The orientation of the two central hydroxy groups influences the positioning of the inhibitor in the active site and thereby the structure of the protease.. The significance of this discre
Trang 1Optimization of P1–P3 groups in symmetric and asymmetric
HIV-1 protease inhibitors
Hans O Andersson1, Kerstin Fridborg1, Seved Lo¨wgren1, Mathias Alterman2, Anna Mu¨hlman4,
Magnus Bjo¨rsne4, Neeraj Garg2, Ingmar Kvarnstro¨m3, Wesley Schaal2, Bjo¨rn Classon4,
Anders Karle´n2, U Helena Danielsson5, Go¨ran Ahlse´n5, Ullrika Nillroth5, Lotta Vrang6, Bo O¨berg6,
Bertil Samuelsson4, Anders Hallberg2and Torsten Unge1
1 Institute of Cell and Molecular Biology, Uppsala, University, Sweden; 2 Department of Organic Pharmaceutical Chemistry, Uppsala University, Sweden;3Department of Chemistry, Linko¨ping University, Sweden;4Department of Organic Chemistry, Stockholm University, Sweden;5Department of Biochemistry, Uppsala University, Sweden;6Medivir AB,
Lunastigen 7, Huddinge, Sweden
HIV-1 protease is an important target for treatment of
AIDS, and efficient drugs have been developed However,
the resistance and negative side effects of the current drugs
has necessitated the development of new compounds with
different binding patterns In this study, nine C-terminally
duplicated HIV-1 protease inhibitors were cocrystallised
with the enzyme, the crystal structures analysed at 1.8–2.3 A˚
resolution, and the inhibitory activity of the compounds
characterized in order to evaluate the effects of the individual
modifications These compounds comprise two central
hydroxy groups that mimic the geminal hydroxy groups of a
cleavage-reaction intermediate One of the hydroxy groups is
located between the d-oxygen atoms of the two catalytic
aspartic acid residues, and the other in the gauche position
relative to the first The asymmetric binding of the two
central inhibitory hydroxyls induced a small deviation from exact C2 symmetry in the whole enzyme–inhibitor complex The study shows that the protease molecule could accom-modate its structure to different sizes of the P2/P2¢ groups The structural alterations were, however, relatively conser-vative and limited The binding capacity of the S3/S3¢ sites was exploited by elongation of the compounds with groups
in the P3/P3¢ positions or by extension of the P1/P1¢ groups Furthermore, water molecules were shown to be important binding links between the protease and the inhibitors This study produced a number of inhibitors with Kivalues in the
100 picomolar range
Keywords: AIDS; drug; HIV; protease; X-ray
An absolute necessity for the assembly and production of
infectious HIV-1 particles is the proteolytic processing of the
gag and gag-pol polyproteins into functional enzymes and
structural proteins [1–3] The pol-gene-encoded protease,
which is responsible for this key function, has been selected
as a target for intervention of the HIV-1 infection with
antiviral drugs [4–7] Numerous competitive inhibitors of
the protease have been prepared [8,9] The Food and Drug
Administration (FDA) has approved six inhibitors:
ampre-navir, indiampre-navir, lopiampre-navir, nelfiampre-navir, ritonavir and
saqui-navir [10] The side effects of these inhibitors and the clinical
emergence of resistant mutants in HIV-1 means that new
protease inhibitors need to be developed [11,12]
The HIV-1 protease is a C2 symmetric homodimer [13,14] The protein monomer consists of 99 amino acids The active site, with the two catalytic aspartate residues Asp25 and Asp125, is located at the interface between the two monomers Two b-hairpin structures, called flaps, are positioned over the active site They undergo structural changes on binding of the inhibitor molecule In the unliganded protease structure, the conformation of the flaps is open, thereby exposing the active site, whereas
in the ligand complex, the flaps form a roof over the active site and the ligand The flaps cover to a large extent the bound ligand This arrangement is advantageous for the design of inhibitors, because it offers a large number of tight interactions between the enzyme and the inhibitor The active site contains eight C2-symmetric subsites (S4, S3, S2, S1, S1¢, S2¢, S3¢, and S4¢) [15] These are the binding sites for the P4, P3, P2, P1, P1¢, P2¢, P3¢, and P4¢ residues of an octapeptide substrate [16] Thus the N-terminal and C-terminal parts of a bound substrate, or the corresponding parts of the inhibitor, will interact with structurally similar subsites To exploit the C2 symmetry of the protease– substrate complex, N-terminally or C-terminally duplicated C2-symmetric inhibitors have been designed [17–20] The finding that a point mutation could completely abolish the inhibitory activity of the symmetric compounds highlights the weakness of this type of compound [21] Drug-resistant
Correspondence to T Unge, Institute of Cell and Molecular Biology,
BMC, Box 590, Uppsala University, SE-751 24, Uppsala, Sweden.
Tel.: + 46 18 471 49 85,
e-mail: Torsten.Unge@icm.uu.se
Enzyme: HIV-1 protease, POL_HV1B1 (P03366) (EC 3.4.23.16).
