Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

thylakoid membraneIn vitro and in vivo studies of wild-type and tagged versions of the protein Lisa Rosgaard*, Agnieszka Zygadlo, Henrik Vibe Scheller, Alexandra Mant† and Poul Erik Jens

thylakoid membrane

In vitro and in vivo studies of wild-type and tagged versions of the protein

Lisa Rosgaard*, Agnieszka Zygadlo, Henrik Vibe Scheller, Alexandra Mant† and Poul Erik Jensen Plant Biochemistry Laboratory, Department of Plant Biology, The Royal Veterinary & Agricultural University, Frederiksberg, Denmark

Subunit G of photosystem I (PSI-G) is one of the

polypeptides that form the core of metaphyte PSI

(reviewed in [1]) This intricate complex of more than

100 pigments and 14 polypeptides uses solar energy

to transfer electrons from plastocyanin (PC) in the thylakoid lumen, across the thylakoid membrane to

Keywords

His-tag; membrane topology; photosystem I;

Strep-tag; transgenic Arabidopsis

Correspondence

P E Jensen, Plant Biochemistry Laboratory,

Department of Plant Biology, The Royal

Veterinary & Agricultural University, 40,

Thorvaldsensvej, DK-1871 Frederiksberg C,

Denmark

Fax: +45 35283333

Tel: +45 35283354

E-mail: peje@kvl.dk

*Present address

Novozymes A ⁄ S, Starch R & D, Laurentsvej

55, Bagsværd, Denmark

†Present address

Molecular Immunology Group, Cancer

Sciences Division, Southampton General

Hospital, Mailpoint 824, Tremona Road,

Southampton, SO16 6YD, UK

Note

L Rosgaard and A Zygadlo contributed

equally to this work

(Received 9 May 2005, revised 14 June

2005, accepted 17 June 2005)

doi:10.1111/j.1742-4658.2005.04824.x

Subunit G of photosystem I is a nuclear-encoded protein, predicted to form two transmembrane a-helices separated by a loop region We use

in vitro import assays to show that the positively charged loop domain faces the stroma, whilst the N- and C-termini most likely face the lumen PSI-G constructs in which a His- or Strep-tag is placed at the C-terminus

or in the loop region insert with the same topology as wild-type photosys-tem I subunit G (PSI-G) However, the presence of the tags in the loop make the membrane-inserted protein significantly more sensitive to trypsin, apparently by disrupting the interaction between the loop and the PSI core Knock-out plants lacking PSI-G were transformed with constructs enco-ding the C-terminal and loop-tagged PSI-G proteins Experiments on thylakoids from the transgenic lines show that the C-terminally tagged ver-sions of PSI-G adopt the same topology as wild-type PSI-G, whereas the loop-tagged versions affect the sensitivity of the loop region to trypsin, thus confirming the in vitro observations Furthermore, purification of PSI complexes from transgenic plants revealed that all the tagged versions of PSI-G are incorporated and retained in the PSI complex, although the C-terminally tagged variants of PSI-G were preferentially retained This suggests that the loop region of PSI-G is important for proper integration into the PSI core Our experiments demonstrate that it is possible to pro-duce His- and Strep-tagged PSI in plants, and provide further evidence that the topology of membrane proteins is dictated by the distribution of posit-ive charges, which resist translocation across membranes

Abbreviations

Chl, chlorophyll; Fd, ferredoxin; FNR, ferredoxin-NADP+oxidoreductase; His-tag, hexa-histidine tag; LHCI, light harvesting complex

associated with photosystem I; PSI, photosystem I; Lhcb1, major light harvesting complex apoprotein associated with photosystem II;

PC, plastocyanin; Strep-tag, trp-ser-his-pro-gln-phe-glu-lys tag.

