The 2-hydroxyglutaryl-CoA dehy-dratase, also called component D, requires activation by component A, the activator or initiator, which transfers one electron to the dehydratase concomita
Trang 1from Clostridium difficile
Jihoe Kim, Daniel Darley and Wolfgang Buckel
Laboratorium fu¨r Mikrobiologie, Fachbereich Biologie, Philipps-Universita¨t, Marburg, Germany
2-Hydroxyacyl-CoA dehydratases are the key enzymes
in the fermentation pathways of 12 proteinogenous
amino acids to ammonia, CO2, short chain fatty acids
and in some cases molecular hydrogen [1] In
Acidami-nococcus fermentans (Clostridiales), Clostridium
sym-biosum and Fusobacterium nucleatum glutamate is
oxidized to 2-oxoglutarate and ammonia, reduced to
(R)-2-hydroxyglutarate and transformed to
(R)-2-hy-droxyglutaryl-CoA, which is reversibly dehydrated to
(E)-glutaconyl-CoA Subsequent decarboxylation leads
to crotonyl-CoA, which disproportionates to acetate,
butyrate and H2[2] The 2-hydroxyglutaryl-CoA
dehy-dratase, also called component D, requires activation
by component A, the activator or initiator, which
transfers one electron to the dehydratase concomitant
with hydrolysis of ATP It has been postulated that
further transfer of the electron to the substrate initiates
the syn-elimination of water via radical intermediates
[3,4] Upon completion of the catalytic cycle the elec-tron is thought to be recycled to the next incoming substrate enabling many turnovers without further ATP hydrolysis The extremely oxygen-sensitive com-ponent A from both, A fermentans [5] and F nuclea-tum [6], are homodimeric enzymes with one [4Fe)4S] cluster bound between the two subunits, with each capable of binding one ATP The dehydratases also contain [4Fe)4S] clusters; the enzymes from A fermen-tans [7] and F nucleatum [8] contain one, whereas in the enzyme from C symbiosum two such clusters have been detected [9] Components D from A fermentans and C symbiosum are heterodimers and contain in addition to the [4Fe)4S] cluster about one mole of riboflavin-5¢-phosphate (FMN) as well as small amounts of riboflavin and molybdenum [7,9] In con-trast, the dehydratase from F nucleatum lacks FMN and molybdenum but contains riboflavin and is
Keywords
ATP; iron–sulfur; leucine fermentation;
electron recycling; radical mechanism
Correspondence
W Buckel, Laboratorium fu¨r Mikrobiologie,
Fachbereich Biologie, Philipps-Universita¨t,
35032 Marburg, Germany
Fax: +49 6421 28 28979
Tel: +49 6421 28 21527
E-mail: buckel@staff.uni-marburg.de
(Received 4 August 2004, revised 12
November 2004, accepted 22 November
2004)
doi:10.1111/j.1742-4658.2004.04498.x
The hadBC and hadI genes from Clostridium difficile were functionally expressed in Escherichia coli and shown to encode the novel 2-hydroxyiso-caproyl-CoA dehydratase HadBC and its activator HadI The activated enzyme catalyses the dehydration of (R)-2-hydroxyisocaproyl-CoA to isocaprenoyl-CoA in the pathway of leucine fermentation The extremely oxygen-sensitive homodimeric activator as well as the heterodimeric dehy-dratase, contain iron and inorganic sulfur; besides varying amounts of zinc, other metal ions, particularly molybdenum, were not detected in the dehy-dratase The reduced activator transfers one electron to the dehydratase concomitant with hydrolysis of ATP, a process similar to that observed with the unrelated nitrogenase The thus activated dehydratase was separ-ated from the activator and ATP; it catalyzed about 104 dehydration turn-overs until the enzyme became inactive Adding activator, ATP, MgCl2, dithionite and dithioerythritol reactivated the enzyme This is the first demonstration with a 2-hydroxyacyl-CoA dehydratase that the catalytic electron is recycled after each turnover In agreement with this observation, only substoichiometric amounts of activator (dehydratase⁄ activator ¼ 10 mol⁄ mol) were required to generate full activity
Abbreviations
FldA, CoA-transferase; FldBC, phenyllactyl-CoA dehydratase; FMN, riboflavin-5¢-phosphate; HadBC, 2-hydroxyisocaproyl-CoA dehydratase; HadI, initiator, activator or archerase of HadBC; ICP-AES, inductively coupled plasma-atomic emission spectroscopy.