Note: The refined co-ordinates of HIV-1 protease in complex with
compounds 1–9 have been deposited in the RCSB Protein Data Bank
under the file names, 1EBW, 1EBY, 1EBZ, 1D4I, 1D4H, 1D4J,
1EC1, 1EC2 and 1EC3.
(Received 9 December 2002, revised 18 February 2003,
accepted 21 February 2003)
Trang 2forms of the protease have been studied with respect to
kinetic and resistance properties [22] New generations of
mainly asymmetric compounds have been developed with
high inhibitory activity against resistant variants of the
protease [23–25]
We here report crystallographic studies of C-terminally
duplicated C2-symmetric and asymmetric inhibitors in
complex with the HIV-1 protease These compounds,
including the C2-symmetric ones, were found to bind in
an asymmetric fashion Kivalues in the 100 picomolar range
were obtained for a number of these inhibitory compounds
[26,27]
Materials and methods
Expression of HIV-1 protease
The plasmid pBH10 containing the pol gene of the HIV-1
BH10 isolate was a gift from R Gallo (National Cancer
Institute, Bethesda, MD, USA) The protease gene was
isolated by PCR with the upstream primer GAACA
TATGGCCGATAGACAAGGAACTGTATCC and the
downstream primer AGGGGATCCCTAAAAATTTAA
AGTGCAACCAATCTG The annealing site for the
upstream primer corresponds to 12 amino acids before the
protease sequence These extra amino acids were added to
make autolytic processing of the precursor protein possible,
enabling confirmation that the N-terminus was correct
Through PCR, the protease DNA fragment was provided
with an NdeI restriction site at the 5¢ end and a BamHI site
at the 3¢ end These sites were used for the ligation to the
pET11a expression vector The Escherichia coli strains XL-1
and HB101 were used as hosts for cloning
Protein was expressed in the E coli strain BL21
(DE3) Bacteria were grown in Luria–Bertani medium
to an D550of 1.0 before induction with 0.5 mMisopropyl
thio-b-D-galactoside Cells were harvested after 3 h of
induction
Purification of HIV-1 protease
The chromatographic steps were performed at 5C SDS/
PAGE was used after each chromatographic step to
monitor the purification Cells were suspended in lysis
buffer (20 mM Tris/HCl, pH 7.5, 10 mM dithiothreitol,
1 mM phenylmethanesulfonyl fluoride) and lysed in a
French press The lysate was centrifuged for 30 min at
12 100 g The insoluble inclusion body fraction, which
contained more than 90% of the expressed material, was
dissolved in buffer (8M urea, 20 mM Tris/HCl, pH 8.5,
10 mM NaCl, 10 mM dithiothreitol, 1 mM EDTA) and
centrifuged for 1 h at 48 200 g
The supernatant was applied to a POROS Q column
(Roche) The flow-through fraction was collected and
diluted to a final protein concentration of 0.3 mgÆmL)1
Refolding was performed by dialysis against 20 mMsodium
phosphate buffer, pH 6.5, containing 10 mMdithiothreitol
and 1 mMEDTA The refolded protein was diluted with an
equal volume of 50 mM Mes, pH 6.5, containing 1 mM
dithiothreitol and 1 mMEDTA, applied to a POROS HS
column (Roche), and eluted with a linear gradient of
0–0.6 NaCl in Mes buffer The pooled fractions were
precipitated with (NH4)2SO4 The precipitate was collected
by low-speed centrifugation and dissolved in 50 mMMes,
pH 6.5, containing 10 mMdithiothreitol, 100 mM 2-mercap-toethanol and 1 mMEDTA The solution was desalted on a PD-10 column (AP Biotech AB, Uppsala, Sweden) and concentrated by ultrafiltration with Centricon Centrifugal Filter Units to 2 mgÆmL)1
Enzyme activity and inhibition studies Enzyme activity/inhibition studies were performed as des-cribed by Nillroth et al [28] The method includes active-site titrations Briefly, a fluorimetric assay was used to determine the effects of the inhibitors on HIV-1 protease This assay used an internally quenched fluorescent peptide substrate, DABSYL-c-Abu-Ser-Gln-Asn-Tyr-Pro-Ile-Val-Gln-EDANS (Bachem, Bubendorf, Switzerland) The measure-ments were performed in 96-well plates with a Fluoroscan plate reader (Labsystems, Helsinki, Finland) Excitation and emission wavelengths were 355 nm and 500 nm, respectively
Anti-HIV activity was assayed in vitro in MT4 cells using the vital dye XTT to monitor the cytopathogenic effects [29]
Crystallization Crystallization was performed at 4C with the hanging drop vapour-diffusion method Protease (5 lL) at a concentration of 2.0 mgÆmL)1 in buffer consisting of
50 mM Mes, pH 6.5, 10 mM dithiothreitol and 1 mM EDTA was mixed with an equal volume of the reservoir solution The reservoir solution contained 50 mM Mes,