ferredoxin (Fd) on the stromal side Reduced Fd can

donate electrons via ferredoxin-NADP+

oxidoreduc-tase (FNR) to produce NADPH, a central currency of

chemical energy Light energy is channelled to the PSI

core by a peripheral antenna or light harvesting

com-plex (LHCI), consisting of four members (Lhca1–4) of

the chlorophyll a⁄ b binding protein family LHCI is

bound along one side of PSI only, in the vicinity of

the PSI-F and PSI-J subunits [2,3] Apart from the

asymmetry conferred by LHCI, PSI in both

cyanobac-teria and plants is a relatively rounded, featureless

structure when single particles are viewed by electron

microscopy

PSI-G, which is absent from cyanobacterial PSI,

shares  30% amino-acid identity with PSI-K in

Arabidopsis[4] Studies using knockout [5,6] and

anti-sense [7] Arabidopsis lines have proposed that PSI-G

plays a role in stabilizing the PSI core and the

peri-pheral antenna, respectively Additionally, PSI-G may

be an important regulator of PSI activity [6,7] PSI-K,

on the other hand, appears to be important for

sta-bilizing antenna proteins Lhca2 and -a3 [5,8] Both

proteins are encoded by the nuclear genome with

N-terminal chloroplast transit (targeting) peptides,

and are predicted to form two transmembrane

a-heli-ces, separated by a charged loop region (Arabidopsis

PSI-G: 6 positive and 7 negative charges; Arabidopsis

PSI-K: 4 positive and 3 negative charges) Topology

studies of barley PSI-K showed that the protein

con-forms to the ‘positive-inside rule’ [9], by having the

positively charged loop in the stroma, with N- and

C-termini in the thylakoid lumen [10] This finding

agreed with the topology of cyanobacterial PSI-K, as

determined by X-ray crystallography of Synechococcus

elongatus PSI [11,12] The crystal structure placed

cyanobacterial PSI-K at the outside edge of the

com-plex, a position that has recently been confirmed for

metaphytes, with the publication of a 4.4 A˚ crystal

structure for Pisum sativum photosystem I [3] In this

structural model, PSI-G is located on the opposite

edge of the PSI complex from PSI-K [3], which is in

good agreement with biochemical evidence [5,7,13]

The homology between PSI-G and PSI-K, from

which PSI-G probably arose by gene duplication [4],

would suggest a ‘horseshoe’-like topology, with the

loop facing the stroma and the N- and C-termini in

the thylakoid lumen This topology is also suggested

by the structural model of PSI based on the 4.4 A˚

crystal structure [3] However, a resolution of 4.4 A˚

does not reveal enough structural detail to determine

the actual topology of a membrane protein and so

far there is no biochemical evidence to support the

proposition

We sought to determine the topology of PSI-G and

to test the feasibility of rescuing Arabidopsis PSI com-plexes lacking PSI-G with tagged constructs Successful introduction of a hexa-histidine (His)- or Strep-tagged PSI-G into PSI will pave the way for determining the polypeptide’s location within the complex by means of immunogold electron microscopy and single-particle analyses It will also provide a useful orientation mar-ker for the otherwise very rounded PSI complex, and potentially act as an affinity tag for preparation of ultra-pure PSI particles His-tags have already been used to purify active PSII both from Synechocystis

6803 [14] and Chlamydomonas reinhardtii [15] and to determine the location of PsbH in photosystem II (PSII) of C reinhardtii [16] We now report the expres-sion of His- and Strep-tagged plant PSI

Results

A series of cassettes containing tagged variants of the full-length precursor of Arabidopsis PSI-G (acces-sion AJ245630) were generated by PCR Strep-(WSHPQFEK) or His-tags were inserted in the loop region, between nucleotide positions 386 and 387, or

at the extreme C-terminus of PSI-G (Fig 1) These cassettes were both cloned into binary vectors under the control of the 35S promoter and terminator, and into vectors for in vitro transcription and translation

An Arabidopsis line (psag-1.4 [5], termed DG in this report), lacking PSI-G due to a transposon footprint

in exon 1, was transformed with the different con-structs, but to test the ability of the tagged PSI-G to

be correctly targeted and inserted into the thylakoid membrane, initial analyses were carried out in vitro

Fig 1 Schematic representation of PSI-G and the recombinant ver-sions of PSI-G used in this study The two transmembrane span-ning helices are indicated as filled boxes The positively charged amino acids in PSI-G are indicated by + Position of the His-tag (HHHHHH) and the Strep-tag (WSHPQFEK) in either the loop region

or the C-terminus of PSI-G is indicated HisT, PSI-G-HisTerm; StrepT, PSI-G-StrepTerm; HisL, PSI-G-HisLoop; StrepL, PSI-G-Strep-Loop.

Targeting of His- and Strep-tagged PSI-G

constructs in vitro

The loop region of PSI-G contains 6 positively charged

amino acids; in agreement with the ‘positive inside

rule’ [9], topology prediction servers such as TMHMM

(http://www.cbs.dtu.dk/ [17]) predict PSI-G to have

two transmembrane regions connected by a stromal

loop, with the N- and C-termini in the thylakoid

lumen In order to test this topology prediction,

wild-type and tagged PSI-G were transcribed and translated

in vitro, then incubated with isolated, intact pea

chlo-roplasts, as described in Experimental procedures

Analysis of chloroplast fractions postimport (Fig 2)

shows that all constructs are processed and imported

by isolated chloroplasts In each case, the full-length

precursor protein (Fig 2, lanes Tr) is processed to a

smaller polypeptide, corresponding in size to mature

PSI-G (Fig 2, panels i, and iii–vi, lanes C) This

pro-tein is inside the chloroplasts, because it is protected

from thermolysin digestion (Fig 2, lanes C+) As a control, full-length precursor proteins were digested with thermolysin, to ensure that the mature PSI-G seen in lanes C+ does not derive from PSI-G bound

