Báo cáo khoa học: 2-Hydroxyisocaproyl-CoA dehydratase and its activator from Clostridium difficile pdf

The 2-hydroxyglutaryl-CoA dehy-dratase, also called component D, requires activation by component A, the activator or initiator, which transfers one electron to the dehydratase concomita

from Clostridium difficile

Jihoe Kim, Daniel Darley and Wolfgang Buckel

Laboratorium fu¨r Mikrobiologie, Fachbereich Biologie, Philipps-Universita¨t, Marburg, Germany

2-Hydroxyacyl-CoA dehydratases are the key enzymes

in the fermentation pathways of 12 proteinogenous

amino acids to ammonia, CO2, short chain fatty acids

and in some cases molecular hydrogen [1] In

Acidami-nococcus fermentans (Clostridiales), Clostridium

sym-biosum and Fusobacterium nucleatum glutamate is

oxidized to 2-oxoglutarate and ammonia, reduced to

(R)-2-hydroxyglutarate and transformed to

(R)-2-hy-droxyglutaryl-CoA, which is reversibly dehydrated to

(E)-glutaconyl-CoA Subsequent decarboxylation leads

to crotonyl-CoA, which disproportionates to acetate,

butyrate and H2[2] The 2-hydroxyglutaryl-CoA

dehy-dratase, also called component D, requires activation

by component A, the activator or initiator, which

transfers one electron to the dehydratase concomitant

with hydrolysis of ATP It has been postulated that

further transfer of the electron to the substrate initiates

the syn-elimination of water via radical intermediates

[3,4] Upon completion of the catalytic cycle the elec-tron is thought to be recycled to the next incoming substrate enabling many turnovers without further ATP hydrolysis The extremely oxygen-sensitive com-ponent A from both, A fermentans [5] and F nuclea-tum [6], are homodimeric enzymes with one [4Fe)4S] cluster bound between the two subunits, with each capable of binding one ATP The dehydratases also contain [4Fe)4S] clusters; the enzymes from A fermen-tans [7] and F nucleatum [8] contain one, whereas in the enzyme from C symbiosum two such clusters have been detected [9] Components D from A fermentans and C symbiosum are heterodimers and contain in addition to the [4Fe)4S] cluster about one mole of riboflavin-5¢-phosphate (FMN) as well as small amounts of riboflavin and molybdenum [7,9] In con-trast, the dehydratase from F nucleatum lacks FMN and molybdenum but contains riboflavin and is

Keywords

ATP; iron–sulfur; leucine fermentation;

electron recycling; radical mechanism

Correspondence

W Buckel, Laboratorium fu¨r Mikrobiologie,

Fachbereich Biologie, Philipps-Universita¨t,

35032 Marburg, Germany

Fax: +49 6421 28 28979

Tel: +49 6421 28 21527

E-mail: buckel@staff.uni-marburg.de

(Received 4 August 2004, revised 12

November 2004, accepted 22 November

2004)

doi:10.1111/j.1742-4658.2004.04498.x

The hadBC and hadI genes from Clostridium difficile were functionally expressed in Escherichia coli and shown to encode the novel 2-hydroxyiso-caproyl-CoA dehydratase HadBC and its activator HadI The activated enzyme catalyses the dehydration of (R)-2-hydroxyisocaproyl-CoA to isocaprenoyl-CoA in the pathway of leucine fermentation The extremely oxygen-sensitive homodimeric activator as well as the heterodimeric dehy-dratase, contain iron and inorganic sulfur; besides varying amounts of zinc, other metal ions, particularly molybdenum, were not detected in the dehy-dratase The reduced activator transfers one electron to the dehydratase concomitant with hydrolysis of ATP, a process similar to that observed with the unrelated nitrogenase The thus activated dehydratase was separ-ated from the activator and ATP; it catalyzed about 104 dehydration turn-overs until the enzyme became inactive Adding activator, ATP, MgCl2, dithionite and dithioerythritol reactivated the enzyme This is the first demonstration with a 2-hydroxyacyl-CoA dehydratase that the catalytic electron is recycled after each turnover In agreement with this observation, only substoichiometric amounts of activator (dehydratase⁄ activator ¼ 10 mol⁄ mol) were required to generate full activity

Abbreviations

FldA, CoA-transferase; FldBC, phenyllactyl-CoA dehydratase; FMN, riboflavin-5¢-phosphate; HadBC, 2-hydroxyisocaproyl-CoA dehydratase; HadI, initiator, activator or archerase of HadBC; ICP-AES, inductively coupled plasma-atomic emission spectroscopy.

composed of three subunits [8]; the extra subunit is not

related to any known protein [10]

Besides 2-hydroxyglutaryl-CoA dehydratases,

enz-ymes catalyzing the dehydration of lactyl-CoA to

acry-loyl-CoA from Clostridium propionicum [11,12] and

phenyllactyl-CoA to cinnamoyl-CoA from Clostridium

sporogenes [13] have also been purified Whereas the

lactyl-CoA dehydratase system resembles that of

2-hy-droxyglutaryl-CoA dehydratase from C symbiosum,

phenyllactyl-CoA dehydratase (FldBC) forms a

com-plex with a highly specific class III CoA-transferase

(FldA) The complex FldABC catalyses the overall

dehydration of (R)-phenyllactate to cinnamate in the

presence of catalytic amounts of cinnamoyl-CoA after

activation by ATP, MgCl2 and a reducing agent

medi-ated by FldI [13,14] Our studies with phenyllactate

dehydratase revealed a similar arrangement of

homo-logous genes in the genome of Clostridium difficile,

designated as hadA, hadI, hadB and hadC, for

hydroxy-acyl-CoA dehydratase [13] Upstream of hadA an open

reading frame in the opposite direction (ldhA) was

detec-ted encoding a putative d-2-hydroxy acid

dehydrogenase (Fig 1) We speculated that these genes

could be involved in the fermentation of leucine, the

pre-ferred substrate of C difficile [14,15] Three moles of

leucine are fermented by this organism to a mixture of

fatty acids; two moles of leucine are reduced to

isocaproate, whereas one mole is oxidized to isovalerate and CO2(Eqn 1) ([16,17]; for structures, see Fig 2)