pH 5.5, and 0.5M NaCl The drops were microseeded after 2 days with seeds from protease/inhibitor crystals belonging to space group P21212 Crystals appeared after
1 week, and grew to a final size of 0.3· 0.3 · 0.05 mm in 3–4 weeks
Data collection and processing X-ray data were recorded on MAR-imaging plates on the synchrotron beam lines 9.5 DRAL at Daresbury, UK, DL41 and DW32 at Lure, France, and I711 at MAX-lab Lund, Sweden The programsDENZOandSCALEPACKwere used for processing and scaling [30,31] A summary of data collection statistics is given in Table 1
Structure refinement Refinement was performed using the program packageCNS [32] The protease model co-ordinates from 1AJV were used for molecular replacement calculations The starting model was refined with rigid-body refinement and simulated annealing The difference Fourier map (Fo–Fc) clearly showed the position and orientation of the inhibitor together with a large number of water molecules The inhibitor was built into the electron density with the help of the program O [33] Water molecules were added to the structures determined from the difference Fourier maps at chemically acceptable sites Only solvent molecules with B
v alues less than 50 A˚2 were accepted Several cycles of
Trang 3minimization, simulated annealing, and B-factor refinement
were performed for each complex, accompanied by manual
rebuilding The Rcrystal and Rfree factors were used to
monitor the refinement [34,35] The refinement statistics are
shown in Table 1
Graphics
All the figures were drawn with the programsSWISS-
PDB-VIEWER [36] (http://www.expasy.ch/spdbv/) and POV-RAY
(http://www.povray.org/)
Results and Discussion
Inhibitor properties
The linear C-terminally duplicated inhibitors in this study
encompass a central six-carbon skeleton derived from
L-mannaric acid (Table 2) Five of the inhibitors [1,2,7–9]
are chemically C2 symmetric Seven of these nine
compounds exhibit Ki values in the nanomolar or
low-nanomolar range, with antiviral effects (ED50) ranging from
>75 l (compound 6) to 0.04 l [7]
Crystallographic calculations The crystal structures of the nine inhibitors in complex with HIV-1 protease were determined to high resolution (Table 1) All the complexes were crystallized in the orthorhombic space group P21212 The asymmetric unit contained the whole protease molecule This means that even though the crystal packing contains twofold axes, these do not impose twofold symmetry on the inhibitor– protease complex In the database of HIV and simian immunodeficiency virus protein–complex structures (http://www.ncifcrf.gov/HIVdb), there are examples of structures in which the inhibitors are uniquely oriented, but also structures in which the corresponding electron density represents two orientations of the inhibitor [37,38] For the structures presented here, the electron densities of the inhibitors, especially the densities of the side groups of the asymmetric compounds, indicate a unique orientation
of the protease–inhibitor complex in the crystal lattice (Fig 1)
The orientation of the two central hydroxy groups influences the positioning of the inhibitor in the active site and thereby the structure of the protease
Table 1 Crystallographic structure determination statistics R merge ¼ SjI i )<I>/SI i , where I i is an observation of the intensity of an individual reflection and <I> is the average intensity over symmetry equivalents R crystal ¼ SjjF o j)jF c jj/SjF o j, where Fo and Fc are the observed and calculated structure factor amplitudes, respectively R free is equivalent to R crystal but calculated for a randomly chosen set of reflections that were omitted from the refinement process Ideal parameters are those defined by Engh & Huber [55].
Data collection details
Space group P2 1 2 1 2 P2 1 2 1 2 P2 1 2 1 2 P2 1 2 1 2 P2 1 2 1 2 P2 1 2 1 2 P2 1 2 1 2 P2 1 2 1 2 P2 1 2 1 2 Wavelength (A˚) 0.920 1.386 0.970 1.375 1.375 1.375 0.970 0.958 0.958
Cell dimensions (A˚)
a ¼ 59.04 59.15 58.84 58.62 58.46 58.78 58.12 58.48 58.89
b ¼ 86.83 86.98 86.66 86.32 86.31 86.52 86.11 86.67 86.70
c ¼ 46.98 47.16 46.87 46.69 46.57 46.58 46.11 46.52 46.70
d min (A˚) 1.80 2.30 2.00 1.81 1.81 1.81 2.10 2.00 1.90
No of observations 42993 28849 55336 95666 61625 92684 35374 44926 62391
No of unique reflections 16613 10685 15626 21735 20047 21687 13120 15612 18784 Completeness (%) 69.7 93.8 95.9 97.5 90.5 97.2 93.1 92.9 95.7
Reflections I >2 r (%) 63.0 84.1 83.4 84.6 79.7 80.5 77.1 72.5 90.4 Reflections I >2 r in
highest resolution shell (%)
9.4 74.2 70.1 60.8 52.5 51.1 63.1 61.0 79.2 Bin resolution (A˚) 1.86–1.80 2.40–2.30 2.07–2.00 1.87–1.81 1.87–1.81 1.87–1.81 2.18–2.10 2.07–2.00 1.97–1.90 Refinement statistics