Trang 2composed of three subunits [8]; the extra subunit is not
related to any known protein [10]
Besides 2-hydroxyglutaryl-CoA dehydratases,
enz-ymes catalyzing the dehydration of lactyl-CoA to
acry-loyl-CoA from Clostridium propionicum [11,12] and
phenyllactyl-CoA to cinnamoyl-CoA from Clostridium
sporogenes [13] have also been purified Whereas the
lactyl-CoA dehydratase system resembles that of
2-hy-droxyglutaryl-CoA dehydratase from C symbiosum,
phenyllactyl-CoA dehydratase (FldBC) forms a
com-plex with a highly specific class III CoA-transferase
(FldA) The complex FldABC catalyses the overall
dehydration of (R)-phenyllactate to cinnamate in the
presence of catalytic amounts of cinnamoyl-CoA after
activation by ATP, MgCl2 and a reducing agent
medi-ated by FldI [13,14] Our studies with phenyllactate
dehydratase revealed a similar arrangement of
homo-logous genes in the genome of Clostridium difficile,
designated as hadA, hadI, hadB and hadC, for
hydroxy-acyl-CoA dehydratase [13] Upstream of hadA an open
reading frame in the opposite direction (ldhA) was
detec-ted encoding a putative d-2-hydroxy acid
dehydrogenase (Fig 1) We speculated that these genes
could be involved in the fermentation of leucine, the
pre-ferred substrate of C difficile [14,15] Three moles of
leucine are fermented by this organism to a mixture of
fatty acids; two moles of leucine are reduced to
isocaproate, whereas one mole is oxidized to isovalerate and CO2(Eqn 1) ([16,17]; for structures, see Fig 2)
3 lLeucine þ 2 H2O¼ 3 NHþ4 þ CO2þ isovalerate
þ 2 isocaproate Eqnð1Þ DG¢ ¼)146 kJÆreaction)1[18]
A proposed pathway is shown in Fig 2 The forma-tion of isocaproate should proceed via the dehydraforma-tion
of (R)-2-hydroxyisocaproyl-CoA to 2-isocaprenoyl-CoA In this paper we describe the expression of hadI and hadBC in Escherichia coli and characterize the respective gene products as functional activator⁄ initiator and 2-hydroxyisocaproyl-CoA dehydratase, respectively
Fig 1 Gene arrangement for the 2-hydroxyisocaproyl-CoA dehydra-tase system of C difficile ldhA, hydroxyisocaproate dehydroge-nase; hadA, isocaproyl-CoA: 2-hydroxyisocaproate CoA-transferase; hadI, activator of the dehydratase; hadBC, dehydratase, acdB; acyl-CoA dehydrogenase; etfBA, electron transferring flavoprotein
Fig 2 Proposed L -leucine fermentation
pathway of C difficile LdhA,
(R)-2-hydroxy-isocaproate dehydrogenase; HadA,
isocaproyl-CoA: 2-hydroxyisocaproate
CoA-transferase; HadI, activator of
dehydra-tase; HadBC, 2-hydroxyisocaproyl-CoA
dehydratase; Fd – , reduced ferredoxin.
Trang 3Cloning of the genes, hadI and hadBC
The genes, hadI for activator or initiator and hadBC
for the two subunits of the dehydratase, were identified
in the gene cluster of the putative
2-hydroxyisocap-royl-CoA dehydratase system of C difficile as
des-cribed earlier [14] For gene cloning, PCR primers
were designed on the basis of identified ORFs In the
case of hadI and hadB the second in frame ATG start
codons were chosen, because their distance of nine and
seven nucleotides, respectively, from the
Shine–Dal-garno sequences [19] were similar to those in the ldhA,
hadAand hadC genes (Fig 3) The primers for cloning
into the expression vectors (pASK-IBA7 or 3)
con-tained a cleavage site for the restriction enzyme BsaI
and provided an 8-amino acid Strep-tag II peptide
(Trp-Ser-His-Pro-Gln-Phe-Glu-Lys) on the C-terminal
ends of the proteins for one-step purification The
nuc-leotide sequence (810 bp) of the cloned hadI showed
two nucleotide substitutions at C303fiT and
A645fiG, but the encoded 266 amino acids were
100% identical to those of the sequence from the
Sanger Center (see acknowledgement), GenBank
acces-sion number AY772815 The genes hadB and hadC
encoding the two subunits of the dehydratase were
amplified as one fragment and cloned into
pASK-IBA3 giving Np3 BC The nucleotide sequence of the
cloned hadBC was composed of 2354 bp encoding 783
amino acids; three silent nucleotide substitutions were
found at G285fiA, T870fiC and T2003fiC, GenBank
accession number AY772816
Activator of 2-hydroxyisocaproyl-CoA
dehydratase, HadI
HadI was identified by homology analysis with
the known activators of C sporogenes (FldI) and
A fermentans (HgdC) showing 55 and 51% amino
acid sequence identities, respectively Similar to HgdC
[7] and FldI [14], HadI was produced in E coli
through gene expression and purified by affinity
chromatography, because these activators are extre-mely sensitive against oxygen and difficult to purify in sufficient amounts from the original organism In order to produce the activator of 2-hydroxyisocaproyl-CoA dehydratase HadI from C difficile, E coli cells harbouring the Np3I plasmid were grown and induced under anaerobic conditions The harvested cells were opened by a French Press to avoid heating the sensi-tive enzyme by sonication and the produced protein fused with a C-terminal Strep-tag II peptide was puri-fied by one-step affinity column The pure activator was eluted in buffer (see Experimental procedures) containing 1 mm ADP and 10 mm MgCl2 to maintain stability (Fig 4) By chemical analysis, 4 ± 0.5 nonh-eme iron and 2 ± 0.1 acid-labile sulfur were detected indicating one [4Fe)4S] cluster in the isolated protein The low observed sulfur content presumably resulted from loss of H2S during storage of the extremely labile [4Fe)4S] protein The UV-visible spectrum of the puri-fied activator as isolated showed a maximum around
370 nm (Fig 5) Reduction of the [4Fe)4S]2+ cluster with 11 equivalents of dithionite gave a shoulder around 420 nm concomitant with a 20% decrease in
Fig 3 Nucleotide sequences around the ribosome binding site and start codons of the genes The ribosome binding sites and the start codons are shown in bold letters Abbreviations of the genes are as described in Fig 1 The number of nucleotides shows the nucleotide space between ribosome binding site and start codon By using the italicized start codons no active proteins could be obtained.
Fig 4 Purification of recombinant HadI, activator of dehydratase SDS ⁄ PAGE (15%) stained with Coomassie brilliant blue M, molecular mass marker; CFE, cell-free extract induced with anhydrotetracycline, 200 lgÆL)1; FT, flow through from the column;
Ac, purified activator.