to the outside of the chloroplast None of the precur-sor proteins yielded a mature-sized degradation prod-uct when incubated with thermolysin (Fig 2, lanes Tr+) wild-type and all tagged PSI-G constructs frac-tionate with the thylakoid membrane (Fig 2, lanes T), but differences become apparent when the thylakoid membranes are digested with trypsin, a protease that cleaves after arginine and lysine residues (6 of which are present in the loop of wild-type PSI-G) Wild-type PSI-G resists digestion (Fig 2, panel i, lane T+), while a control protein, Lhcb1, is digested to a charac-teristic degradation product, DP (Fig 2, panel ii, lane T+) Resistance to trypsin digestion suggests either that PSI-G’s positive charges (Fig 1) are on the trans-side of the thylakoid, or that they are shielded from trypsin digestion on the cis-side of the membrane The

A

B

Fig 2 Determination of the topology of PSI-G in the thylakoid membrane using

in vitro import experiments (A) Insertion of Arabidopsis thaliana wild-type PSI-G or tagged PSI-G into thylakoids Shown are fluorograms of the fractions obtained from import of radioactive precursors into isolated, intact pea chloroplasts The lanes correspond to: in vitro-translated precursor (Tr), thermolysin-treated precursor (Tr+), total, washed chloroplasts immediately post-import (C), thermolysin-treated chloroplasts (C+), stromal extract (S), thylakoids (T), and trypsin-treated thylakoids (T+) Panel i, wild-type PSI-G; panel ii Lhcb1; panel iii, PSI-G-HisTerm; panel iv, PSI-G-StrepTerm; panel v, PSI-G-HisLoop; panel vi, PSI-G-StrepLoop DP indicates the charac-teristic degradation product yielded when membrane-inserted Lhcb1 is digested by trypsin A set of degradation products yielded by trypsin digestion of thylakoidal PSI-G-HisLoop is denoted by an asterisk (B) Insertion of Chlamydomonas reinhardtii PSI-G into thylakoids (Lanes as in panel A) Alignment of the loop region of Arabidopsis and Chlamydomonas PSI-G Positively charged amino acids are shown in italics.

first scenario is consistent with a topology where the

loop is in the thylakoid lumen, and the N-and

C-ter-mini face the stroma, opposite to that of PSI-K On

the other hand, the second scenario implies a stromal

loop, like that of PSI-K, but unusally inaccessible to

trypsin – unlike PSI-K [10] The two constructs tagged

at the C-terminus, PSI-G-HisTerm and

PSI-G-Strep-Term, are also resistant to trypsin digestion of the

thylakoids (Fig 2, panels iii and iv, lanes T+), but

those tagged in the loop domain, PSI-G-HisLoop and

PSI-G-StrepLoop, are degraded by trypsin (Fig 2,

panels v and vi, lanes T+) This strongly suggests that

the positively charged loop domain in the latter two

constructs is accessible to trypsin on the stromal side

of the membrane and that placing the tags in the loop

prevents PSI-G from adopting its normal

conforma-tion in the membrane

ChlamydomonasPSI-G was imported into pea

chloro-plasts to assess whether other PSI-G molecules show

similar topological characteristics (Fig 2B)

Post-import analysis indicates a trypsin-sensitive loop facing

the stroma, and therefore supports a topology in which

PSI-G has a stromal loop (Fig 2B, lane T+) An

alignment of the Arabidopsis and Chlamydomonas

PSI-G loop regions is also shown in Fig 2B, from

which it is evident that the algal loop contains a

simi-lar distribution of positive charges, although fewer

than Arabidopsis (4 instead of 6) Aside from the

charge distributions, the loops exhibit enough variation

to leave room for altered protein–protein interactions,

which may explain why the Chlamydomonas loop

region is exposed to trypsin in the in vitro assay

The in vitro import experiments suggested that the

loop of Arabidopsis PSI-G faces the stroma However,

it was also clear that this loop must adopt an

unusu-ally stable structure that is resistant to trypsin

diges-tion under the standard condidiges-tions commonly used to

determine the topology of thylakoid membrane

pro-teins To find out whether the in vitro behaviour was

anomalous, a range of experiments was performed

using thylakoid membranes isolated from wild-type

Arabidopsis (Fig 3A) wild-type thylakoids were

incu-bated on ice with trypsin for defined periods, then the

thylakoid proteins were separated by SDS⁄ PAGE and

analysed by immunoblotting using antibodies

recogni-zing PSI subunits with known location and topology

Quantification of the signal showed that even after a

60 min incubation with trypsin, 60–70% of the PSI-G

protein remains Yet in the same sample, PSI-K, which

is known to have a stromal loop, is completely

diges-ted On the other hand, the loop of PSI-O, which is

protected in the thylakoid lumen, is unaffected by the

trypsin treatment, while PSI-D, which is a stromal,

extrinsic PSI subunit, is degraded to a smaller peptide

by the trypsin treatment In Fig 3B, a similar experi-ment has been performed upon PSI complexes purified from sucrose gradients after solubilization of the thylakoid membrane using the detergent dodecyl-b-d-maltoside Here, the solubilization of the complex from the membrane clearly renders the PSI-O subunit accessible to the protease but the PSI-G subunit still resists complete protease digestion In fact, only when the highly active, nonspecific, proteinase K is used, is

it possible to degrade PSI-G significantly (Fig 3C)