Resolution range (A˚) 24.6–1.81 24.0–2.30 24.6–2.01 27.9–1.81 22.6–1.81 15.0–1.81 24.3–2.10 24.7–2.00 24.3–2.10
R free (%) 21.8 20.0 20.3 222.4 23.4 23.1 23.7 23.9 23.7
No of atoms 1677 1662 1647 1697 1694 1655 1676 1688 1688 Mean B factors (A˚ 2 )
Protein 19.6 20.2 20.2 20.2 20.4 25.6 18.3 17.4 23.4 Inhibitor 16.8 12.9 18.1 16.5 20.0 23.8 14.0 13.4 23.3 All 20.4 20.5 21.0 21.1 21.9 26.3 19.8 18.7 19.8 Deviation from ideality
Bond lengths (A˚) 0.006 0.008 0.006 0.006 0.006 0.006 0.007 0.007 0.007 Angles () 1.3 1.2 1.3 1.2 1.2 1.2 1.4 1.3 1.4 Dihedrals () 25.7 25.4 25.5 25.4 25.3 25.2 25.4 25.4 25.4 Impropers () 0.79 0.77 0.76 0.79 0.82 0.85 0.77 0.75 0.77
Trang 4The inhibitors in this study (excep compound 4) contain
two central hydroxy groups that mimic the geminal hydroxy
groups of an intermediate in the cleavage reaction [39] A
completely symmetric arrangement of these inhibitors in the
active site would require a twofold symmetrical
arrange-ment of the two hydroxyls and consequently identical
binding patterns to the catalytic residues (Asp25/Asp125) However, a symmetrical arrangement of the central hydroxyls was not found for either the symmetric or the asymmetric compounds Instead, one of the hydroxy groups was placed at hydrogen-bonding distance (2.7 A˚) between the d-oxygen atoms of the two aspartic acid residues (Figs 1
Table 2 Inhibitor structure, enzyme inhibition and antiviral activity in MT4-cell culture ED 50 values for reference substances tested in the same assay: ritonavir (ED 50 0.06 l M ), indinavir (ED 50 0.06 l M ), saquinavir (ED 50 0.01 l M ) and nelfinavir (ED 50 0.04 l M ) Compound 4 was synthesized with only one central hydroxy group.
Compound no A B C K i (n M ) ED 50 (l M )
Trang 5and 2), and the other hydroxy group was in gauche position
relative to the first, hydrogen-bonded to one of the
aspartates (2.8 A˚) and had van der Waals interaction with
Cb of Ala28 (Ala128) at a distance of 3.9 A˚ The same
arrangement has been observed for other C2-symmmertric
diol-containing inhibitors [40] As a direct consequence of
this arrangement, the twofold symmetry axis of the inhibitor
will not coincide with the protease twofold axis Despite the
ability of the protease to adapt to differences in the size of
the inhibitor side groups, a comparison between the left and
right binding sites reveals small but significant differences in
bond lengths This is exemplified by the observation that the
distance between the P1 benzyl group of compound 1 to
Arg8 was 4.0 A˚ whereas the distance from P1¢ to Arg108
was 3.6 A˚ The significance of this discrepancy is apparent
from a comparison with the HIV-1 protease–inhibitor
structure 4phv, which contains an inhibitor homologous to
compound 2 but with only one central hydroxy group and
which is also shorter by one carbon in the central part of the
inhibitor [41] In this structure, the distances between the P1/ P1¢ benzyl groups and Arg8/Arg108 were 4.0 and 3.9, respectively Thus, like the natural protein substrate, the inhibitors, including the symmetric ones, tend to bind in an asymmetric fashion [40,42] Compounds 3, 5 and 6 were made in order to exploit the asymmetric binding
Electron density maps revealed a preference for the same arrangement of the central hydroxyls for compounds 1, 3 and 5–8 (see Figs 1, 2 and 4) Compound 4, with only one central hydroxyl, had it arranged as in compounds 1,3 and 5–8 Preference for the opposite arrangement was found for compound 9 (see Fig 6) However, the central hydroxyls were not completely uniquely arranged in any of the structures of compounds 1–3 or 5–9 Degrees of uniqueness varied from 75 to 90% For the asymmetric compound 3, the density indicated a 90% unique orientation (Fig 1) Small but significant deviations from exact C2 symmetry were also observed in parts of the protease structure connected with movement of the flaps Application of a
Fig 1 Orientation of the inhibitor in the active site and arrangement of the central vicinal hydroxyls (stereo view) The figure shows the structure of the asymmetric compound 3 as it is arranged in the HIV-1 protease active site The electron density map indicates a unique orientation of the inhibitor and the whole protease–inhibitor complex in the crystal lattice The density also indicates an 90% unique orientation of the central vicinal hydroxy groups in the complex with this compound The Fo–Fc electron density map was calculated at 2.0 A˚ resolution with the inhibitor compound omitted, and contoured at 2.5 r.