3 l
Leucine þ 2 H2O¼ 3 NHþ4 þ CO2þ isovalerate

þ 2 isocaproate
Eqnð1Þ DG
¢ ¼)146 kJÆreaction)1[18]

A proposed pathway is shown in Fig 2 The forma-tion of isocaproate should proceed via the dehydraforma-tion

of (R)-2-hydroxyisocaproyl-CoA to 2-isocaprenoyl-CoA In this paper we describe the expression of hadI and hadBC in Escherichia coli and characterize the respective gene products as functional activator⁄ initiator and 2-hydroxyisocaproyl-CoA dehydratase, respectively

Fig 1 Gene arrangement for the 2-hydroxyisocaproyl-CoA dehydra-tase system of C difficile ldhA, hydroxyisocaproate dehydroge-nase; hadA, isocaproyl-CoA: 2-hydroxyisocaproate CoA-transferase; hadI, activator of the dehydratase; hadBC, dehydratase, acdB; acyl-CoA dehydrogenase; etfBA, electron transferring flavoprotein

Fig 2 Proposed L -leucine fermentation

pathway of C difficile LdhA,

(R)-2-hydroxy-isocaproate dehydrogenase; HadA,

isocaproyl-CoA: 2-hydroxyisocaproate

CoA-transferase; HadI, activator of

dehydra-tase; HadBC, 2-hydroxyisocaproyl-CoA

dehydratase; Fd – , reduced ferredoxin.

Cloning of the genes, hadI and hadBC

The genes, hadI for activator or initiator and hadBC

for the two subunits of the dehydratase, were identified

in the gene cluster of the putative

2-hydroxyisocap-royl-CoA dehydratase system of C difficile as

des-cribed earlier [14] For gene cloning, PCR primers

were designed on the basis of identified ORFs In the

case of hadI and hadB the second in frame ATG start

codons were chosen, because their distance of nine and

seven nucleotides, respectively, from the

Shine–Dal-garno sequences [19] were similar to those in the ldhA,

hadAand hadC genes (Fig 3) The primers for cloning

into the expression vectors (pASK-IBA7 or 3)

con-tained a cleavage site for the restriction enzyme BsaI

and provided an 8-amino acid Strep-tag II peptide

(Trp-Ser-His-Pro-Gln-Phe-Glu-Lys) on the C-terminal

ends of the proteins for one-step purification The

nuc-leotide sequence (810 bp) of the cloned hadI showed

two nucleotide substitutions at C303fiT and

A645fiG, but the encoded 266 amino acids were

100% identical to those of the sequence from the

Sanger Center (see acknowledgement), GenBank

acces-sion number AY772815 The genes hadB and hadC

encoding the two subunits of the dehydratase were

amplified as one fragment and cloned into

pASK-IBA3 giving Np3 BC The nucleotide sequence of the

cloned hadBC was composed of 2354 bp encoding 783

amino acids; three silent nucleotide substitutions were

found at G285fiA, T870fiC and T2003fiC, GenBank

accession number AY772816

Activator of 2-hydroxyisocaproyl-CoA

dehydratase, HadI

HadI was identified by homology analysis with

the known activators of C sporogenes (FldI) and

A fermentans (HgdC) showing 55 and 51% amino

acid sequence identities, respectively Similar to HgdC

[7] and FldI [14], HadI was produced in E coli

through gene expression and purified by affinity

chromatography, because these activators are extre-mely sensitive against oxygen and difficult to purify in sufficient amounts from the original organism In order to produce the activator of 2-hydroxyisocaproyl-CoA dehydratase HadI from C difficile, E coli cells harbouring the Np3I plasmid were grown and induced under anaerobic conditions The harvested cells were opened by a French Press to avoid heating the sensi-tive enzyme by sonication and the produced protein fused with a C-terminal Strep-tag II peptide was puri-fied by one-step affinity column The pure activator was eluted in buffer (see Experimental procedures) containing 1 mm ADP and 10 mm MgCl2 to maintain stability (Fig 4) By chemical analysis, 4 ± 0.5 nonh-eme iron and 2 ± 0.1 acid-labile sulfur were detected indicating one [4Fe)4S] cluster in the isolated protein The low observed sulfur content presumably resulted from loss of H2S during storage of the extremely labile [4Fe)4S] protein The UV-visible spectrum of the puri-fied activator as isolated showed a maximum around

370 nm (Fig 5) Reduction of the [4Fe)4S]2+ cluster with 11 equivalents of dithionite gave a shoulder around 420 nm concomitant with a 20% decrease in

Fig 3 Nucleotide sequences around the ribosome binding site and start codons of the genes The ribosome binding sites and the start codons are shown in bold letters Abbreviations of the genes are as described in Fig 1 The number of nucleotides shows the nucleotide space between ribosome binding site and start codon By using the italicized start codons no active proteins could be obtained.