Trang 4absorbance and the appearance of second shoulder
between 500 and 600 nm A 10-fold excess of thionine
oxidized HadI (as isolated) with a maximum around
400 nm Oxidized ( 1 s)1) well as reduced HadI
( 2 s)1) showed low ATPase activities But in the
presence of the dehydratase (20 lg HadBC⁄ mL)
reduced HadI (1.0 lgÆmL)1) catalyzed the hydrolysis
of ATP very efficiently (50 s)1), almost independent of
whether the substrate was added (45 s)1)
2-Hydroxyisocaproyl-CoA dehydratase (HadBC)
An E coli cell-free extract containing the recombinant
dehydratase produced from the hadBC genes showed
by SDS⁄ PAGE thick protein bands around the
43-kDa molecular mass marker, which were not seen
in the extract of noninduced E coli cells A
dehydra-tase activity of 9 UÆmg)1, equal to that in the
C difficile cell-free extract, was obtained Unfortu-nately, the produced protein could not be purified using the affinity column, probably because the Strep-tag II peptide at the C-terminus of the HadC subunit was buried inside the protein and could not bind to the column The dehydratase was therefore purified from C difficile cell-free extracts by three chromatog-raphy columns (Table 1) SDS⁄ PAGE of the purified enzyme showed two protein bands (calculated masses
of two subunits, HadB¼ 46 578 Da and HadC ¼
42 350 Da) just below the 43 kDa protein molecular mass marker (Fig 6) On a gel filtration column, the enzyme eluted at a size ( 90 kDa) corresponding to the heterodimer (89 kDa) The N-terminal amino acid sequences of two subunits determined by the Edman degradation method revealed that the upper band was the slightly smaller HadC (MEAILSKMKE) and the lower band the somewhat larger HadB (SEKKE ARVVI) confirming the correct start codon The UV-visible spectrum of purified 2-hydroxyisocaproyl-CoA dehydratase showed a typical spectrum of iron–sulfur
Fig 5 UV-visible spectra of purified activator of the dehydratase,
HadI Solid line, as isolated (4.2 mgÆmL)1); dotted line, reduced
with a 10-fold excess of dithionite in 50 m M Mops pH 7.0, 10 m M
MgCl2, 1 m M ADP and 5 m M dithiothreitol (0.5 mgÆmL)1; eightfold
amplified); dashed line, oxidized with a 10-fold excess of thionine in
the same buffer condition (0.5 mgÆmL)1; eightfold amplified).
Excess reductant or oxidant was removed by desalting through
Sephadex G-25 columns.
Table 1 Purification of 2-hydroxyisocaproyl-CoA dehydratase from C difficile and E coli.
a Starting from 15 g wet cell paste; b 6 g wet cell paste.
Fig 6 SDS ⁄ PAGE of purified 2-hydroxyisocaproyl-CoA dehydratase (HadBC) The gel was (8%) stained with Coomassie brilliant blue.
M, molecular mass marker; lanes 1–3, purified protein.
Trang 5cluster(s) (Fig 7) Chemical analysis revealed
5.7 ± 0.1 nonheme iron and 6.1 ± 0.5 acid-labile
sul-fur Metal contents were also estimated by inductively
coupled plasma atomic emission spectroscopy
(ICP-AES, model Optima 3000, PerkinElmer,
Rodgau-Ju¨ge-sheim, Germany) Two preparations of the dehydratase
were analyzed The iron content was estimated as 3.8
and 4.1 mol⁄ mol homodimer; cobalt, nickel and
molybdenum were absent (< 0.01), but surprisingly
stoichiometric amounts of zinc were found in the
pre-parations, 1.1 and 1.9 molÆmol)1, respectively The
supernatant of the enzyme after treatment with anoxic
0.2 m trichloroacetic acid showed a characteristic
UV-visible spectrum of oxidized flavin (peaks at 370 nm
and 450 nm), but no significant flavin content (< 5%
of the dehydratase) was detected by HPLC comparing
with FMN, FAD and riboflavin standards After
oxi-dation with air the UV-visible spectrum of the
super-natant showed a new peak at 300 nm and a shoulder
around 325 nm, which could not be assigned to any
known cofactor Probably this absorption was due to
oxidized iron sulfide
Using the same method as applied for the
purifica-tion of the 2-hydroxyisocaproyl-CoA dehydratase from
cell-free extracts of C difficile, the recombinant
enzyme with a nonfunctional Strep-tag at the
C-termi-nus of the C-subunit could be also obtained in pure
form from E coli The properties of the recombinant
dehydratase (Vmax and Km, see below) were identical
to those of the enzyme from C difficile ICP-AES
analysis revealed 5.3 iron, 3.2 zinc, 0.2 nickel and
0.08 cobalt mol⁄ mol enzyme, but no molybdenum
(< 0.01)
(R)-2-Hydroxyisocaproyl-CoA dehydratase activity 2-Hydroxyisocaproyl-CoA dehydratase activity was measured in the presence of ATP, MgCl2, dithionite, dithiothreitol, serum albumin and activator Addition
of (R)-2-hydroxyisocaproyl-CoA started this assay and the formation of isocaprenoyl-CoA was followed at
290 nm (De ¼ 2.2 mm)1Æcm)1) Due to the high absorbance of the adenine moiety of CoA, the absorb-ance maximum at 263 nm was not used The product isocaprenoyl-CoA was identified by MALDI-TOF mass spectrometry (Mr¼ 865) and by comparison with the chemically synthesized compound The enzyme accepted only (R)-2-hydroxyisocaproyl-CoA with the S-isomer showing less than 10% activity, which might be due to a contamination of the R-iso-mer As an equal mixture of (R)- and (S)-2-hydroxy-isocaproyl-CoA gave only one-half of the enzymatic activity, we assume that that the S-isomer was also able to bind at the active site of the enzyme but could not be dehydrated The apparent Km value for (R)-2-hydroxyisocaproyl-CoA was 50–80 lm and Vmax was determined as 110–150 UÆmg)1(160–220 s)1) using different dehydratase preparations In assays using (E)-isocaprenoyl-CoA as substrate, no activity could