Fig 2 Positioning of the inhibitor in the active site and hydrogen-bond network One of the inhibitor hydroxyls has extensive contacts with the catalytic Asp25/Asp125 The hydrogen-bond distances are short (2.7–2.8 A˚) The gauche hydroxy group is hydrogen-bonded to one of the catalytic aspartate residues Gly27/Gly127 contribute to the active-site hydrogen-bond network by donation of hydrogens via the main-chain amide groups These two compounds 1 and 2 represent the two groups of inhibitors in this study Compound 1 (A) has 10 and compound 2 (B) has 8 hydrogen-bond donors/acceptors In the latter case, two water molecules remain co-ordinated to the G48/G148 carbonyl groups after complex formation.
Trang 6least-squares superimpositioning of chain A on B showed
an average difference of 0.9 A˚ between Ca atoms in the flap
region and in the b-strands with amino acids 15–18, 37–41,
59–64 and 71–74 (not shown) Consequently, significant
differences in the binding pattern were observed for the
chemically identical P1/P1¢, P2/P2¢ and P3/P3¢ groups The
asymmetric positioning of the inhibitor in the protease
substrate-binding site, especially the interactions between
the inhibitor and the flaps, may be the major reason for
these structural differences However, crystal-packing
inter-actions, which in this space group are different for the two
peptide chains, may contribute to the asymmetry of the
protease
Interactions between the central inhibitor hydroxy
groups and the active-site aspartate residues
The oxygen atom of the hydroxy group, which is positioned
symmetrically above the catalytic Asp25/Asp125, is
hydro-gen-bonded to the carboxylate oxygens of the aspartates at
distances between 2.63 and 2.89 A˚ (Fig 2, Table 3) This
position is 1.4 A˚ away from the position of the catalytic
water as suggested by the structure of the hydrated
difluoroketone inhibitor A79285 (1DIF) [39] The active
site of the inhibitor complex is rich in hydrogen bonds In
addition to the abundant hydrogen-bond network involving
the inhibitor, the main-chain amide nitrogen atoms of
Gly27 and Gly127 are hydrogen-bonded to the carboxylate
oxygens Asp25 OD1 and Asp125 OD1, respectively, at
distances of 2.8–2.9 A˚ The position and orientation of
G27/G127 is to a large extent determined by the stabilizing
hydrogen-bond network, which involves the second
mem-ber of the catalytic triad T26/T126 [43] The close packing of
the central hydroxy group between the aspartic carboxylates
is a common property of not only the compounds in this
series but also of other linear inhibitors [44] The positioning
of the inhibitor in the active site results in a tight interaction
between the inhibitor’s hydroxy group and the catalytic
residues This close positioning of the inhibitor’s hydroxyl to
the carboxylate oxygens is not only caused by the attraction
between these groups, but also by the interactions between
the inhibitor’s side chains and the S1-S3 site residues This
was revealed by a comparison with the position of a
homologous inhibitor that lacked the co-ordinating central
hydroxy group (unpublished data)
Binding contribution by the gauche hydroxy group
The central gauche hydroxy group of these compounds
mimics the gauche position of the hydrated peptide
carbonyl in a cleavage-reaction intermediate (Fig 2) Its
position is an average distance of 0.3 A˚ from the gauche
hydroxyl in compound A79285, which mimics a hydrated
peptide intermediate [39] To evaluate the binding
contri-butions of this gauche hydroxy group, compound 4 was
synthesized, in which the gauche hydroxy group was
replaced with a hydrogen atom Superimposition of the
compound 2 and 4 protease–inhibitor complexes with
lsq_explicit in the programOresulted in an r.m.s.d value
of 0.18 A˚ for the protein Ca atoms The same
magnitude-of-distance deviations were observed between identical
inhi-bitor atoms There were, however, asymmetric discrepancies
in the P1/P1¢ positions The positions of P1 atoms in compound 4 agreed within 0.1 A˚ with the corresponding atoms of compound 2, as opposed to atoms of P1¢, which were within 0.3 A˚ This led us to conclude that the hydroxy group could be exchanged for a hydrogen atom without any major effects on the positioning of the inhibitor in the active site However, the modification had a negative effect on the
Ki value, which was seven times higher for compound 4 (1.4 nM) than for compound 2 (0.2 nM) Thus, the gauche hydroxy group contributes significantly to the binding capability The contribution, which is complex, includes hydrogen-bonding to Asp25/Asp125, van der Waals
Table 3 Hydrogen bonds between the protease and the inhibitor com-pounds 1, 2, 3 and 5.