Fig 4 Purification of recombinant HadI, activator of dehydratase SDS ⁄ PAGE (15%) stained with Coomassie brilliant blue M, molecular mass marker; CFE, cell-free extract induced with anhydrotetracycline, 200 lgÆL)1; FT, flow through from the column;

Ac, purified activator.

absorbance and the appearance of second shoulder

between 500 and 600 nm A 10-fold excess of thionine

oxidized HadI (as isolated) with a maximum around

400 nm Oxidized ( 1 s)1) well as reduced HadI

( 2 s)1) showed low ATPase activities But in the

presence of the dehydratase (20 lg HadBC⁄ mL)

reduced HadI (1.0 lgÆmL)1) catalyzed the hydrolysis

of ATP very efficiently (50 s)1), almost independent of

whether the substrate was added (45 s)1)

2-Hydroxyisocaproyl-CoA dehydratase (HadBC)

An E coli cell-free extract containing the recombinant

dehydratase produced from the hadBC genes showed

by SDS⁄ PAGE thick protein bands around the

43-kDa molecular mass marker, which were not seen

in the extract of noninduced E coli cells A

dehydra-tase activity of 9 UÆmg)1, equal to that in the

C difficile cell-free extract, was obtained Unfortu-nately, the produced protein could not be purified using the affinity column, probably because the Strep-tag II peptide at the C-terminus of the HadC subunit was buried inside the protein and could not bind to the column The dehydratase was therefore purified from C difficile cell-free extracts by three chromatog-raphy columns (Table 1) SDS⁄ PAGE of the purified enzyme showed two protein bands (calculated masses

of two subunits, HadB¼ 46 578 Da and HadC ¼

42 350 Da) just below the 43 kDa protein molecular mass marker (Fig 6) On a gel filtration column, the enzyme eluted at a size ( 90 kDa) corresponding to the heterodimer (89 kDa) The N-terminal amino acid sequences of two subunits determined by the Edman degradation method revealed that the upper band was the slightly smaller HadC (MEAILSKMKE) and the lower band the somewhat larger HadB (SEKKE ARVVI) confirming the correct start codon The UV-visible spectrum of purified 2-hydroxyisocaproyl-CoA dehydratase showed a typical spectrum of iron–sulfur

Fig 5 UV-visible spectra of purified activator of the dehydratase,

HadI Solid line, as isolated (4.2 mgÆmL)1); dotted line, reduced

with a 10-fold excess of dithionite in 50 m M Mops pH 7.0, 10 m M

MgCl2, 1 m M ADP and 5 m M dithiothreitol (0.5 mgÆmL)1; eightfold

amplified); dashed line, oxidized with a 10-fold excess of thionine in

the same buffer condition (0.5 mgÆmL)1; eightfold amplified).

Excess reductant or oxidant was removed by desalting through

Sephadex G-25 columns.

Table 1 Purification of 2-hydroxyisocaproyl-CoA dehydratase from C difficile and E coli.

a Starting from 15 g wet cell paste; b 6 g wet cell paste.

Fig 6 SDS ⁄ PAGE of purified 2-hydroxyisocaproyl-CoA dehydratase (HadBC) The gel was (8%) stained with Coomassie brilliant blue.

M, molecular mass marker; lanes 1–3, purified protein.

cluster(s) (Fig 7) Chemical analysis revealed

5.7 ± 0.1 nonheme iron and 6.1 ± 0.5 acid-labile

sul-fur Metal contents were also estimated by inductively

coupled plasma atomic emission spectroscopy

(ICP-AES, model Optima 3000, PerkinElmer,

Rodgau-Ju¨ge-sheim, Germany) Two preparations of the dehydratase

were analyzed The iron content was estimated as 3.8

and 4.1 mol⁄ mol homodimer; cobalt, nickel and

molybdenum were absent (< 0.01), but surprisingly

stoichiometric amounts of zinc were found in the

pre-parations, 1.1 and 1.9 molÆmol)1, respectively The

supernatant of the enzyme after treatment with anoxic

0.2 m trichloroacetic acid showed a characteristic

UV-visible spectrum of oxidized flavin (peaks at 370 nm

and 450 nm), but no significant flavin content (< 5%

of the dehydratase) was detected by HPLC comparing

with FMN, FAD and riboflavin standards After

oxi-dation with air the UV-visible spectrum of the

super-natant showed a new peak at 300 nm and a shoulder

around 325 nm, which could not be assigned to any

known cofactor Probably this absorption was due to

oxidized iron sulfide

Using the same method as applied for the

purifica-tion of the 2-hydroxyisocaproyl-CoA dehydratase from

cell-free extracts of C difficile, the recombinant

enzyme with a nonfunctional Strep-tag at the

C-termi-nus of the C-subunit could be also obtained in pure

form from E coli The properties of the recombinant

dehydratase (Vmax and Km, see below) were identical

to those of the enzyme from C difficile ICP-AES

analysis revealed 5.3 iron, 3.2 zinc, 0.2 nickel and

0.08 cobalt mol⁄ mol enzyme, but no molybdenum

(< 0.01)

(R)-2-Hydroxyisocaproyl-CoA dehydratase activity 2-Hydroxyisocaproyl-CoA dehydratase activity was measured in the presence of ATP, MgCl2, dithionite, dithiothreitol, serum albumin and activator Addition

of (R)-2-hydroxyisocaproyl-CoA started this assay and the formation of isocaprenoyl-CoA was followed at