be observed suggesting that the dehydration is irrevers-ible under these conditions or the Z-isomer is the cor-rect product (E)-Isocaprenoyl-CoA (400 lm) was shown to decompose slowly (5 nmolÆmin)1) under the assay conditions regardless whether the dehydratase was present (compare Fig 9, in which an absorbance maximum is observed after addition 3) The product could not be identified by MALDI-TOF spectrometry Recombinant HadI activated the dehydratase in the presence of ATP, MgCl2 and a one-electron reducing agent titanium(III) citrate or dithionite, but the initial experiments revealed a dependence of the activity on the applied amount of activator (Fig 8) Hence, it appeared that each dehydratase molecule required one activator molecule and ATP is hydrolyzed during every turnover A true activator, however, should act catalyt-ically; it should be able to serve many dehydratase molecules, each of which catalyses many turnovers without further hydrolysis of ATP Subsequent experi-ments indicated that the low dehydratase⁄ activator ratio £ 1 required to get high activity was due to the instability of the activator in the assay mixture The activator HadI could be stabilized with 5 mm dithio-threitol and 1 lm bovine serum albumin, probably by removing trace amounts of oxygen and preventing dis-sociation into subunits Under these conditions a dehy-dratase⁄ activator ratio of 10 gave an even higher dehydratase activity than a ratio of 0.2 in the absence
Fig 7 UV-visible spectra of 2-hydroxyisocaproyl-CoA dehydratase.
Solid line, as isolated (1.2 mgÆmL)1); activated dehydratase
separ-ated from activator (1.2 mgÆmL)1) The insert shows the difference
spectrum of activated dehydratase (dashed line) minus isolated
de-hydratase The peak at 320 nm stems from dithionite.
Trang 6of the stabilisators (Fig 8) The experiments indicate,
however, that at a dehydratase⁄ activator ratio of 10 a
preincubation time of at least 40 min is required to
reach full activity Immediate activation was only
obtained by using dehydratase⁄ activator ratios £ 0.1
(Fig 8)
In a critical experiment, 4.4 mg dehydratase was
activated for 30 min in the presence of 1.0 mg
activa-tor (dehydratase⁄ activator ¼ 3), 0.4 mm ATP, 10 mm
MgCl2, 5 mm dithiothreitol and 0.1 mm dithionite in
50 mm Mops pH 7.0 (total volume 2 mL)
Dehydra-tase activity was assayed by diluting a 1.0 lL sample
into 0.5 mL 0.4 mm (R)-2-hydroxyisocaproyl-CoA in
50 mm Tris⁄ HCl pH 8.0 (139 s)1) The active
dehy-dratase was separated from its activator through a
Strep-Tactin column The tagged activator bound to
the column, while the active dehydratase passed
through A 2.0 lL sample of the flow-through was
assayed in the same manner as above (69 s)1); after
two successive substrate additions the activity was
almost completely lost (Fig 9) SDS⁄ PAGE revealed
the double band of the dehydratase around 43 kDa
but no band at 30 kDa indicating that > 95% of
activator was removed Activation by 0.4 mm ATP,
0.1 mm dithionite and a > 10-fold molar excess of
activator immediately restored the complete activity
(68 s)1) Hence the activated dehydratase irreversibly
lost 50% of its activity during passage through the
Strep-Tactin column; the remaining 13.5 pmol active
enzyme dehydrated 103 nmol
(R)-2-hydroxyisocap-royl-CoA (7600 turnovers) until activity ceased
After-wards by addition of activator and ATP the enzyme
regained the same activity, which was measured after
the passage through the affinity column This experi-ment showed that the activated dehydratase retained its activity (a) in the absence of 0.4 mm ATP, which was diluted in the assay prior to the affinity chroma-tography to 0.8 lm; (b) after affinity chromachroma-tography
at < 0.8 lm ATP and in the absence of at least 95% of the activator (dehydratase⁄ activator > 60 and absence of stabilisators); (c) turnover causes rapid inactivation; and (d) activator and ATP recovered the activity, which was lost during turnover The UV-vis-ible spectra between 300 and 700 nm of the dehydra-tase as isolated and after activation and affinity chromatography revealed the absorbance of a [4Fe)4S]2+ cluster around 400 nm (Fig 7) In the difference spectrum (insert of Fig 7) the peak at
320 nm stems from dithionite, whereas the increase in absorbance around 400 nm may be caused by the irreversible inactivation of 50% of the dehydratase during affinity chromatography In another experiment,
in which the Strep-Tactin column was not treated with dithionite prior to the affinity chromatography (see below), the yield of active dehydratase was only 10%, but the absorbance increase around 400 nm was higher In contrast to that expected for a reduction of a [4Fe)4S]2+ cluster, no decrease in absorbance was observed
Fig 8 Activation of the dehydratase by its activator Dehydratase
activities were measured in 50 m M Tris ⁄ HCl pH 8.0, 5 m M MgCl2,
0.1 m M dithionite, and 0.4 m M ATP, and the reactions were started
by adding 200 l M (R)-2-hydroxyisocproyl-CoA at the indicated
pre-incubation times The molar ratios of dehydratase ⁄ activator were:
0.2, n; 1.0, h; 10, s; 10 in the presence of 5 m M dithiothreitol and
1 l M bovine serum albumin, d.