Residue Atom Atom
Protease–inhibitor distance (A˚) Compound 1
25 Asp Od1 O27 2.71
25 Asp Od2 O27 2.89
27 Gly O N18 3.13
29 Asp N O24 2.88
48 Gly O N25 2.93
125 Asp Od1 O27 2.74
125 Asp Od2 O27 2.68
125 Asp Od2 O28 2.70
127 Gly O N8 3.12
129 Asp N O14 2.92
148 Gly O N15 2.96 Compound 2
25 Asp Od1 O6 2.64
25 Asp Od2 O6 2.85
27 Gly O N1 3.13
29 Asp N O50 3.02
125 Asp Od1 O6 2.90
125 Asp Od2 O6 2.65
125 Asp Od2 O8 2.71
127 Gly O N12 3.21
129 Asp N O60 3.07
129 Asp Od2 O60 2.86 Compound 3
25 Asp Od1 O6 2.75
25 Asp Od2 O6 2.83
27 Gly O N1 3.16
29 Asp N O46 2.89
48 Gly O N47 2.92
125 Asp Od1 O6 2.72
125 Asp Od2 O6 2.64
125 Asp Od2 O8 2.70
127 Gly O N12 3.13
129 Asp N O60 3.12 Compound 5
25 Asp Od1 O32 2.63
25 Asp Od2 O32 2.88
27 Gly O N44 3.19
125 Asp Od1 O32 2.82
125 Asp Od2 O02 2.66
125 Asp Od2 O32 2.63
127 Gly O N14 2.97
129 Asp N O24 3.10
129 Asp Od2 O24 2.97
Trang 7interactions with Ala28, as well as energy contributions
from restriction of the rotational freedom around the C4
carbon
Overall hydrogen-bond pattern between the inhibitors
and the protease
The compounds in this series contain several
hydrogen-bond donors and acceptors (Fig 2 and Table 3) The
number of hydrogen bonds between the protease and the
inhibitors varies between 7 and 12 (Table 4) The fact that
these inhibitors are all based on the same skeleton is
reflected in the conserved hydrogen-bond pattern between
the different compounds (Table 3) The asymmetric
substi-tutions in the P2 positions do not significantly alter the
pattern of the retained groups All polar groups in the
inhibitors, except the ether link in P1/P1¢, are involved in
hydrogen bonding to the protein, either directly or indirectly
through water molecules Compared with the substrate-like
peptide bond in the P2/P3 positions of compounds 1, 3 and
7–9, substitutions with the indanyl and benzyl groups in P2
led to loss of the hydrogen bond to the carbonyls of Gly48
As expected, because of its position close to the entrance of
the binding site, a water molecule co-ordinates Gly48 in
these complexes (Fig 2B) According to a study by Ala
et al [45], hydrogen bonds contribute less than hydrophobic
interactions to the binding energy However, the overview
of the number of hydrogen bonds and other contacts in
Table 4 indicates that hydrogen bonds, as well as the
close-packing interactions, contribute to the inhibitory efficacy of
the compounds (Table 4) The variations in bond distances indicate potential variation in energy content in the established hydrogen bonds (Table 3) Hydrogen bonds to co-ordinating water molecules are not included in Tables 3 and 4 These are discussed below
Optimization of the P1/P1¢ side chains The HIV-1 protease cleaves the precursor protein at nine positions In seven of these, the P1 or P1¢ amino acid is a phenylalanine or tyrosine By homology, it is natural to use benzyl groups as P1/P1¢substituents on the C2/C5 carbons,
as is the case in a large number of inhibitors In this series of compounds, however, benzyloxy groups are used Through the ether linkage the side chain is elongated by 1.45 A˚ This permits positioning of P1/P1¢ in a position that is almost identical with that in the homologous compound L-700,417, which has only one central hydroxyl and P1/P1¢ benzyl side chains (4PHV [41]) (Fig 3) Even though the ether linkage increases the potential degrees of rotational freedom of the P1/P1¢ side chains, this is not the outcome Rather, the inhibitor becomes more compact The elongation enables close packing of the side chain to the inhibitor backbone and to P2/P2¢ [27] The position of the P1/P1¢ side chains is conserved among these compound complexes of com-pounds 1–8 The oxygen atom in the ether linkage shows only weak interaction with the protein The closest atoms are the Od2 atoms of Asp25/Asp125 at distances of 3.4/ 3.7 A˚ The P1/P1¢ benzyloxy side groups are within a 3.7-A˚ radius of the S1/S1¢ site atoms O of Gly27/Gly127, CG of
Table 4 Summary of the inhibitor/protease interactions Buried surface area was calculated with programs within the CNS package [32] Hydrogen bonds were calculated with a maximum distance of 3.5 A˚ between acceptors and donors An atom/pair distance of less than 3.9 A˚ was used as criterion for a contact.
Compound
Molecular mass (Da)
Buried surface area (A˚2)
No of hydrogen bonds
No of inhibitor/
protease contacts K i (n M )
Fig 3 Comparison between the 3D structures of our compound 2 and compound L-700, 417 (in blue) (4PHV [41]) (stereo view) The two compounds 2 and L-700, 417 have similar C2-symmetric scaffolds, but the scaffold of L-700, 417 is one carbon atom shorter Through the elongation with an ether link in compound 2, the P1/P1¢ benzyl groups superimpose well The two compounds form notably compact structures when bound to the protease.