290 nm (De ¼ 2.2 mm)1Æcm)1) Due to the high absorbance of the adenine moiety of CoA, the absorb-ance maximum at 263 nm was not used The product isocaprenoyl-CoA was identified by MALDI-TOF mass spectrometry (Mr¼ 865) and by comparison with the chemically synthesized compound The enzyme accepted only (R)-2-hydroxyisocaproyl-CoA with the S-isomer showing less than 10% activity, which might be due to a contamination of the R-iso-mer As an equal mixture of (R)- and (S)-2-hydroxy-isocaproyl-CoA gave only one-half of the enzymatic activity, we assume that that the S-isomer was also able to bind at the active site of the enzyme but could not be dehydrated The apparent Km value for (R)-2-hydroxyisocaproyl-CoA was 50–80 lm and Vmax was determined as 110–150 UÆmg)1(160–220 s)1) using different dehydratase preparations In assays using (E)-isocaprenoyl-CoA as substrate, no activity could

be observed suggesting that the dehydration is irrevers-ible under these conditions or the Z-isomer is the cor-rect product (E)-Isocaprenoyl-CoA (400 lm) was shown to decompose slowly (5 nmolÆmin)1) under the assay conditions regardless whether the dehydratase was present (compare Fig 9, in which an absorbance maximum is observed after addition 3) The product could not be identified by MALDI-TOF spectrometry Recombinant HadI activated the dehydratase in the presence of ATP, MgCl2 and a one-electron reducing agent titanium(III) citrate or dithionite, but the initial experiments revealed a dependence of the activity on the applied amount of activator (Fig 8) Hence, it appeared that each dehydratase molecule required one activator molecule and ATP is hydrolyzed during every turnover A true activator, however, should act catalyt-ically; it should be able to serve many dehydratase molecules, each of which catalyses many turnovers without further hydrolysis of ATP Subsequent experi-ments indicated that the low dehydratase⁄ activator ratio £ 1 required to get high activity was due to the instability of the activator in the assay mixture The activator HadI could be stabilized with 5 mm dithio-threitol and 1 lm bovine serum albumin, probably by removing trace amounts of oxygen and preventing dis-sociation into subunits Under these conditions a dehy-dratase⁄ activator ratio of 10 gave an even higher dehydratase activity than a ratio of 0.2 in the absence

Fig 7 UV-visible spectra of 2-hydroxyisocaproyl-CoA dehydratase.

Solid line, as isolated (1.2 mgÆmL)1); activated dehydratase

separ-ated from activator (1.2 mgÆmL)1) The insert shows the difference

spectrum of activated dehydratase (dashed line) minus isolated

de-hydratase The peak at 320 nm stems from dithionite.

of the stabilisators (Fig 8) The experiments indicate,

however, that at a dehydratase⁄ activator ratio of 10 a

preincubation time of at least 40 min is required to

reach full activity Immediate activation was only

obtained by using dehydratase⁄ activator ratios £ 0.1

(Fig 8)

In a critical experiment, 4.4 mg dehydratase was

activated for 30 min in the presence of 1.0 mg

activa-tor (dehydratase⁄ activator ¼ 3), 0.4 mm ATP, 10 mm

MgCl2, 5 mm dithiothreitol and 0.1 mm dithionite in

50 mm Mops pH 7.0 (total volume 2 mL)

Dehydra-tase activity was assayed by diluting a 1.0 lL sample

into 0.5 mL 0.4 mm (R)-2-hydroxyisocaproyl-CoA in

50 mm Tris⁄ HCl pH 8.0 (139 s)1) The active

dehy-dratase was separated from its activator through a

Strep-Tactin column The tagged activator bound to

the column, while the active dehydratase passed

through A 2.0 lL sample of the flow-through was

assayed in the same manner as above (69 s)1); after

two successive substrate additions the activity was

almost completely lost (Fig 9) SDS⁄ PAGE revealed

the double band of the dehydratase around 43 kDa

but no band at 30 kDa indicating that > 95% of

activator was removed Activation by 0.4 mm ATP,

0.1 mm dithionite and a > 10-fold molar excess of

activator immediately restored the complete activity

(68 s)1) Hence the activated dehydratase irreversibly

lost 50% of its activity during passage through the

Strep-Tactin column; the remaining 13.5 pmol active

enzyme dehydrated 103 nmol

(R)-2-hydroxyisocap-royl-CoA (7600 turnovers) until activity ceased

After-wards by addition of activator and ATP the enzyme

regained the same activity, which was measured after

the passage through the affinity column This experi-ment showed that the activated dehydratase retained its activity (a) in the absence of 0.4 mm ATP, which was diluted in the assay prior to the affinity chroma-tography to 0.8 lm; (b) after affinity chromachroma-tography

at < 0.8 lm ATP and in the absence of at least 95% of the activator (dehydratase⁄ activator > 60 and absence of stabilisators); (c) turnover causes rapid inactivation; and (d) activator and ATP recovered the activity, which was lost during turnover The UV-vis-ible spectra between 300 and 700 nm of the dehydra-tase as isolated and after activation and affinity chromatography revealed the absorbance of a [4Fe)4S]2+ cluster around 400 nm (Fig 7) In the difference spectrum (insert of Fig 7) the peak at

320 nm stems from dithionite, whereas the increase in absorbance around 400 nm may be caused by the irreversible inactivation of 50% of the dehydratase during affinity chromatography In another experiment,

in which the Strep-Tactin column was not treated with dithionite prior to the affinity chromatography (see below), the yield of active dehydratase was only 10%, but the absorbance increase around 400 nm was higher In contrast to that expected for a reduction of a [4Fe)4S]2+ cluster, no decrease in absorbance was observed

Fig 8 Activation of the dehydratase by its activator Dehydratase

activities were measured in 50 m M Tris ⁄ HCl pH 8.0, 5 m M MgCl2,

0.1 m M dithionite, and 0.4 m M ATP, and the reactions were started

by adding 200 l M (R)-2-hydroxyisocproyl-CoA at the indicated

pre-incubation times The molar ratios of dehydratase ⁄ activator were:

0.2, n; 1.0, h; 10, s; 10 in the presence of 5 m M dithiothreitol and

1 l M bovine serum albumin, d.