A

C

B

Fig 3 Protease treatment of thylakoid membranes and PSI com-plexes isolated from wild-type Arabidopsis (A) Digestion of thyla-koid membranes over time Immunoblot of thylathyla-koid samples after

0, 30 and 60 min digestion with trypsin, probed with antibodies directed against PSI-G, PSI-K (intrinsic membrane protein, stromal loop), PSI-O (intrinsic membrane protein, luminal loop) and PSI-D (extrinsic membrane protein, stromal side) Each lane corresponds

to 2 lg Chl (B) Digestion of PSI complexes purified from wild-type Arabidopsis thylakoids after detergent solubilization and sucrose gradient centrifugation Immunoblot of undigested (–) PSI com-plexes and comcom-plexes digested with trypsin for 30 min (+) Anti-bodies used as in part A Each lane corresponds to 1 lg Chl (C) Digestion of thylakoids (2 lg Chl) and PSI complexes (1 lg Chl) using trypsin and proteinase K Immunoblots probed with antibod-ies directed against PSI-G and PSI-D.

These results support the notion that PSI-G adopts an

unusually protease-resistant structure when associated

with PSI in the thylakoid membrane Importantly

however, the observation that PSI-G in thylakoid

membranes is partially degraded under conditions

where a protease-susceptible subunit such as PSI-O,

with a known lumenal loop resists degradation,

strongly indicates that the PSI-G loop is stromal

Expression of Strep- and His-tagged PSI-G

constructs in vivo

To extend the in vitro import experiments to in vivo

conditions, an Arabidopsis mutant in which the psaG

gene has been disrupted by transposon insertion [5]

was transformed with constructs encoding the tagged

versions of PSI-G DG plants germinate normally, but

grow slightly smaller, paler and flower slightly later

than wild type [5] However, in our growth chambers,

DG plants display a less pronounced phenotype In

total, c 620 T1and T2 plants from two separate

trans-formation experiments were screened by

immunoblot-ting, and approximately 50% of those transformed

with a PSI-G construct (as opposed to an empty

vec-tor), expressed PSI-G or its tagged counterpart

Thylakoids were prepared from pools of plants

expressing similar levels of PSI-G, and analysed by

immunoblotting, using antibodies to PSI-G and PSI-F,

as an indicator of the relative content of PSI in the

samples Plants lacking PSI-G have 40% less PSI

com-pared to wild-type [5,7] Representative thylakoid

pre-parations are shown in Fig 4A From the immunoblot

it is clear that the steady state level of PSI-G, expressed

as the PSI-G to PSI-F ratio, in all the transformed lines

is lower than in the true wild type This suggests that

the expression of PSI-G and steady state level of PSI-G

in all the transformed lines is suboptimal

High resolution SDS⁄ PAGE shows that PSI-G

bear-ing a His- or Strep-tag migrates more slowly than

wild-type PSI-G, with all tagged constructs behaving

similarly, typified in Fig 4B That these bands

repre-sent PSI-G carrying the appropriate tag was confirmed

by probing gel blots with an anti-hexa-His antibody or

StrepTactin-HRP conjugated with horseradish

peroxi-dase The results for the tagged constructs are shown

in Fig 4C Interestingly, both tags are recognized

more efficiently in the context of the PSI-G loop

region than at the C-terminus

Topology of PSI-G in vivo

In order to examine the topology of PSI-G in vivo,

samples of thylakoids from wild-type (empty vector)

and transformed plants were treated separately with thermolysin and trypsin as described for the in vitro import analyses PSI-G, and a control protein, Lhcb1, were then detected by immunoblotting (Fig 5) Wild-type and C-terminally tagged PSI-G resist digestion

by either protease whereas G-HisLoop and PSI-G-StrepLoop are sensitive to both proteases Lhcb2

is, as expected, clipped by both proteases The beha-viour of the wild-type and tagged constructs in vivo exactly parallels the in vitro results, and suggest that PSI-G carrying either a C-terminal or a loop His- or Strep-tag is able to insert into the thylakoid mem-brane with the same topology as wild-type PSI-G The versions of PSI-G that carry a His- or a Strep-tag in the loop are sensitive to digestion by the pro-teases, whereas the C-terminally tagged versions remain as protease-resistant as the wild-type protein Thus, the loop-tags disrupt the structure of the loop