Trang 8Pro81/Pro181, CG1 of Val82/Val182, and CD1 of Ile84/
Ile184 Within a distance of 4.0 A˚ is CD2 of Leu23/Leu123
Two water molecules in each side of the protease molecule
interacts with P1/P1¢ In the complex with compound 9, the
benzyloxy group is shifted upward by 1.5 A˚ on one of the
sides leading to loss of the interaction with O of Gly127 but
instead making contact with C and O of Gly149
Optimization of the P2/P2¢ side chains
The chemical properties of the natural substrate P2/P2¢
amino-acid residues vary more than these of the P1/P1¢
residues The S2/S2¢ sites contain the hydrophobic amino
acids Ala28/Ala128, Val32/Val132, Ile47/Ile147, Ile84/
Ile184 and Ile150/Ile50, as well as the polar Asp30/Asp130
[16] The P2/P2¢ side chains of the compounds studied here
are manly hydrophobic Thus, the lipophilic groups valinyl
(the side chain of valine) [3,7–9], isoleucinyl (the side chain
of isoleucine) [1], indanyl [2–6], benzyl [5] and
2-chloro-6-fluorobenzyl [6] were explored (Table 2) The interacting
S2/S2¢ ligands were Ala28/Ala128, Asp30/Asp130, Val32/
Val132, Ile47/Ile147 and Ile84/Ile184 Even though the sizes
of the P2/P2¢ side chains differ significantly and penetrate
the binding site with a difference of 2.1 A˚, the positions of
the contacting S2/S2¢ amino acids are relatively conserved
except for those in the 30s and 80s loops The side chain of
Asp30 and Val32 moves as much as 2.0 A˚ and 0.6 A˚,
respectively, to accommodate the benzyl and
2-chloro-6-fluorobenzyl groups of compounds 5 and 6 (Fig 4) Fig 5
shows a summary of the shifts in the Ca positions In
addition to the shifts around amino-acid position 30,
significant shifts of the order of 0.2–0.7 A˚ are observed
around positions 18, 67 and 81 Only the peptide chain
harbouring the S2 site was used in the calculations
The change in position of Asp30 leads to small changes
in the hydrogen-bond networks involving this residue A
comparison with compounds 1, 2 and 3 indicate how the
side chains valinyl, isoleucinyl and indanyl gradually fill
out the S2/S2¢ sites, resulting in the expected improvements
in the Ki values (Table 2) However, the
chlorine-substi-tuted and fluorine-substichlorine-substi-tuted benzyl group of compound
6 created a P2 group that was too large, as reflected by the
high Kivalue of 4.4 nM Because of steric hindrance by the
main-chain carbonyl group of Gly48, the Cl atom had to
be positioned inward against the S2 site and in close contact with Cb of V28 and Cd of I84 The close packing against A28 forces this P2 side chain upward by 0.6 A˚ As
a consequence, the hydrogen bond with the inhibitor backbone amide and Gly27 is broken and replaced by co-ordination of a water molecule This water molecule is co-ordinated by the NH group of the inhibitor, O of Gly27, and N of Asp29 The close packing between the chlorine atom and Cd of I84 displaces the phenyl ring
2 A˚ closer to the 30s loop compared with the phenyl group of compound 5 and the six-carbon ring of the indanyl group of compound 2 This leads to repositioning
of the 30s loop and Asp30 by 0.4 and 1.0 A˚, respectively, compared with their positions with the smaller P2¢ groups The electronegative fluorine is within van der Waals radius (3.3 A˚) of the similarly electronegative carbonyl oxygen of Gly84 The most serious problems with this P2 group are the breaking of the hydrogen bond and repulsion between the dipoles
In compound 5, one of the indanyl groups was exchanged for a benzyl group to investigate the requirements for optimal asymmetric binding to the S2/S2¢ site The benzyl group is coplanar with the six-carbon ring of the indanyl group but its position is shifted by 0.3 A˚ Thus, the hydroxy group is not necessary for the orientation of the plane of the aromatic moiety A bound water molecule (B¼ 39.6) positioned in contact with the phenyl planes of the P1¢ and P2¢ side chains and 0.5 A˚ from the position of the indanyl oxygen atom replaces the function of the indanyl hydroxy group as hydrogen-bond donor (Fig 6) Interestingly, compounds 5 and 2 have about the same Ki values, which indicates the value of the bridging water molecule for specific and efficient interactions between ligand and enzyme
Calculation of accessible area in the protease buried by the compounds in the complex showed that compound 1, with a relatively low molecular mass, buried an area of equivalent size to the bigger compound 2 (Table 4) A comparison of the number of contacts and hydrogen bonds for these compounds revealed inefficient utilization of area
in the case of compound 1 This was also reflected in a higher Kivalue for compound 1
Fig 4 Accommodation of S2/S2¢ residue to different P2/P2¢ groups (stereo view) Whereas the positions and orientations of Ala28, Val32, Ile47, Ile84 are conserved, Asp30 and Val32 as well as the entire loop containing these residues adopt to the different P2 side chains as much as 2.1 A˚ for the side chain and 0.2–0.7 A˚ for the main-chain atoms Colour code: light blue (1), magenta (2), dark blue (3), black (5) and red (6).