Fig 9 The activity assay of activated dehydratase separated from the activator by passage through a Strep-Tactin column The assay (total volume 500 lL) contained 27 pmol active dehydratase in

50 m M Tris ⁄ HCl pH 8.0 in absence of ATP, MgCl 2 , dithionite and di-thiothreitol The reaction was started by adding 0.2 lmol of the substrate (R)-2-hydroxyisocaproyl-CoA (arrow 1) After the substrate was consumed (DA 290nm ¼ 0.455), further 2 · 0.2 lmol substrate was added at arrows 1 and 2 The activity was recovered by addi-tion of an excess amount of activator (> 10-fold), 0.4 m M ATP,

5 m M MgCl 2 , 5 m M dithiothreitol and 0.1 m M dithionite (arrow 3) The decrease in absorbance after 20 min was due to the instability

of the product isocaprenoyl-CoA.

It was suggested that 2-hydroxyisocaproyl-CoA

dehydratase could be the most sensitive target of

met-ronidazole [14], which has been used as an antibiotic

for C difficile infections in the human body [20]

Met-ronidazole inhibited effectively cell growth (50%

inhi-bition at 10 lm) and the dehydratase activity was

completely abolished at 20 lm, probably by oxidation

of the activated enzyme by the nitro group of the

inac-tivator [21]

Discussion

The experiments described in this work clearly show

that the hadIBC-genes of C difficile encode a novel

2-hydroxyacyl-CoA dehydratase (HadBC) and its

acti-vator (HadI), probably specific for the dehydration of

(R)-2-hydroxyisocaproyl-CoA to isocaprenoyl-CoA,

but besides the S-isomer no other substrate was tested

As the known enzymatic eliminations of water

from (R)-2-hydroxyacyl-CoA to (E)-2-enoyl-CoA

(R)-2-hydroxyglutaryl-CoA to (E)-glutaconyl-CoA [22]

(R)-lactyl-CoA to acryloyl-CoA [23] and

(R)-phenyllac-tyl-CoA to (E)-cinnamoyl-CoA [24] all occur in a

syn-fashion, we assume that this will also be the case for

(R)-2-hydroxyisocaproyl-CoA to

(E)-2-isocaprenoyl-CoA, which, however, remains to be determined The

inability to measure the hydration of the chemically

synthesized (E)-2-isocaprenoyl-CoA could be either

due to the unfavourable equilibrium or due to the

Z-isomer being the correct substrate It has been

shown that 2-hydroxyglutaryl-CoA dehydratase indeed

catalyzed the reverse reaction The conditions,

how-ever, were different; this experiment was performed in

the cell-free extract using (E)-glutaconate in the

pres-ence of acetyl-CoA as substrate and the formed

(R)-2-hydroxyglutarate was determined enzymatically [22]

The 2-hydroxyisocaproyl-CoA dehydratase fits well

into the proposed pathway of leucine fermentation by

C difficile In addition we showed that ldhA encodes a

fairly specific NAD-dependent

(R)-2-hydroxyisocapro-ate dehydrogenase (GenBank accession number

AY772817) and hadA a highly specific class III [25]

2-hydroxyisocaproate CoA-transferase using

(R)-2-hy-droxyisocaproyl-CoA and (E)-isocaprenoate, probably

as well as isocaproate as substrates (GenBank

acces-sion number AY772818) [26] The genes acdB, etfB

and etfA, downstream of hadBC, are related to those

of an acyl-CoA dehydrogenease and an

electron-trans-ferring flavoprotein, which most likely are involved in

the reduction of isocaprenoyl-CoA to isocaproyl-CoA

Finally the CoA-transferase HadA may liberate the

product isocaproate (Figs 1 and 2) An ambiguous step

is the conversion of leucine to 2-oxoisocaproate, which

may proceed via amino transfer to 2-oxoglutarate fol-lowed by dehydrogenation of the formed glutamate (Fig 2) or by a direct one-step oxidative deamination

of leucine Although the arrangement of the hadAIBC genes are very similar to those involved in the dehy-dration of (R)-phenyllactate to (E)-cinnamate [13], a stable complex of the 2-hydroxyisocaproyl-CoA dehy-dratase (HadBC) with the CoA-transferase (HadA) could not be detected, as both enzymes separate during purification

The requirement of activator (HadI), dehydratase (HadBC), ATP, Mg2+, dithiothreitol and dithionite for the activity of 2-hydroxyisocaproyl-CoA dehydra-tase indicates that this enzyme acts by the same mech-anism as that proposed for 2-hydroxyglutaryl-CoA dehydratase [27] (Fig 10) The reduced activator trans-fers one electron to the dehydratase concomitant with hydrolysis of ATP Although the stoichiometry of 1 or

2 ATP⁄ electron remains to be determined, the homo-dimeric structure of the activator with one [4Fe)4S] cluster and two ATP binding sites strongly suggests 2 ATP⁄ electron as observed with nitrogenase [28] The reduced dehydratase transfers the electron further to the substrate to generate the ketyl radical anion I, which expels the adjacent hydroxyl group The formed enoxy radical can now be deprotonated at the b-posi-tion to the product-related ketyl radical anion II, which is oxidized to isocaprenoyl-CoA by the next incoming substrate 2-hydroxyisocaproyl-CoA, whereby the electron is recycled It has been calculated that the extremely high pK of the b-protons of 2-hydroxyiso-caproyl-CoA ( 40), is lowered by 26 units to pK ¼

14 in the enoxy radical [29] This fairly low pK could

be even further decreased to about 7 by hydrogen

Fig 10 Proposed mechanism of dehydration from (R)-2-hydroxyiso-caproyl-CoA to (E)-2-isocaprenoyl-CoA For protein abbreviations, see Fig 2.