Fig 9 The activity assay of activated dehydratase separated from the activator by passage through a Strep-Tactin column The assay (total volume 500 lL) contained 27 pmol active dehydratase in
50 m M Tris ⁄ HCl pH 8.0 in absence of ATP, MgCl 2 , dithionite and di-thiothreitol The reaction was started by adding 0.2 lmol of the substrate (R)-2-hydroxyisocaproyl-CoA (arrow 1) After the substrate was consumed (DA 290nm ¼ 0.455), further 2 · 0.2 lmol substrate was added at arrows 1 and 2 The activity was recovered by addi-tion of an excess amount of activator (> 10-fold), 0.4 m M ATP,
5 m M MgCl 2 , 5 m M dithiothreitol and 0.1 m M dithionite (arrow 3) The decrease in absorbance after 20 min was due to the instability
of the product isocaprenoyl-CoA.
Trang 7It was suggested that 2-hydroxyisocaproyl-CoA
dehydratase could be the most sensitive target of
met-ronidazole [14], which has been used as an antibiotic
for C difficile infections in the human body [20]
Met-ronidazole inhibited effectively cell growth (50%
inhi-bition at 10 lm) and the dehydratase activity was
completely abolished at 20 lm, probably by oxidation
of the activated enzyme by the nitro group of the
inac-tivator [21]
Discussion
The experiments described in this work clearly show
that the hadIBC-genes of C difficile encode a novel
2-hydroxyacyl-CoA dehydratase (HadBC) and its
acti-vator (HadI), probably specific for the dehydration of
(R)-2-hydroxyisocaproyl-CoA to isocaprenoyl-CoA,
but besides the S-isomer no other substrate was tested
As the known enzymatic eliminations of water
from (R)-2-hydroxyacyl-CoA to (E)-2-enoyl-CoA
(R)-2-hydroxyglutaryl-CoA to (E)-glutaconyl-CoA [22]
(R)-lactyl-CoA to acryloyl-CoA [23] and
(R)-phenyllac-tyl-CoA to (E)-cinnamoyl-CoA [24] all occur in a
syn-fashion, we assume that this will also be the case for
(R)-2-hydroxyisocaproyl-CoA to
(E)-2-isocaprenoyl-CoA, which, however, remains to be determined The
inability to measure the hydration of the chemically
synthesized (E)-2-isocaprenoyl-CoA could be either
due to the unfavourable equilibrium or due to the
Z-isomer being the correct substrate It has been
shown that 2-hydroxyglutaryl-CoA dehydratase indeed
catalyzed the reverse reaction The conditions,
how-ever, were different; this experiment was performed in
the cell-free extract using (E)-glutaconate in the
pres-ence of acetyl-CoA as substrate and the formed
(R)-2-hydroxyglutarate was determined enzymatically [22]
The 2-hydroxyisocaproyl-CoA dehydratase fits well
into the proposed pathway of leucine fermentation by
C difficile In addition we showed that ldhA encodes a
fairly specific NAD-dependent
(R)-2-hydroxyisocapro-ate dehydrogenase (GenBank accession number
AY772817) and hadA a highly specific class III [25]
2-hydroxyisocaproate CoA-transferase using
(R)-2-hy-droxyisocaproyl-CoA and (E)-isocaprenoate, probably
as well as isocaproate as substrates (GenBank
acces-sion number AY772818) [26] The genes acdB, etfB
and etfA, downstream of hadBC, are related to those
of an acyl-CoA dehydrogenease and an
electron-trans-ferring flavoprotein, which most likely are involved in
the reduction of isocaprenoyl-CoA to isocaproyl-CoA
Finally the CoA-transferase HadA may liberate the
product isocaproate (Figs 1 and 2) An ambiguous step
is the conversion of leucine to 2-oxoisocaproate, which
may proceed via amino transfer to 2-oxoglutarate fol-lowed by dehydrogenation of the formed glutamate (Fig 2) or by a direct one-step oxidative deamination
of leucine Although the arrangement of the hadAIBC genes are very similar to those involved in the dehy-dration of (R)-phenyllactate to (E)-cinnamate [13], a stable complex of the 2-hydroxyisocaproyl-CoA dehy-dratase (HadBC) with the CoA-transferase (HadA) could not be detected, as both enzymes separate during purification
The requirement of activator (HadI), dehydratase (HadBC), ATP, Mg2+, dithiothreitol and dithionite for the activity of 2-hydroxyisocaproyl-CoA dehydra-tase indicates that this enzyme acts by the same mech-anism as that proposed for 2-hydroxyglutaryl-CoA dehydratase [27] (Fig 10) The reduced activator trans-fers one electron to the dehydratase concomitant with hydrolysis of ATP Although the stoichiometry of 1 or
2 ATP⁄ electron remains to be determined, the homo-dimeric structure of the activator with one [4Fe)4S] cluster and two ATP binding sites strongly suggests 2 ATP⁄ electron as observed with nitrogenase [28] The reduced dehydratase transfers the electron further to the substrate to generate the ketyl radical anion I, which expels the adjacent hydroxyl group The formed enoxy radical can now be deprotonated at the b-posi-tion to the product-related ketyl radical anion II, which is oxidized to isocaprenoyl-CoA by the next incoming substrate 2-hydroxyisocaproyl-CoA, whereby the electron is recycled It has been calculated that the extremely high pK of the b-protons of 2-hydroxyiso-caproyl-CoA ( 40), is lowered by 26 units to pK ¼
14 in the enoxy radical [29] This fairly low pK could
be even further decreased to about 7 by hydrogen
Fig 10 Proposed mechanism of dehydration from (R)-2-hydroxyiso-caproyl-CoA to (E)-2-isocaprenoyl-CoA For protein abbreviations, see Fig 2.
