof for

the unstability, or noncovalent character, of the

chromo-phore–protein interactions

In contrast, the CphA–PCB chromoprotein and its

Synechocystisortholog Cph1–PCB [16,17] are remarkably

similar to each other with respect to assembly kinetics, Pr

and Pfr absorption maxima positions, and even Pr-to-Pfr

conversion kinetics In fact, the similar formation of a

far-red shifted intermediate during the assembly process (found

in both cyanobacterial proteins, Cph1 and CphA) has not

been found in any plant-derived phytochrome on that time

scale The strong red shift of this intermediate points to a

protonation of the protein-adsorbed chromophore prior to

or during the incorporation into the protein binding site It

is worth noting that this assembly intermediate is not

observed in the formation of the CphB/PCB complex,

another indication for the different chromophore–protein

interaction in this peculiar protein

The thermal stability of the Pfrform of CphA in the dark,

which is nearly identical to that of the recombinant

Synechocystis protein, is greater than that for any plant

phytochrome studied so far [28] However, a process of

protonation/deprotonation, evident from a strong isotope

effect in the Synechocystis phytochrome photoconversion

[17], could not be detected in CphA The finding that the Pr

-to-Pfrconversion is not affected by addition of ATPand/or

response regulator does not contradict a protein–protein

interaction during the phosphotransfer between receptor

and response regulator [29] The fact that the kinetics

remain undisturbed upon the addition of ATPor the

interacting response regulator allows to suggest that this

protein–protein interaction occurs in the Pfr state of the

CphA or CphB

With the finding of two new receptor proteins in

Calothrixsp., associated with two response regulators, the

principle of detection and response to external stimuli is

farther extended into the prokaryotic phylum and illustrates

the broad spread of light-driven two-component signal

transduction

A C K N O W L E D G E M E N T S

We thank Tanja Berndsen, Gu¨l Koc and Helene Steffen,

Max-Planck-Institut fu¨r Strahlenchemie, Mu¨lheim an der Ruhr, for their technical

assistance This work was financially supported by the Institut Pasteur

and the CNRS URA 1129 and by the Fonds der Chemischen Industrie

(B Q.).

R E F E R E N C E S

1 Kendrick, R.E & Kronenberg, G.H.M., eds (1994)

Photo-morphogenesis in Plants, 2nd edn Kluwer Academic Publishers,

Dordrecht, the Netherlands.

2 Quail, P.H (1997) The phytochromes: a biochemical mechanism

of signaling in sight? Bioessays 19, 571–579.

3 Braslavsky, S.E., Ga¨rtner, W & Schaffner, K (1997) Phyto-chrome photoconversion Plant Cell Env 20, 700–706.

4 Tandeau de Marsac, N (1983) Phycobilisomes and complement-ary chromatic adaptation in cyanobacteria Bull Inst Pasteur 81, 201–254.

5 Tandeau de Marsac, N & Houmard, J (1993) Adaptation of cyanobacteria to environmental stimuli – new steps towards molecular mechansims FEMS Microbiol Rev 104, 119–190.

6 Grossman, A.R., Schaefer, M.R., Chiang, G.G & Collier, J.L (1994) The responses of cyanobacteria to environmental condi-tions: light and nutritients In The Molecular Biology of Cyano-bacteria (Bryant, D.A., ed.), pp 641–675 Kluwer Academic Publishers, New York.

7 Fujita, Y., Murakami, A., Aizawa, K & Ohki, K (1994) Short-term and long-Short-term adaptation of the photosynthetic apparatus: homeostatic properties of thylakoids In The Molecular Biology of Cyanobacteria (Bryant, D.A., ed.), pp 677–692 Kluwer Academic Publishers, New York.

8 Kaneko, T., Sato, S., Kotani, H., Tanaka, A., Asamizu, E., Nakamura, Y., Miyajima, N., Hirosawa, M., Sugiura, M., Sasa-moto, S., Kimura, T et al (1996) Sequence analysis of the genome

of the unicellular cyanobacterium Synechocystis sp strain PCC6803 II Sequence determination of the entire genome and assignment of potential protein-coding regions DNA Res 3, 109–136.

9 Hughes, J., Mittmann, F., Wilde, A., Ga¨rtner, W., Bo¨rner, T., Hartmann, E & Lamparter, T (1997) A prokaryotic phyto-chrome Nature 386, 663.

10 Park, C.-M., Shim, J.-Y., Yang, S.-S., Kang, J.-G., Kim, J.-I., Luka, Z.A & Song, P.-S (2000) Chromophore–apoprotein interactions in Synechocystis sp PCC6803 phytochrome Cph1 Biochemistry 39, 1409–1412.

11 Kehoe, D.M & Grossmann, A.R (1996) Similarity of a chromatic adaptation sensor to phytochrome and ethylene receptors Science

273, 1409–1412.

12 Cobley, J.G., Zerweck, E., Reyes, R., Mody, A., Seludo-Unson, J.R., Jaeger, H., Weerasuriya, S & Navankasattusas, S (1993) Construction of shuttle plasmids which can be effectively mobi-lized from Escherichia coli into the chromatically adapting cya-nobacterium, Fremyella diplosiphon Plasmid 30, 90–105.