Trang 9Optimization of the P3/P3¢ side chains
In addition to extension of the inhibitor by addition of a
new peptide bond and P3/P3¢ ligands, the S3/S3¢ sites can
be reached by substituents on the P1/P1¢ ligands To test
this, compounds 7–9 were synthesized Compounds 7 and
8 are substituted with thienly and pyridyl groups at the
para position of the P1/P1¢ benzyl groups, and inhibitor 9
contains pyridyl groups in the P3/P3¢ positions (Fig 7)
The structures of compounds 7 and 8 have previously
been briefly described by Alterman et al [46] Compound
8 has a significantly better binding parameter
(Ki¼ 0.1 nM) than compounds 7 and 9 (1.2 nM and
0.92 nM, respectively) (Table 2) The electron density of
the thienyl ring of compound 7 was low, which indicated
undefined binding, whereas the densities for the pyridyl
rings of compounds 8 and 9 were well defined The
significantly lower Ki value for compound 8 is explained
by the van der Waals interactions of the pyridyl rings with
Phe53/Phe153, Pro181/Pro81 and Gly48/Gly148, where
Pro packs against the plane of the pyridyl ring
Further-more, the pyridyl nitrogens are co-ordinated to Arg8/108
via water molecules (Fig 7) The pyridyl ring of com-pound 9 interacts with Gly48/148 and Arg8/108 How-ever, the orientations of the two pyridyl rings as well as their binding patterns are different There are not, as for compound 8, any apparent co-ordinating ligands to the pyridyl nitrogens Only in one side of the S3 sites is it possible to find water molecules within binding distances Loosely bound water molecules at the entrance to the S3/ S3¢ sites are displaced by the extending pyridyl and thienyl rings
Water molecules located in the active site Several water molecules are located in the active site and bound to the protein as well as to inhibitor compounds Similar to other linear HIV-1 protease inhibitors, in these inhibitor complexes also a structural water molecule acts as
a link between the inhibitor and the flap residues Ile50/ Ile150 Considerable effort has been expended on designing inhibitors that include this water molecule in their structure [47–50] However, in these compounds, co-ordinating hydrogen-bond-accepting carbonyl groups were designed
Fig 5 Ca plot analysis [56] of the inhibitor complexes 1–9 (here labelled A-J) The mRMSD panel shows the combined distance deviation for all pairs of A subunits (containing the S2 site) Values were calculated with LSQMAN [57].
Trang 10The hydrogen-bond distances between the water molecule
and the Ile50/Ile150 N atoms are in the range 2.7–2.9 A˚
The tetrahedral arrangement of the ligands to this water
molecule is slightly distorted This water oxygen atom has a
low-temperature factor (15 A˚2)
Two water molecules are positioned between the P1/P2
arms and hydrogen-bonded by the P3 carbonyl oxygen
atom and at the corresponding symmetry-related sites
(Fig 2) Water molecules at these positions have been
found in several inhibitor complexes [51] Also these water
molecules have low-temperature factors Their role is not
clear, but their position, just below the inhibitor, indicates
that water molecules may serve as lubricant between
movable parts in a protein molecule, increase the
promis-cuity of the interactions, and add to the enthalpy energy
term by contributing additional bonds to the protein–
inhibitor complex [52–54] In support of this role of water
molecules in enzyme–ligand complexes is the finding that
compounds 2 and 5 inhibit the protease activity with similar
efficacy although one of the indanyl groups of compound 2
was exchanged for a benzyl and a co-ordinating water molecule in compound 5 (Fig 6 and Table 2)
Conclusions
We have exploited the technique of structure-aided drug design to improve the inhibitory efficacy of HIV-1 protease lead compounds The flexibility of the target molecule complicates prediction of the effect of a modification of the inhibitor and necessitates structural analysis of each complex In this case, the HIV-1 protease, the flexibility was relatively conservative The asymmetric binding of the two central inhibitor hydroxyls to the active-site aspartates induced a small deviation from the exact C2 symmetry in the whole enzyme–inhibitor complex This study shows that, even without changing the chemistry of the inhibitor scaffold but with modifications limited to the side groups, several potent compounds can be designed The most active compounds in this series had the highest number of contacts (bonds) between the protease and the inhibitor
Fig 6 Value of a water molecule in the
inter-face between inhibitor and protein (stereo view).
A bound water molecule in the compound 5
protease complex (A) fulfils the function of the
indanyl hydroxyl in compound 2 (B) The two
compounds have comparable inhibitory
activity, 0.1 and 0.2 n M , respectively.