Trang 8bonds from backbone amides of the enzyme to the
carbonyl oxygen and thus gets into the range of
the pK of carboxylates or imidazolyl residues of the
enzyme [30]
One major support for this mechanism comes from
experiments described in this work For the first time
it has been shown that catalytic amounts of activator
(HadBC⁄ HadI ¼ 10 mol ⁄ mol) are sufficient to get
maximum dehydratase activity This important finding
was due to the development of a direct
spectrophoto-metric assay of the dehydratase and to the improved
stability of HadI through the addition of serum
albu-min and dithiothreitol In previous work an assay with
six auxiliary enzymes was used and hence gave only
qualitative data [8,31] Furthermore, the activated
dehydratase could be separated from the activator and
retained its activity for almost 104 turnovers This
experiment clearly demonstrated that ATP and Mg2+
are only required for activation and ATP is not used
to phosphorylate the hydroxyl group in order to
facili-tate the elimination as suggested in the early work on
lactyl-CoA dehydratase The authors Anderson and
Wood [32] have already addressed the energetic enigma
if each dehydration would require one ATP, this
means in the case of C difficile that generation of one
ATP by substrate-level phosphorylation consumes two
ATP (Fig 2 and Eqn 1) Therefore it was proposed
that one ATP must be sufficient to activate the
dehy-dratase for at least 100 turnovers [1], which has now
been experimentally verified The activated enzyme
may become inactivated simply by one-electron
oxida-tion with traces of oxygen or by a second electron
transfer to a radical intermediate, which would result
in isocaproyl-CoA rather than isocaprenoyl-CoA as
product, but according to the measured turnover only
one in 104 The inactivation by substrate is reminiscent
of coenzyme B12-dependent mutases The suicide
inac-tivation of b-lysine 5,6-aminomutase is caused by
the substrate-induced one electron transfer from
cob(II)alamin to the 5¢-deoxadenosyl radical resulting
in the inactive pair of cob(III)alamin and
5¢-deoxyadenosine [33]
In our publications on 2-hydroxyglutaryl-CoA
dehy-dratase [1,3,4], the terms component A and component
D were used, A for activator and D for dehydratase,
implicating that only both components together are
able to form an active enzyme The important result
that even in the absence of activator the activated
2-hydroxyisocaproyl-CoA dehydratase is catalytically
active has consequences for the nomenclature From
this paper onward we will call component A just
activator or archerase [1] and component D just
dehydratase
Previous work on 2-hydroxyglutaryl-CoA dehydra-tase showed that the activator alone had ATPase activ-ity (4–6 s)1) but only in the oxidized state [3] The results in this work, which revealed low ATPase activ-ities of the activator HadI regardless of its oxidation state, question those data Therefore the original data obtained with the activator of 2-hydroxyglutaryl-CoA dehydratase have been re-calculated and found too high by a factor of 10 Furthermore, repetition of the ATPase measurements with the activator from A fer-mentans by applying the conditions used in this work also gave only low activities (M Hetzel & W Buckel, unpublished results) Addition of dehydratase to the corresponding reduced activator, however, gave high ATPase activities; in case of HadI + HadBC up to
50 UÆmg)1 activator was achieved These results fit much better to the proposed mechanism, as the elec-tron should only be transferred in a complex of both proteins driven by ATP hydrolysis
Another important result of this work is the finding that 2-hydroxyisocaproyl-CoA dehydratase, the 2-hyd-roxyacyl-CoA dehydratase with highest ever-observed activity (up to 220 s)1), contains no molybdenum and hardly any flavin Therefore these two cofactors seem not to play important roles also in the other 2-hydroxy-acyl-CoA dehydratases Molybdenum may be an impurity that could not be separated from 2-hydroxy-glutaryl-CoA dehydratase and flavin (FMN and⁄ or riboflavin) could bind fortuitously Interestingly, crude preparations of 2-hydroxyisocaproyl-CoA dehydratase obtained from C difficile do contain molybdenum, which is removed during further purification without decreasing the activity The only prosthetic group of the dehydratase, which after activation could carry the catalytic electron, is a putative [4Fe)4S] cluster, whose structure remains to be determined by spectroscopic and crystallographic methods The failure to see the reduction of the cluster in the active dehydratase by a decrease in absorbance at 400 nm may be due to the concomitant increase in absorbance of half of the dehydratase irreversibly inactivated during separation from its activator This cluster must have a very negat-ive redox potential (E0¢ ¼ <) 600 mV), as no activity could be observed after treatment of the inactive dehy-dratase with excess dithionite or titanium(III) citrate in the absence of the activator HadI and ATP On the other hand this cluster cannot be very unusual, as it is synthesized by enzymes not only present in C difficile but also in E coli [34] as shown by the functional heterologous expression of the hadBC genes The role