A

B

C

Fig 4 Tagged PSI-G is present in thylakoids of DG plants trans-formed with the various PSAG constructs (A) Immunoblot of pooled thylakoids (0.5 lg Chl per lane) from lines expressing wild-type or tagged PSI-G, or lacking PSI-G (DG) PSI-F is detected as an indicator of PSI content The ratio PSI-G ⁄ PSI-F is indicated under each lane (nd, not determined) (B) Comparison of the migration of wild-type and His-tagged PSI-G by high-resolution SDS ⁄ PAGE (C) Immunodetection of His and Strep tags in PSI-G constructs.

and⁄ or its interaction with other proteins such as the

PSI core

Incorporation of tagged PSI-G into PSI

Whilst it is evident that both C-terminally and

loop-tagged PSI-G can insert into the thylakoid in vivo

(Figs 4 and 5), it is possible that the tags hinder

assem-bly into PSI complexes Therefore, it was of interest to

find out whether any of the tagged proteins are

assem-bled into PSI complexes We solubilized thylakoid

membranes using dodecyl-b-d-maltoside and purified

PSI complexes using sucrose gradient centrifugation

The purified PSI complexes were then analysed by

immunoblotting, using antibodies against PSI-G and

PSI-F (Fig 6A) That PSI-G contained the

appropri-ate tag was confirmed by probing gel blots with an

antihexa-His antibody or StrepTactin-HRP conjugated

with horseradish peroxidase (Fig 6B) The results

clearly indicate that both the C-terminally and

loop-tagged versions of PSI-G are present in PSI, sug-gesting that all versions of PSI-G can be incorporated into the PSI complex However, C-terminally His- and Strep-tagged PSI-G seem to incorporate to a higher degree than the loop-tagged versions of PSI-G This may suggest that the loop of PSI-G is important for stable integration of the subunit into the PSI complex

A protein band smaller that the tagged versions of PSI-G is present in the lanes with the loop-tagged PSI, but is also seen faintly in the lanes with the terminally tagged PSI The respective tags were only present in the upper band (Fig 6B) and we have no reason to believe that the lower band is a degradation product

of the tagged versions of PSI-G Cross-contamination with wild-type PSI-G during the process of preparing thylakoids or PSI particles can also be ruled out as the double band could be detected in at least two inde-pendent preparations of both thylakoids and PSI parti-cles from the four lines carrying the tagged versions of PSI-G The most likely explanation is therefore that the psaG transposon knock-out line used for the trans-formation experiments is unstable and apparently a fraction of the cells within the plant revert to wild type, giving rise to the wild-type-sized immuno-detect-able band It seems that transformation of the trans-poson-tagged psaG knock-out line somehow increases this reversion rate

Fig 5 Tagged PSI-G inserts into the thylakoid membrane in vivo.

Immunoblot of thylakoids (2 lg Chl per lane) isolated from plant

lines transformed with the various constructs and subsequently

subjected to protease treatment The lanes correspond to:

untreated thylakoids (T), thylakoids treated with thermolysin (P1)

and thylakoids treated with trypsin (P2) DP denotes the

character-istic degradation product of membrane-inserted Lhcb1 digested by

thermolysin or trypsin.

A

B

Fig 6 The tagged PSI-G subunit is incorporated into photosystem I (A) Immunoblot of PSI complexes (1 lg Chl per lane) purified from thylakoids shown in Fig 5 The ratio of PSI-G : PSI-F is shown beneath the lanes (nd, not determined) B: Immunoblot of PSI com-plexes (1 lg Chl per lane) purified from thylakoids and probed with Anti-Hexa-His tag or Anti-Strep tag Ig, as indicated alongside the panels.

We have successfully incorporated His- and

Strep-tagged PSI-G into Arabidopsis PSI complexes in vivo In

achieving this, we have been able to collect multiple lines

of evidence that PSI-G inserts into the thylakoid

mem-brane with a stromal loop and its N- and C-termini

facing the lumen PSI-G is markedly protected from

trypsin degradation, both in vitro and in vivo, which

means that the positively charged loop region is not

eas-ily accessible to protease from the stromal face of the

membrane By contrast, PSI-K is cleaved by trypsin into

two fragments, representing the two transmembrane

spans [10] However, PSI-G constructs with a His- or

Strep-tag in the loop region are sensitive to proteases,

indicating that the loop region becomes more accessible,

presumably by disrupting protein–protein interactions

within PSI, or by altering the conformation of the loop

His-tags were employed in a topological study of the

major light harvesting chlorophyll a⁄ b binding

apopro-tein, Lhcb1 [18] Interestingly, fusion of a His-tag to the

C-terminus, which must cross the thylakoid membrane

during insertion, did not prevent Lhcb1 adopting its

cor-rect topology The most likely explanation of our own

experimental observations is that the C-terminal

His-and Strep-tags are also translocated across the thylakoid

membrane, such that PSI-G has the same topology as

PSI-K This means that PSI-G obeys the ‘positive-inside

rule’ [9], which states that the topology of membrane

proteins is dictated by the distribution of positive

charges, which resist translocation across membranes

Our findings provide the first biochemical evidence

for the predictions made by Ben-Shem et al [3] in the

interpretation of their crystal structure of Pisum

sativum PSI, in which the loop of PSI-G is suggested

to face the stroma

The amount of PSI-G in the transformed knock-out

line does not reach the level of the wild type The lines

expressing the tagged versions of PSI-G all accumulate

significantly lower amounts of PSI-G than wild-type;