bonds from backbone amides of the enzyme to the

carbonyl oxygen and thus gets into the range of

the pK of carboxylates or imidazolyl residues of the

enzyme [30]

One major support for this mechanism comes from

experiments described in this work For the first time

it has been shown that catalytic amounts of activator

(HadBC⁄ HadI ¼ 10 mol ⁄ mol) are sufficient to get

maximum dehydratase activity This important finding

was due to the development of a direct

spectrophoto-metric assay of the dehydratase and to the improved

stability of HadI through the addition of serum

albu-min and dithiothreitol In previous work an assay with

six auxiliary enzymes was used and hence gave only

qualitative data [8,31] Furthermore, the activated

dehydratase could be separated from the activator and

retained its activity for almost 104 turnovers This

experiment clearly demonstrated that ATP and Mg2+

are only required for activation and ATP is not used

to phosphorylate the hydroxyl group in order to

facili-tate the elimination as suggested in the early work on

lactyl-CoA dehydratase The authors Anderson and

Wood [32] have already addressed the energetic enigma

if each dehydration would require one ATP, this

means in the case of C difficile that generation of one

ATP by substrate-level phosphorylation consumes two

ATP (Fig 2 and Eqn 1) Therefore it was proposed

that one ATP must be sufficient to activate the

dehy-dratase for at least 100 turnovers [1], which has now

been experimentally verified The activated enzyme

may become inactivated simply by one-electron

oxida-tion with traces of oxygen or by a second electron

transfer to a radical intermediate, which would result

in isocaproyl-CoA rather than isocaprenoyl-CoA as

product, but according to the measured turnover only

one in 104 The inactivation by substrate is reminiscent

of coenzyme B12-dependent mutases The suicide

inac-tivation of b-lysine 5,6-aminomutase is caused by

the substrate-induced one electron transfer from

cob(II)alamin to the 5¢-deoxadenosyl radical resulting

in the inactive pair of cob(III)alamin and

5¢-deoxyadenosine [33]

In our publications on 2-hydroxyglutaryl-CoA

dehy-dratase [1,3,4], the terms component A and component

D were used, A for activator and D for dehydratase,

implicating that only both components together are

able to form an active enzyme The important result

that even in the absence of activator the activated

2-hydroxyisocaproyl-CoA dehydratase is catalytically

active has consequences for the nomenclature From

this paper onward we will call component A just

activator or archerase [1] and component D just

dehydratase

Previous work on 2-hydroxyglutaryl-CoA dehydra-tase showed that the activator alone had ATPase activ-ity (4–6 s)1) but only in the oxidized state [3] The results in this work, which revealed low ATPase activ-ities of the activator HadI regardless of its oxidation state, question those data Therefore the original data obtained with the activator of 2-hydroxyglutaryl-CoA dehydratase have been re-calculated and found too high by a factor of 10 Furthermore, repetition of the ATPase measurements with the activator from A fer-mentans by applying the conditions used in this work also gave only low activities (M Hetzel & W Buckel, unpublished results) Addition of dehydratase to the corresponding reduced activator, however, gave high ATPase activities; in case of HadI + HadBC up to

50 UÆmg)1 activator was achieved These results fit much better to the proposed mechanism, as the elec-tron should only be transferred in a complex of both proteins driven by ATP hydrolysis

Another important result of this work is the finding that 2-hydroxyisocaproyl-CoA dehydratase, the 2-hyd-roxyacyl-CoA dehydratase with highest ever-observed activity (up to 220 s)1), contains no molybdenum and hardly any flavin Therefore these two cofactors seem not to play important roles also in the other 2-hydroxy-acyl-CoA dehydratases Molybdenum may be an impurity that could not be separated from 2-hydroxy-glutaryl-CoA dehydratase and flavin (FMN and⁄ or riboflavin) could bind fortuitously Interestingly, crude preparations of 2-hydroxyisocaproyl-CoA dehydratase obtained from C difficile do contain molybdenum, which is removed during further purification without decreasing the activity The only prosthetic group of the dehydratase, which after activation could carry the catalytic electron, is a putative [4Fe)4S] cluster, whose structure remains to be determined by spectroscopic and crystallographic methods The failure to see the reduction of the cluster in the active dehydratase by a decrease in absorbance at 400 nm may be due to the concomitant increase in absorbance of half of the dehydratase irreversibly inactivated during separation from its activator This cluster must have a very negat-ive redox potential (E0¢ ¼ <) 600 mV), as no activity could be observed after treatment of the inactive dehy-dratase with excess dithionite or titanium(III) citrate in the absence of the activator HadI and ATP On the other hand this cluster cannot be very unusual, as it is synthesized by enzymes not only present in C difficile but also in E coli [34] as shown by the functional heterologous expression of the hadBC genes The role

of zinc, if any, remains to be established Hence, 2-hydroxyisocaproyl-CoA dehydratase and its activator appear as simple iron–sulfur proteins without any

special cofactors or rare elements Owing to this

sim-plicity, one may conclude that 2-hydroxyacyl-CoA

de-hydratases have evolved very early during the

emergence of life [35], probably with an unknown

ana-bolic rather than a cataana-bolic function

Experimental procedures

Materials

C difficile (DSMZ 1296T) was purchased from the

Deut-sche Sammlung fu¨r Mikroorganismen und Zellkulturen

(DMSZ, Braunschweig, Germany) and E coli,

BL21-Co-donPlus(DE3)-RIL strain for gene expression was obtained

from Stratagene (Heidelberg, Germany) The affinity

col-umn, Strep-Tactin MacroPrep was purchased from IBA

GmbH (Go¨ttingen, Germany) The enzymes for molecular

biology were obtained from New England Biolabs

(Frank-furt am Main, Germany), ABgene (Hamburg, Germany)

