Báo cáo khoa học: Inhibition of recombinant human maltase glucoamylase by salacinol and derivatives pdf

This paper reports the produc-tion and purificaproduc-tion of active human recombinant MGA amino terminal catalytic domain MGAnt from two different eukaryotic cell culture sys-tems.. Inhi

by salacinol and derivatives

Elena J Rossi1,2,*, Lyann Sim1,2,*, Douglas A Kuntz2, Dagmar Hahn3, Blair D Johnston4,

Ahmad Ghavami4, Monica G Szczepina4, Nag S Kumar4, Erwin E Sterchi3, Buford L Nichols5,

B M Pinto4and David R Rose1,2

1 Department of Medical Biophysics, University of Toronto, Canada

2 Division of Cancer Genomics and Proteomics, Ontario Cancer Institute, Canada

3 Institute of Biochemistry and Molecular Medicine, University of Berne, Switzerland

4 Department of Chemistry, Simon Fraser University, Burnaby, Canada

5 US Department of Agriculture, Agricultural Research Service, Baylor College of Medicine, Houston, TX, USA

In the treatment of Type II (noninsulin-dependent)

diabetes, management of blood glucose levels is

crit-ical One strategy is to delay digestion of ingested

carbohydrates, thereby lowering postprandial blood

glucose concentration [1] This can be achieved by

inhibiting the activity of pancreatic a-amylase, which

mediates the hydrolysis of complex starches to

oligo-saccharides, and⁄ or membrane-bound intestinal a-glucosidases, which hydrolyze these oligosaccharides

to glucose in the small intestine [1] Carbohydrate ana-logues, such as acarbose (1) and miglitol (2) (Fig 1) reversibly inhibit the function of these two groups of enzymes [2] resulting in delayed glucose absorp-tion into the blood and a smoothing or lowering of

Keywords

enzyme inhibition; family GH31;

glucosidase; glycosyl hydrolase; salacinol

Correspondence

D R Rose, Ontario Cancer Institute, 101

College Street, Toronto, ON, M5G 1L7

Canada

Fax: +416 581 7562

Tel: +416 581 7537

Email: drose@oci.utoronto.ca

http://www.uhnresearch.ca/

*These authors contributed equally to this

work

(Received 5 January 2006, revised 11 April

2006, accepted 13 April 2006)

doi:10.1111/j.1742-4658.2006.05283.x

Inhibitors targeting pancreatic a-amylase and intestinal a-glucosidases delay glucose production following digestion and are currently used in the treatment of Type II diabetes Maltase-glucoamylase (MGA), a family 31 glycoside hydrolase, is an a-glucosidase anchored in the membrane of small intestinal epithelial cells responsible for the final step of mammalian starch digestion leading to the release of glucose This paper reports the produc-tion and purificaproduc-tion of active human recombinant MGA amino terminal catalytic domain (MGAnt) from two different eukaryotic cell culture sys-tems MGAnt overexpressed in Drosophila cells was of quality and quantity suitable for kinetic and inhibition studies as well as future structural stud-ies Inhibition of MGAnt was tested with a group of prospective a-glucosi-dase inhibitors modeled after salacinol, a naturally occurring a-glucosia-glucosi-dase inhibitor, and acarbose, a currently prescribed antidiabetic agent Four synthetic inhibitors that bind and inhibit MGAnt activity better than acar-bose, and at comparable levels to salacinol, were found The inhibitors are derivatives of salacinol that contain either a selenium atom in place of sulfur in the five-membered ring, or a longer polyhydroxylated, sulfated chain than salacinol Six-membered ring derivatives of salacinol and compounds modeled after miglitol were much less effective as MGAnt inhibitors These results provide information on the inhibitory profile

of MGAnt that will guide the development of new compounds having antidiabetic activity

Abbreviations

HPA, human pancreatic a-amylase; MGA, maltase glucoamylase; MGAnt, maltase glucoamylase N-terminal catalytic domain; pNP, para-nitrophenyl; SIM, sucrase isomaltase.

postprandial hyperglycemia [3,4] (Fig 1) Because

these inhibitors decrease both hyperglycemia and

hyperinsulinemia, they reduce insulin resistance and

stress on the beta-cells of the pancreas, thus preventing

further insulin-dependent disorders [5–7]