however, the data do not allow us to conclude that the

loop-tagged versions of PSI-G accumulate to a lesser

extent than the C-terminally tagged versions, although

there is a weak tendency Even the line transformed

with the wild-type version of PSI accumulates less

PSI-G than wild type This is a somewhat surprising

result as the 35S promoter used in this study should

ensure strong constitutive expression of the gene A

likely explanation for this is that the transposon-tagged

psaGgene in the knock-out line used for the

transforma-tion experiments still produces a psaG transcript, and

together with the strong constitutive expression of

tagged or wild-type psaG transcripts, causes cosuppres-sion and subsequent accumulation of less PSI-G protein Preliminary experiments in which individual transformants were found to accumulate near-wild-type levels of PSI-G at the age of 7–8 weeks after ger-mination, show that the transformants lost expression 4–5 weeks later (results not shown)

In conclusion, we have shown using both in vitro and

in vivo methods, that PSI-G adopts a topology in the thylakoid membrane with the loop facing the stroma and its N- and C-termini facing the lumen We have also shown that plants lacking PSI-G can be transformed with tagged versions of PSI-G, albeit limited by the expression level of PSI-G in the transformants Finally,

we have demonstrated that His- or Strep-tagged PSI can

be made in planta In future experiments, we will evalu-ate its use for quick purification of PSI and alignment of PSI particles during structural determination of PSI using electron microscopy and single particle analysis

Experimental procedures

PSAG constructs

Constructs encoding tagged variants of Arabidopsis PSAG (accession number AJ245630) were prepared by polymerase chain reaction, using the EST 279G1T7 (obtained from the ABRC, Ohio, USA and described in [7]) as a template Primers were designed as follows: PSAG with a C-terminal hexa-histidine tag (PSI-G-HisTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CAGTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3¢ (His-tag underlined); PSAG with a C-ter-minal Strep-tag (PSI-G-StrepTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CATTTTTCGAACTGCGGGTGGCTCCATCCAAAGAA GCTTGGGTCGTAT-3¢ (region encoding the Strep-tag, WSHPQFEK [19], underlined) Constructs containing a His- or Strep-tag in the loop region (PSI-G-HisLoop and PSI-G-StrepLoop) were prepared in three stages: a primary amplification with primers 5¢-GCGGAGCTCATGGCCAC AAGCGCATCAGC-3¢ and 5¢-GTGGTGGTGGTGGTGG TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag under-lined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined), then a secondary amplification with primers 5¢-CACCAC CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCG AAAAAGAAGCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined) and 5¢-GCGGCATGCTCATCCAAAGAAGC TTGGGTCG-3¢ The two amplified fragments were used

as a combined template for the tertiary amplification, using primers 5¢-GCGGAGCTCATGGCCACAAGCGCA