and Amersham Biosciences (Freiburg, Germany) Primers

were purchased from MWG (Ebersberg, Germany) Protein

molecular mass markers and DNA size markers were

obtained from Amersham Biosciences

Experiments under anoxic conditions

Purification of the activator and 2-hydroxyisocaproyl-CoA

dehydratase were performed at 15–20
C in an ‘Anaerobic

Chamber’ (Coy Laboratories, Ann Arbor, MI, USA) under

a nitrogen atmosphere containing 5% H2 Oxygen was

removed from buffers for enzyme purification by boiling

and cooling under vacuum Afterwards the buffers were

flushed with nitrogen, transferred to the anaerobic chamber,

and stirred overnight In the chamber, 2 mm dithiothreitol

was added to each buffer Enzyme activity was determined

inside the anaerobic chamber with an Ultrospec 4000

spec-trophotometer from Amersham Biosciences

Chemicals and synthesis of CoA-esters

(R)-2-Hydroxyisocaproate and (S)-2-hydroxyisocaproate

were obtained from d- and l-leucine, respectively, by

treat-ment of the corresponding amino acids with sodium nitrite

in dilute sulfuric acid [36] (E)-2-Isocaprenoate

(4-methyl-trans-2-pentenoic acid) was synthesized from

isobutyralde-hyde and malonic acid in pyridine-piperidine [37] (R)- and

(S)-2-Hydroxyisocaproyl-CoA and (E)-2-isocaprenoyl-CoA

were prepared from the corresponding acids following the

modified anhydrous 1,1¢-carbonyldiimidazole synthesis [38]

Gene cloning

Routine manipulation of plasmid DNA, PCR, the

construc-tion of recombinant plasmids and isolaconstruc-tion of chromosomal

DNA from C difficile were performed using standard techniques [39] The ORF hadI was amplified with follow-ing primers: FhadI, 5¢-ATGGTAGGTCTCAAATGTACA CAATGGGATTAGATATAGGTTC-3¢; RhadI, 5¢-ATGG TAGGTCTCAGCGCTTATATTTTTCACTTCTTTTTGT GATTCT-3¢

PCR was performed using proof reading polymerase, Extensor Hi-Fidelity PCR Enzyme Mix (ABgene, Ham-burg, Germany) and the amplified fragment was cloned into the BsaI restriction site [GGTCTC(N)1] of the expression vector pASK-IBA3 providing a C-terminal Strep-tag II pep-tide (Trp-Ser-His-Pro-Gln-Phe-Glu-Lys) fused protein The plasmid construct, pASK-IBA3::hadI, was named Np3I The ORF hadBC was amplified with following primers: FhadBC, 5¢-ATGGTAGGTCTCAAATGTCTGAAAAAAAAGAAG CTAGAGTAGT-3¢; RhadBC, 5¢-ATGGTAGGTCTCAG CGCTCGCTAAACTCATCATCTCAGCAAA-3¢ The amplified fragment using proofreading polymerase was cloned into the BsaI restriction site of pASK-IBA3 giv-ing Np3 bc In order to exclude readgiv-ing errors of the polymerase, three different clones from three different PCR products were sequenced The sequencing primers labelled

at their 5¢ end with the infrared dye IRD-41 were obtained from MWG-Biotech (Ebersberg, Germany)

Gene expression and purification of the activator

Plasmid constructs, Np3I or Np3 BC, were transformed into E coli BL21-CodonPlus(DE3)-RIL harbouring addi-tional rare codon tRNA genes (arg, ileY and leuW), in order to express the relevant genes An overnight preculture (100 mL) of a fresh single colony was used to inoculate 2 L Standard I medium (Merck, Darmstadt, Germany) contain-ing antibiotics (ampicillin, 100 lgÆmL)1, and chlorampheni-col, 50 lgÆmL)1) at 30
C (or room temperature for Np3 BC) under anoxic conditions When the culture reached the mid-exponential phase, A590¼ 0.5–0.7, gene expression was induced with anhydrotetracycline (200 lgÆL)1) After another 3 h growth, the culture was transferred to the anaerobic chamber Cells were harvested

by centrifugation in airtight bottles, washed and suspended

in 50 mm Mops pH 7.0, 300 mm NaCl, 10 mm MgCl2, and

5 mm dithiothreitol Cells in serum bottles tightly closed with rubber stoppers were transferred through a needle into the French Press operating at 140 MPa After the cell

deb-ris had been removed by ultracentrifugation at 100 000 g

for 1 h, the supernatant was loaded on a 5 mL Strep-Tactin MacroPrep column, which was equilibrated with the buffer used for suspending the cells After loading, the column was washed with at least 10 column volumes of equilibra-tion buffer and the enzyme was eluted with equilibraequilibra-tion buffer containing 3 mm d-desthiobiotin and 1 mm ADP Afterwards d-desthiobiotin was removed by gel filtration on Sephadex G-25 equilibrated with 50 mm Mops pH 7.0,