Starch, one of the main digestible carbohydrates in

the human diet, is composed of approximately 25%

amylose and 75% amylopectin [9] Mammalian starch

digestion occurs in the lumen of the small intestine

where the endoglycosidase a-amylase (EC 3.2.1.1)

hydrolyzes the internal a-(1–4) linkages of starch while

bypassing the a-(1–6) linkages of the amylopectin com-ponent This hydrolysis yields both linear maltose oligosaccharides and branched isomaltose oligosaccha-rides, neither of which can be absorbed into the blood-stream without further processing [8] These linear and branched oligosaccharides are hydrolyzed at the non-reducing end by maltase glucoamylase (MGA; E.C 3.2.1.20 and 3.2.1.3) maltase glucoamylase and sucrase isomaltase (SIM; EC 3.2.1.48 and 3.2.1.10), respect-ively, to yield glucose [9] MGA and SIM have over-lapping and complementary substrate specificities in

Fig 1 Inhibitors discussed in this paper: acarbose (1), miglitol (2), salacinol (3) and kotalanol (4); (5–7) are derivatives of salacinol with substi-tutions in the ring (8–9) are ring expanded salacinol derivatives (10) and (11) are miglitol derivatives (12–15) are derivatives of salacinol with variations in the length and stereochemistry of the aliphatic chain Figures in brackets indicate the degree of inhibition of MGAnt dependent maltose hydrolysis in the presence of 200 l M of inhibitor, when measured with 1 m M maltose as substrate Glucose release was monitored using the glucose oxidase assay as described in Experimental procedures Values are ± 10% These conditions (
1 ⁄ 4 K m ) permitted a meas-urable effect from weak competitive inhibitors.

starch digestion SIM accounts for almost all sucrase

activity, all isomaltase activity, and 80% of the maltase

activity, while MGA accounts for all glucoamylase

activity, 20% of the maltase activity, and 1% of the

sucrase activity [10] Together, these two enzymes form

a complex in the epithelial cells of the small intestine

and complete the hydrolysis of oligosaccharide chains

in starch digestion

Human MGA encoded by the gene MGAM [8,11] is

an a-glucosidase responsible for hydrolysis of

a-1,4-linkages from the nonreducing end of maltose

oligo-saccharides [9] and belongs to glycoside hydrolase

family 31 It is type II membrane protein 1857 amino

acids in length anchored in the brush border epithelial

cells of the small intestine MGA contains five distinct

protein domains: a small cytosolic domain (26 amino

acids) a transmembrane domain (
20 amino acids), an

O-glycosylated linker (or stalk) (
55 amino acids), and

two homologous (family GH31) catalytic domains

(each
900 amino acids) [9] The domain organization

is illustrated schematically in Fig 2 Each MGA

cata-lytic domain contains a putative catacata-lytic site made up

of the amino acid sequence

tryptophan-X-aspartate-methionine-asparagine-glutamate (WXDMNE), where

X indicates a variable amino acid This catalytic site is

conserved in other human a-glucosidases and family

31 enzymes including SIM [12] Human SIM is the

clo-sest known homologue of hMGA, sharing 59% amino

acid sequence identity, and is responsible for the

hydro-lysis of branched a-1,6-linked oligosaccharides [8]

Due to its role in starch digestion, MGA has

become an important inhibition target in the treatment

of Type II diabetes Although 1 and 2 (Fig 1) are

currently being used to treat Type II diabetes, they

are accompanied by undesirable side-effects, including

gastrointestinal and abdominal discomfort [2] For this

reason, there is a drive to identify alternative a-glucosi-dase inhibitors with greater potency and fewer side-effects

The naturally occurring glucosidase inhibitors salacinol (3) and kotalanol (4) (Fig 1) have been iso-lated from Salacia reticulata, a plant native to Sri Lanka and India that has been used in the Ayurvedic system of medicine for the treatment of diabetes [13,14] Compounds 3 and 4 (Fig 1) may potentially have fewer long-term side-effects than other existing oral antidiabetic agents Recent animal studies have shown that the oral ingestion of an extract from a

S reticulata trunk at a dose of 5000 mgÆkg)1 had no serious acute toxicity or mutagenicity in rats [15]

We have been active in the synthesis and biological evaluation of analogues of 3 (Fig 1), differing in stereochemistry at the stereogenic centers, in ring-heteroatom substitution, and in ring size [16–22]

In vitro testing has revealed different inhibitory activ-ities of these compounds against different glycosidase enzymes [23,24] In addition, 3, and the selenium ana-logue, blintol 5 (Fig 1), have been shown to be very effective in controlling blood glucose levels in rats after a carbohydrate meal, thus providing lead candi-dates for the treatment of Type 2 diabetes [23] In order to examine the mechanism of action of this class of inhibitors, 3, 5, the stereoisomers of salacinol