TCAGC-3¢ and 5¢-GCGGCATGCTCATCCAAAGAAGC

TTGGGTCG-3¢ for both PSI-G-HisLoop and

PSI-G-Strep-Loop

Tagged PSAG constructs were cloned either into

pGEM
4Z (Promega GmbH, Germany) under the SP6

pro-moter, for in vitro transcription and translation, or into

pPS48 [20] under the control of the 35S promoter and

termi-nator For each tagged variant and the wild-type PSAG, a

cassette containing the PSAG construct flanked by the 35S

promoter and terminator was excised and ligated into the

binary vector pPZP111 [21], ready for transformation of

Agrobacterium tumefaciens All DNA constructs were fully

sequenced to confirm their identities before experimental use

In vitro import assays

PSAGconstructs were transcribed in vitro using SP6 RNA

polymerase, then translated in a Wheat Germ Lysate system

(Promega GmbH, Germany), in the presence of [3H]leucine

(Amersham Biosciences, Denmark) Intact chloroplasts were

isolated from pea seedlings, and in vitro import assays were

carried out as described in [22] Samples were analysed by

Tricine-SDS⁄ PAGE [23] and fluorography

Transformation of Arabidopsis with tagged

PSAG constructs

Wild-type plants were Arabidopsis thaliana, ecotype

Colum-bia 0 The Arabidopsis PSI-G knock-out line (DG [5],

Columbia 0 background) was generously provided by

Dr D Leister, Max Planck Institute, Cologne, Germany

Prior to transformation, plants were screened for the

pres-ence or abspres-ence of PSI-G by immunoblotting Five DG

plants per construct were subjected to

Agrobacterium-medi-ated transformation, using the floral dip method [24] Five

wild-type plants were transformed with an empty pPZP111

vector Seeds from transformed plants were

surface-steril-ized in 5% (v⁄ v) sodium hypochlorite, 0.02% (v ⁄ v) Triton

X-100, washed with sterile water and plated on MS medium

supplemented with 50 lgÆmL)1 kanamycin

Kanamycin-resistant seedlings were transferred to soil and subsequently

analysed for the expression of PSAG and the tagged

con-structs by immunoblotting That individual transformants

contained the correct construct was confirmed by PCR

amplification of genomic DNA using primers

complement-ary to the 35S promoter and terminator, followed by DNA

sequencing of the amplicons

Immunoblot analysis of transgenic Arabidopsis

For screening of the transformants, one mature leaf was

excised from each individual plant, placed in an Eppendorf

tube and frozen in liquid nitrogen Frozen tissue was

pulverized in 200 lL protein extraction buffer [PEB: 100 mm

Tris⁄ HCl, pH 8.0, 50 mm EDTA, pH 8.0, 250 mm NaCl, 0.7% SDS, 1 mm dithiothreitol, 1· Complete Protease Inhibitor Cocktail (Roche)], using a pestle The sample was then incubated at 68C for 10 min, followed by

centrifuga-tion at 15 000 g for 10 min at 4C The supernatant was removed, transferred to a fresh tube, and its chlorophyll con-tent estimated by measuring light absorbance at 652 nm [25] Protein equivalent to 2 lg chlorophyll was acetone-precipita-ted before being separaacetone-precipita-ted by SDS⁄ PAGE and transferred to nitrocellulose Antibodies employed were rabbit polyclonals against PSI-G, PSI-F and a monoclonal His tag anti-body (Novagen, Merck Biosciences GmbH, Germany) The Strep tag was detected on blots using StrepTactin coupled to Horse Radish Peroxidase (Bio-Rad, Herlev, Denmark) Sam-ples equivalent to 0.125, 0.250 and 0.500 lg chlorophyll were analysed for quantitative immunoblot analysis of thylakoid PSI proteins For immunoblotting of purified PSI particles, samples containing 0.5 and 1 lg chlorophyll were analysed

Isolation of thylakoid membranes and PSI particles from Arabidopsis

Healthy leaves from typically 5–10 Arabidopsis plants were pooled Thylakoid membranes were isolated according to [26] PSI particles were isolated from thylakoids after solu-bilization with dodecyl-b-d-maltoside and sucrose density ultracentrifugation, as described in [8]

Trypsin treatment of thylakoids and PSI particles

Thylakoid membranes equivalent to 2 lg Chl and PSI com-plexes equivalent to 1 lg Chl were treated with trypsin

(Sig-ma, type XIII) on ice at 0.25 mgÆmL)1 final concentration Thylakoid digestions were carried out in 10 mm Hepes⁄ KOH, pH 8.0, 5 mm MgCl2 (HM) and PSI diges-tions were carried out in 20 mm Tricine⁄ NaOH, pH 7.5, 0.06% dodecyl-b-maltoside PSI incubations were stopped

by addition of soybean trypsin inhibitor (Sigma type I-S) to

a final concentration of 1 mgÆmL)1and boiling loading buf-fer In the case of thylakoids, the samples were washed in

400 lL HM and the pellets resuspended in trypsin inhibitor and boiling loading buffer Samples were loaded on SDS⁄ PAGE gels for immunoblot analysis

Acknowledgements

We thank the ABRC at Ohio State University for pro-viding ESTs and Lis Drayton Hansen for excellent technical assistance We are grateful to Dr D Leister for the gift of the Arabidopsis PSI-G knock-out line, Prof J.-D Rochaix for the gift of the cDNA clone encoding Chlamydomonas PSI-G and to Dr A Ben-Shem and Prof N Nelson for sharing unpublished

data with us The Danish National Research

Founda-tion, the Danish Veterinary and Agricultural Research

Council (23-03-0105) and the EU (Contract No

HPRN-CT-2002–00248) are gratefully acknowledged

References

1 Jensen PE, Haldrup A, Rosgaard L & Scheller HV

(2003) Molecular dissection of photosystem I in higher

plants: topology, structure and function Physiol Plant

119, 313–321

2 Boekema EJ, Jensen PE, Schlodder E, van Breemen JFL,

van Roon H, Scheller HV & Dekker JP (2001) Green

plant photosystem I binds light harvesting complex I on

one side of the complex Biochemistry 40, 1029–1036

3 Ben-Shem A, Frolow F & Nelson N (2003) Crystal

structure of plant photosystem I Nature 426, 630–635

4 Kjærulff S, Andersen B, Skovgaard Nielsen V, Lindberg

Møller B & Okkels JS (1993) The PSI-K subunit of

photosystem I from barley (Hordeum vulgare L.):