of zinc, if any, remains to be established Hence, 2-hydroxyisocaproyl-CoA dehydratase and its activator appear as simple iron–sulfur proteins without any
Trang 9special cofactors or rare elements Owing to this
sim-plicity, one may conclude that 2-hydroxyacyl-CoA
de-hydratases have evolved very early during the
emergence of life [35], probably with an unknown
ana-bolic rather than a cataana-bolic function
Experimental procedures
Materials
C difficile (DSMZ 1296T) was purchased from the
Deut-sche Sammlung fu¨r Mikroorganismen und Zellkulturen
(DMSZ, Braunschweig, Germany) and E coli,
BL21-Co-donPlus(DE3)-RIL strain for gene expression was obtained
from Stratagene (Heidelberg, Germany) The affinity
col-umn, Strep-Tactin MacroPrep was purchased from IBA
GmbH (Go¨ttingen, Germany) The enzymes for molecular
biology were obtained from New England Biolabs
(Frank-furt am Main, Germany), ABgene (Hamburg, Germany)
and Amersham Biosciences (Freiburg, Germany) Primers
were purchased from MWG (Ebersberg, Germany) Protein
molecular mass markers and DNA size markers were
obtained from Amersham Biosciences
Experiments under anoxic conditions
Purification of the activator and 2-hydroxyisocaproyl-CoA
dehydratase were performed at 15–20C in an ‘Anaerobic
Chamber’ (Coy Laboratories, Ann Arbor, MI, USA) under
a nitrogen atmosphere containing 5% H2 Oxygen was
removed from buffers for enzyme purification by boiling
and cooling under vacuum Afterwards the buffers were
flushed with nitrogen, transferred to the anaerobic chamber,
and stirred overnight In the chamber, 2 mm dithiothreitol
was added to each buffer Enzyme activity was determined
inside the anaerobic chamber with an Ultrospec 4000
spec-trophotometer from Amersham Biosciences
Chemicals and synthesis of CoA-esters
(R)-2-Hydroxyisocaproate and (S)-2-hydroxyisocaproate
were obtained from d- and l-leucine, respectively, by
treat-ment of the corresponding amino acids with sodium nitrite
in dilute sulfuric acid [36] (E)-2-Isocaprenoate
(4-methyl-trans-2-pentenoic acid) was synthesized from
isobutyralde-hyde and malonic acid in pyridine-piperidine [37] (R)- and
(S)-2-Hydroxyisocaproyl-CoA and (E)-2-isocaprenoyl-CoA
were prepared from the corresponding acids following the
modified anhydrous 1,1¢-carbonyldiimidazole synthesis [38]
Gene cloning
Routine manipulation of plasmid DNA, PCR, the
construc-tion of recombinant plasmids and isolaconstruc-tion of chromosomal
DNA from C difficile were performed using standard techniques [39] The ORF hadI was amplified with follow-ing primers: FhadI, 5¢-ATGGTAGGTCTCAAATGTACA CAATGGGATTAGATATAGGTTC-3¢; RhadI, 5¢-ATGG TAGGTCTCAGCGCTTATATTTTTCACTTCTTTTTGT GATTCT-3¢
PCR was performed using proof reading polymerase, Extensor Hi-Fidelity PCR Enzyme Mix (ABgene, Ham-burg, Germany) and the amplified fragment was cloned into the BsaI restriction site [GGTCTC(N)1] of the expression vector pASK-IBA3 providing a C-terminal Strep-tag II pep-tide (Trp-Ser-His-Pro-Gln-Phe-Glu-Lys) fused protein The plasmid construct, pASK-IBA3::hadI, was named Np3I The ORF hadBC was amplified with following primers: FhadBC, 5¢-ATGGTAGGTCTCAAATGTCTGAAAAAAAAGAAG CTAGAGTAGT-3¢; RhadBC, 5¢-ATGGTAGGTCTCAG CGCTCGCTAAACTCATCATCTCAGCAAA-3¢ The amplified fragment using proofreading polymerase was cloned into the BsaI restriction site of pASK-IBA3 giv-ing Np3 bc In order to exclude readgiv-ing errors of the polymerase, three different clones from three different PCR products were sequenced The sequencing primers labelled
at their 5¢ end with the infrared dye IRD-41 were obtained from MWG-Biotech (Ebersberg, Germany)
Gene expression and purification of the activator
Plasmid constructs, Np3I or Np3 BC, were transformed into E coli BL21-CodonPlus(DE3)-RIL harbouring addi-tional rare codon tRNA genes (arg, ileY and leuW), in order to express the relevant genes An overnight preculture (100 mL) of a fresh single colony was used to inoculate 2 L Standard I medium (Merck, Darmstadt, Germany) contain-ing antibiotics (ampicillin, 100 lgÆmL)1, and chlorampheni-col, 50 lgÆmL)1) at 30C (or room temperature for Np3 BC) under anoxic conditions When the culture reached the mid-exponential phase, A590¼ 0.5–0.7, gene expression was induced with anhydrotetracycline (200 lgÆL)1) After another 3 h growth, the culture was transferred to the anaerobic chamber Cells were harvested
by centrifugation in airtight bottles, washed and suspended
in 50 mm Mops pH 7.0, 300 mm NaCl, 10 mm MgCl2, and
5 mm dithiothreitol Cells in serum bottles tightly closed with rubber stoppers were transferred through a needle into the French Press operating at 140 MPa After the cell
deb-ris had been removed by ultracentrifugation at 100 000 g
for 1 h, the supernatant was loaded on a 5 mL Strep-Tactin MacroPrep column, which was equilibrated with the buffer used for suspending the cells After loading, the column was washed with at least 10 column volumes of equilibra-tion buffer and the enzyme was eluted with equilibraequilibra-tion buffer containing 3 mm d-desthiobiotin and 1 mm ADP Afterwards d-desthiobiotin was removed by gel filtration on Sephadex G-25 equilibrated with 50 mm Mops pH 7.0,
1 mm ADP, 10 mm MgCl2and 5 mm dithiothreitol
Trang 10Purification of 2-hydroxyisocaproyl-CoA
dehydratase from C difficile