13 Jiang, Z.Y., Swem, L.R., Rushing, B.G., Devanathan, S., Tollin, G & Bauer, C.E (1999) Bacterial photoreceptor with similarity to photoactive yellow protein and plant phytochromes Science 285, 406–409.

14 Davis, S.J., Vener, A.V & Vierstra, R.D (1999) Bacter-iophytochromes: Phytochrome-like photoreceptors from non-photosynthetic eubacteria Science 286, 2517–2520.

15 Bhoo, S.H., Davis, S.J., Walker, J.M., Karniol, B & Vierstra, R.D (2001) Bacteriophytochromes are photochromic histidine kinases using a biliverdin chromophore Nature 414, 776–779.

16 Lamparter, T., Mittmann, F., Ga¨rtner, W., Bo¨rner, T., Hart-mann, E & Hughes, J (1997) Characterization of recombinant phytochrome from the cyanobacterium Synechocystis Proc Natl Acad Sci USA 94, 11792–11797.

17 Remberg, A., Lindner, I., Lamparter, T., Hughes, J., Kneip, C., Hildebrandt, P., Braslavsky, S.E., Ga¨rtner, W & Schaffner, K (1997) Raman spectroscopic and light-induced kinetic character-ization of a recombinant phytochrome of the cyanobacterium Synechocystis Biochemistry 36, 13389–13395.

18 Yeh, K.-C., Wu, S.-H., Murphy, J.T & Lagarias, J.C (1997) A cyanobacterial phytochrome two-component light sensory system Science 277, 1505–1508.

19 Parkinson, J.S & Kofoid, E.C (1992) Communication modules in bacterial signaling proteins Annu Rev Genet 26, 71–112.

20 Wurgler-Murphy, S.M & Saito, H (1997) Two-component signal transducers and MAPK cascades Trends Biochem Sci 22, 172–176.

21 Herdman, M., Coursin, T., Rippka, R., Houmard, J & Tandeau

de Marsac, N (2000) A new appraisal of the prokaryotic origin of

eukaryotic phytochromes J Mol Evol 51, 205–213.

22 Rippka, R., Deruelles, J., Waterbury, J.B., Herdman, M & Stanier,

R.Y (1979) Generic assignments, strain histories and properties of

pure cultures of cyanobacteria J Gen Microbiol 111, 1–61.

23 Sambrook, J., Fritsch, E.F & Maniatis, T (1989) Molecular

Cloning, 2nd edn Cold Spring Harbor Laboratory Press, New

York.

24 Dower, W.J., Miller, J.F & Ragsdale, C.W (1988) High efficiency

transformation of E coli by high voltage electroporation Nucleic

Acids Res 16, 6127–6145.

25 Mazel, D., Guglielmi, G., Houmard, J., Sidler, W., Bryant, D.A.

& Tandeau de Marsac, N (1986) Green light induces transcription

of the phycoerythrin operon in the cyanobacterium Calothrix

7601 Nucleic Acids Res 14, 8279–8290.

26 Remberg, A., Schmidt, P., Braslavsky, S.E., Ga¨rtner, W &

Schaffner, K (1999) Differential effects of mutations in the

chro-mophore pocket of recombinant phytochrome on chromoprotein

assembly and P r -to-P fr photoconversion Eur J Biochem 266,

201–208.

27 Lamparter, T., Esteban, B & Hughes, J (2001) Phytochrome

Cph1 from the cyanobacterium Synechocystis PCC6803 –

purifi-cation, assembly, and quaternary structure Eur J Biochem 268, 4720–4730.

28 Schmidt, P , Gensch, T., Remberg, A., Ga¨rtner, W., Braslavsky, S.E & Schaffner, K (1998) The complexity of the P r fi P fr

phototransformation kinetics is an intrinsic property of homo-geneous native phytochrome Photochem Photobiol 68, 754–761.

29 Hu¨bschmann, T., Jorissen, H.J.M.M., Bo¨rner, T., Ga¨rtner, W & Tandeau de Marsac, N (2001) Phosphorylation of proteins in the light-dependent signalling pathway of a filamentous cyano-bacterium Eur J Biochem 268, 3383–3389.

30 Jorissen, H.J.M.M., Quest, B., Lindner, I., Tandeau de Marsac, N & Ga¨rtner, W (2002) Phytochromes with non-covalently bound chromophores: The capability of apophyto-chromes to direct tetrapyrrole photoisomerization Photochem Photobiol 75, 554–559.

31 Lindner, I., Braslavsky, S.E., Schaffner, K & Ga¨rtner, W (2000) Model studies of phytochrome photochromism: Protein-mediated photoisomerization of a linear tetrapyrrole in the absence of covalent binding Angew Chem Int., ed Engl 39, 3269–3271.

32 Hu¨bschmann, T., Bo¨rner, T., Hartmann, E & Lamparter, T (2001) Characterization of the Cph1 holo-phytochrome from Synechocystis sp PCC 6803 Eur J Biochem 268, 2055–2063.