1 mm ADP, 10 mm MgCl2and 5 mm dithiothreitol

Purification of 2-hydroxyisocaproyl-CoA

dehydratase from C difficile

C difficile cells were cultivated as described before [40] in

2 L tightly closed bottles containing anoxic defined medium

[41] supplemented with l-leucine (1 gÆL)1; 7.6 mm) Cells

were harvested, washed and suspended in buffer A

contain-ing 50 mm Mops pH 7.0 and 2 mm dithiothreitol, yield 3 g

wet cell paste The preparation of the cell free extract was

performed as that described in the activator purification

The cell free extract was filtered (0.45 lm pore size) and

loaded a DEAE-Sepharose fast-flow column (3· 10 cm)

equilibrated with buffer A The column was washed with

70 mL buffer A and the proteins were eluted at a rate of

3 mLÆmin)1 with a linear gradient of 0–1.0 m NaCl in

buf-fer A The active brown fractions were eluted around 0.4 m

NaCl An equal volume of 2.0 m (NH4)2SO4 in buffer A

was added to the pooled fractions from the first column,

which were then loaded on a phenyl-Sepharose column

(3· 10 cm) equilibrated with buffer B, 50 mm Mops

pH 7.0, 1.0 m (NH4)2SO4, 2 mm dithiothreitol After

wash-ing the column with 70 mL buffer B, the active brown

dehydratase eluted around 0.1 m (NH4)2SO4 with a linear

gradient of 1.0–0 m (NH4)2SO4 in buffer B at a rate of

3 mLÆmin)1 The dehydratase fractions were concentrated

on an Amicon PM 30 cell and desalted against buffer A,

then loaded on a Q-Sepharose column (1.8· 10 cm)

equili-brated with buffer A After a washing step with 60 mL

buf-fer A, the dehydratase was eluted around 0.5 m NaCl with

a linear gradient of 0–1.0 m NaCl in buffer A at a rate of

3 mLÆmin)1 The dehydratase was finally concentrated with

an Amicon Ultra-4 PLTK Ultracel-Pl (30 kDa cut-off)

The recombinant 2-hydroxyisocaproyl-CoA dehydratase

from E coli was purified by the same method, as the

enzyme was not absorbed at the Strep-Tactin MacroPrep

column After the phenyl-Sepharose column the enzyme

was already pure and therefore the Q-Sepharose column

could be omitted

Determination of enzyme activity

2-Hydroxyisocaproyl-CoA dehydratase activity was

meas-ured using a continuous direct assay based on the difference

between the extinction coefficients of

2-hydroxyisocaproyl-CoA and 2-isocaprenoyl-2-hydroxyisocaproyl-CoA at 290 nm (De ¼ 2.2 mm)1Æ

cm)1) The dehydratase was incubated for 5 min with an

equal molar amount of recombinant activator in the

presence of 50 mm Tris⁄ HCl pH 8.0, 5 mm MgCl2, 0.4 mm

ATP, 0.1 mm dithionite or titanium(III) citrate, 5 mm

dithiothreitol and 1 lm bovine serum albumin in a total

volume of 0.5 mL The assay was started by the addition of

200 lm (R)-2-hydroxyisocaproyl-CoA and the absorbance

increase was followed at 290 nm The ATPase activity of

the activator was measured using a coupled assay with

pyruvate kinase and lactate dehydrogenase [42] The

cuvette, total volume 0.5 mL, contained 50 mm Tris⁄ HCl

pH 8.0, 1 mm phosphoenolpyruvate, 10 mm MgCl2, 1 mm ATP, 0.2 mm NADH, 2 U pyruvate kinase and 2 U lactate dehydrogenase After adding the activator, the absorbance

6.3 mm)1Æcm)1[43])

Analysis of CoA-thiol esters by MALDI-TOF mass spectrometry

The molecular mass of a CoA ester produced in an enzymatic

or chemical reaction was confirmed by MALDI-TOF mass spectrometry The reaction was acidified with 1 m HCl to

pH < 4.0 and loaded on Sep-pak C18cartridge (Waters, Eschborn, Germany), which was equilibrated with 0.1% tri-fluoroacetic acid The column was washed with five column-volumes of 0.1% trifluoroacetic acid and the CoA-thiol ester was eluted with 5 mL 1% trifluoroacetic acid in 50% aceto-nitrile After evaporation of the acetonitrile under vacuum, a drop of the CoA-thiol ester solution was applied on a thin layer of indole-2-carboxylic acid on a golden plate prepared from a solution of 300 mm indole-2-carboxylic acid in acet-one and measured under the described conditions [44]

Separation of activated dehydratase from its activator

Dehydratase (4.4 mg) was activated by 1.0 mg activator in the presence of 50 mm Mops pH 7.0, 0.4 mm ATP, 5 mm MgCl2, 5 mm dithiothreitol, and 0.1 mm dithionite (total volume 2.0 mL) as described in activity assay but in the absence of bovine serum albumin After 30-min incubation

at room temperature, 1.0 lL was assayed for activity with-out further activation and the reaction mixture was loaded

on a 5 mL Strep-Tactin MacroPrep column, previously reduced with 50 mm Mops pH 7.0, 5 mm dithiothreitol and 0.1 mm dithionite and equilibrated with 50 mm Mops

pH 7.0, 300 mm NaCl, 10 mm MgCl2and 5 mm dithiothre-itol The tagged activator was bound to the column while the dehydratase-containing flow through was collected in

1 mL fractions An UV-visible spectrum was taken from the peak fraction (1.2 mg dehydrataseÆmL)1), which was also analyzed for activity Therefore a 2 lL aliquot was added to 50 mm Tris⁄ HCl pH 8.0 and the reaction was started with 0.2 lmol (R)-2-hydroxyisocaproyl-CoA, total volume 0.5 mL, d¼ 1 cm After the reaction had ceased, two additional 0.2 lmol (R)-2-hydroxyisocaproyl-CoA aliquots were added Finally the enzyme was reactivated by 0.1 mm dithionite, 0.4 mm ATP, 5 mm MgCl2 and 5 mm dithiothreitol and 30 lg activator (added last) On an SDS⁄ polyacrylamide gel, to which 20 lL of the separated dehydratase were applied, the double band of the dehydra-tase (40 kDa) but no trace of the activator (30 kDa) was visible