C difficile cells were cultivated as described before [40] in
2 L tightly closed bottles containing anoxic defined medium
[41] supplemented with l-leucine (1 gÆL)1; 7.6 mm) Cells
were harvested, washed and suspended in buffer A
contain-ing 50 mm Mops pH 7.0 and 2 mm dithiothreitol, yield 3 g
wet cell paste The preparation of the cell free extract was
performed as that described in the activator purification
The cell free extract was filtered (0.45 lm pore size) and
loaded a DEAE-Sepharose fast-flow column (3· 10 cm)
equilibrated with buffer A The column was washed with
70 mL buffer A and the proteins were eluted at a rate of
3 mLÆmin)1 with a linear gradient of 0–1.0 m NaCl in
buf-fer A The active brown fractions were eluted around 0.4 m
NaCl An equal volume of 2.0 m (NH4)2SO4 in buffer A
was added to the pooled fractions from the first column,
which were then loaded on a phenyl-Sepharose column
(3· 10 cm) equilibrated with buffer B, 50 mm Mops
pH 7.0, 1.0 m (NH4)2SO4, 2 mm dithiothreitol After
wash-ing the column with 70 mL buffer B, the active brown
dehydratase eluted around 0.1 m (NH4)2SO4 with a linear
gradient of 1.0–0 m (NH4)2SO4 in buffer B at a rate of
3 mLÆmin)1 The dehydratase fractions were concentrated
on an Amicon PM 30 cell and desalted against buffer A,
then loaded on a Q-Sepharose column (1.8· 10 cm)
equili-brated with buffer A After a washing step with 60 mL
buf-fer A, the dehydratase was eluted around 0.5 m NaCl with
a linear gradient of 0–1.0 m NaCl in buffer A at a rate of
3 mLÆmin)1 The dehydratase was finally concentrated with
an Amicon Ultra-4 PLTK Ultracel-Pl (30 kDa cut-off)
The recombinant 2-hydroxyisocaproyl-CoA dehydratase
from E coli was purified by the same method, as the
enzyme was not absorbed at the Strep-Tactin MacroPrep
column After the phenyl-Sepharose column the enzyme
was already pure and therefore the Q-Sepharose column
could be omitted
Determination of enzyme activity
2-Hydroxyisocaproyl-CoA dehydratase activity was
meas-ured using a continuous direct assay based on the difference
between the extinction coefficients of
2-hydroxyisocaproyl-CoA and 2-isocaprenoyl-2-hydroxyisocaproyl-CoA at 290 nm (De ¼ 2.2 mm)1Æ
cm)1) The dehydratase was incubated for 5 min with an
equal molar amount of recombinant activator in the
presence of 50 mm Tris⁄ HCl pH 8.0, 5 mm MgCl2, 0.4 mm
ATP, 0.1 mm dithionite or titanium(III) citrate, 5 mm
dithiothreitol and 1 lm bovine serum albumin in a total
volume of 0.5 mL The assay was started by the addition of
200 lm (R)-2-hydroxyisocaproyl-CoA and the absorbance
increase was followed at 290 nm The ATPase activity of
the activator was measured using a coupled assay with
pyruvate kinase and lactate dehydrogenase [42] The
cuvette, total volume 0.5 mL, contained 50 mm Tris⁄ HCl
pH 8.0, 1 mm phosphoenolpyruvate, 10 mm MgCl2, 1 mm ATP, 0.2 mm NADH, 2 U pyruvate kinase and 2 U lactate dehydrogenase After adding the activator, the absorbance
6.3 mm)1Æcm)1[43])
Analysis of CoA-thiol esters by MALDI-TOF mass spectrometry
The molecular mass of a CoA ester produced in an enzymatic
or chemical reaction was confirmed by MALDI-TOF mass spectrometry The reaction was acidified with 1 m HCl to
pH < 4.0 and loaded on Sep-pak C18cartridge (Waters, Eschborn, Germany), which was equilibrated with 0.1% tri-fluoroacetic acid The column was washed with five column-volumes of 0.1% trifluoroacetic acid and the CoA-thiol ester was eluted with 5 mL 1% trifluoroacetic acid in 50% aceto-nitrile After evaporation of the acetonitrile under vacuum, a drop of the CoA-thiol ester solution was applied on a thin layer of indole-2-carboxylic acid on a golden plate prepared from a solution of 300 mm indole-2-carboxylic acid in acet-one and measured under the described conditions [44]
Separation of activated dehydratase from its activator
Dehydratase (4.4 mg) was activated by 1.0 mg activator in the presence of 50 mm Mops pH 7.0, 0.4 mm ATP, 5 mm MgCl2, 5 mm dithiothreitol, and 0.1 mm dithionite (total volume 2.0 mL) as described in activity assay but in the absence of bovine serum albumin After 30-min incubation
at room temperature, 1.0 lL was assayed for activity with-out further activation and the reaction mixture was loaded
on a 5 mL Strep-Tactin MacroPrep column, previously reduced with 50 mm Mops pH 7.0, 5 mm dithiothreitol and 0.1 mm dithionite and equilibrated with 50 mm Mops
pH 7.0, 300 mm NaCl, 10 mm MgCl2and 5 mm dithiothre-itol The tagged activator was bound to the column while the dehydratase-containing flow through was collected in
1 mL fractions An UV-visible spectrum was taken from the peak fraction (1.2 mg dehydrataseÆmL)1), which was also analyzed for activity Therefore a 2 lL aliquot was added to 50 mm Tris⁄ HCl pH 8.0 and the reaction was started with 0.2 lmol (R)-2-hydroxyisocaproyl-CoA, total volume 0.5 mL, d¼ 1 cm After the reaction had ceased, two additional 0.2 lmol (R)-2-hydroxyisocaproyl-CoA aliquots were added Finally the enzyme was reactivated by 0.1 mm dithionite, 0.4 mm ATP, 5 mm MgCl2 and 5 mm dithiothreitol and 30 lg activator (added last) On an SDS⁄ polyacrylamide gel, to which 20 lL of the separated dehydratase were applied, the double band of the dehydra-tase (40 kDa) but no trace of the activator (30 kDa) was visible