Evi-dence for a gene duplication of an ancestral PSI-G⁄ K

gene J Biol Chem 268, 18912–18916

5 Varotto C, Pesaresi P, Jahns P, Lessnick A, Tizzano M,

Schiavon F, Salamini F & Leister D (2002) Single and

double knock-outs of the genes for photosystem I

subu-nits G, K and H of Arabidopsis Effects on photosystem

I composition, photosynthetic electron flow and state

transitions Plant Physiol 129, 616–624

6 Zygadlo A, Jensen PE, Leister D & Scheller HV (2005)

Photosystem I lacking the PSI-G subunit has a higher

affinity for plastocyanin and is sensitive to

photo-damage Biochim Biophys Acta 1708, 154–163

7 Jensen PE, Rosgaard L, Knoetzel J & Scheller HV

(2002) Photosystem I activity is increased in the absence

of the PSI-G J Biol Chem 277, 2789–2803

8 Jensen PE, Gilpin M, Knoetzel J & Scheller HV (2000)

The PSI-K subunit of photosystem I is involved in the

interaction between light-harvesting complex I and the

photosystem I reaction center core J Biol Chem 275,

24701–24708

9 Gavel Y, Steppuhn J, Herrmann R & von Heijne G

(1991) The ‘positive-inside rule’ applies to thylakoid

membrane proteins FEBS Letts 282, 41–46

10 Mant A, Woolhead CA, Moore M, Henry R & Robinson

C (2001) Insertion of PsaK into the thylakoid membrane

in a ‘horseshoe’ conformation occurs in the absence of

signal recognition particle, nucleoside triphosphates, or

functional Albino3 J Biol Chem 276, 36200–36206

11 Fromme P, Jordan P & Krauss N (2001) Structure of

photosystem I Biochim Biophys Acta 1507, 5–31

12 Jordan P, Fromme P, Witt HT, Klukas O, Saenger W

& Krauss N (2001) Three-dimensional structure of

cyanobacterial photosystem I at 2.5 A˚ resolution

Nature 411, 909–917

13 Jansson S, Andersen B & Scheller HV (1996) Nearest-neighbor analysis of higher-plant photosystem I holo-complex Plant Physiol 12, 409–420

14 Bricker TM, Morvant J, Masri N, Sutton HM & Fran-kel LK (1998) Isolation of a highly active photosystem

II preparation from Synechocystis 6803 using a histi-dine-tagged mutant of CP47 Biochim Biophys Acta

1409, 50–57

15 Sugiura M, Inoue Y & Minagawa J (1998) Rapid and discrete isolation of oxygen-evolving His-tagged photo-system II core complex from Chlamydomonas reinhardtii

by Ni2+affinity column chromatography FEBS Lett

426, 140–144

16 Bu¨chel C, Morris E, Orlova E & Barber J (2001) Locali-sation of the PsbH subunit in photosystem II: a new approach using labelling of His-tags with a Ni(2+)-NTA gold cluster and single particle analysis J Mol Biol 312, 371–379

17 Kosemund K, Geiger I & Paulsen H (2000) Insertion of light-harvesting chlorophyll a⁄ b protein into the thyla-koid Topographical studies Eur J Biochem 267, 1138– 1145

18 Krogh A, Larsson B, von Heijne G & Sonnhammer ELL (2001) Predicting transmembrane protein topology with a hidden Markov model: Application to complete genomes J Mol Biol 305, 567–580

19 Skerra A & Schmidt TGM (2000) Use of the Strep-tag and streptavidin for recombinant protein purification and detection Methods Enzymol 326, 271–304

20 Kay R, Shan A, Daly M & McPherson J (1987) Duplica-tion of CaMV 35S promoter sequences creates a strong enhancer for plant genes Science 236, 1299–1302

21 Hajdukiewicz P, Svab Z & Maliga P (1994) The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation Plant Mol Biol 25, 989–994

22 Robinson C & Mant A (2002) Import of proteins into isolated chloroplasts and thylakoid membranes In Molecular Plant Biology Volume Two: a Practical Approach(Gilmartin, P & Bowler, C, eds), pp 123–146 Oxford University Press, Oxford, UK

23 Scha¨gger & Von Jagow (1987) Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa Anal Biochem 166, 368–379

24 Clough JC & Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana Plant J 16, 735–743

25 Lichtenthaler HK (1987) Chlorophylls and carotenoids: Pigments of photosynthetic biomembranes Methods Enzymol 148, 350–382

26 Haldrup A, Naver H & Scheller HV (1999) The inter-action between plastocyanin and photosystem I is inefficient in transgenic Arabidopsis plants lacking the PSI-N subunit of photosystem I Plant J 17, 689–698