6, 7 [25], and the six-membered ring analogues of salacinol (8, 9) (N S Kumar and B M Pinto, unpublished results) were synthesized along with analogues of miglitol (10, 11) [22] In view of the reported antiglucosidase activity of 4 [14], we also synthesized chain-extended analogues (12–15) (Fig 1) [26], whose acyclic, polyhydroxylated, sulfated chains varied between the four-carbon chain of salacinol and the seven-carbon chain of kotalanol

Fig 2 Schematic diagram of MGA protein

organization and expression construct.

Amino acid boundaries of each of the

domains comprising the full size protein,

and the region inserted into the Drosophila

expression plasmid, are indicated.

It has been difficult previously to carry out extensive

studies on the inhibitor profiles of these compounds

due to the lack of large amounts of active enzyme

Here we report heterologous overexpression of

recom-binant DNA encoding the MGA amino terminal

cata-lytic domain (MGAnt) in Drosophila S2 cells in order

to overcome this difficulty The purified recombinant

MGAnt was then used to perform kinetic analyses of

prospective MGA inhibitors

Results

The N-terminal catalytic domain of MGA is presently

the most extensively studied region of the enzyme and

enzymatic activity of the domain has been reported in

the presence of maltose and amylose substrates, with

little or no activity in the presence of lactose or sucrose

substrates [8] While the function of the C-terminal

domain has yet to be determined, the results of

Nich-ols et al [8] confirmed that the N-terminal domain

contains the substrate specificity of MGA and is

dis-tinct from the specificity of SIM For this reason, the

recombinant proteins used in the studies reported here

were designed to contain only the N-terminal region

and all kinetic and inhibition analysis was performed

using this catalytic domain

Activity of salacinol and acarbose on mammalian

cell expressed C-terminally truncated MGA

Preliminary inhibition studies were performed on

sonicated cell extracts of primate cells expressing

C-terminally truncated MGA [8] In this assay, COS-1

cells transiently transfected with the MGA-P1A2

construct, which encodes the complete amino-terminal

portion of the molecule including the membrane anchor

and 5¢-catalytic domain, were used The inhibition of

maltose (4-O-a-d-glucopyranosyl-d-glucose) hydrolysis

was monitored The activity of the known glycosidase

inhibitor acarbose (Bayer), used for the treatment of

Type II diabetes, was compared to that of salacinol

Whereas salacinol at 5 lm concentration inhibited 60–

70% of the breakdown of maltose, 5 lm acarbose only

inhibited 4% of the activity Thus, it would appear that

acarbose acts mainly by inhibiting human pancreatic

a-amylase (HPA) and the breakdown of starch, and

possibly other intestinal glucosidases but not MGA

The synthetic analogues of salacinol appeared to be

slightly more active than the parent compound in these

crude extracts At 0.2 lm, blintol 5 inhibited 50% of

MGA activity, and the chain extended analogues

(13–15) inhibited 88%, 91%, and 90% of MGA

activ-ity, respectively, when tested at 5 lm

Expression of active recombinant MGAnt

in Drosophila S2 cells Due to limited expression levels in COS-1 cells and dif-ficulties in purification of the resultant membrane anchored protein we decided to express the catalytic domain as a secreted protein in Drosophila melanoga-ster cells (DES system, Invitrogen) We designed a construct that lacked the cytosolic, transmembrane region and most of the O-glycosylated stalk region that occurs at the amino terminus (Fig 2) The N-terminal catalytic domain of MGA, starting at Ser87 and end-ing at amino acid 955, was fused to a C-terminal hexa-histidine tag This domain was placed downstream of

a metallothionein promoter and behind a Bip secretion signal Correctness of the construct was determined by sequencing in each direction An active protein was successfully expressed in Drosophila S2 cells Secreted protein was isolated from the cell media using chelat-ing Sepharose resin and was further purified uschelat-ing anion exchange chromatography The total yield of pure MGA from expression in Drosophila S2 cells was approximately 14 mgÆL)1 The size and purity of the final protein preparation was determined by SDS⁄ PAGE analysis (Fig 3, inset) and by mass spec-trophotometric analysis The expected size of the 876 amino acid expressed domain is 99 274 while a mass

of 105 360 was determined by MALDI-TOF MS The difference in mass is a result of glycosylation (six pre-dicted sites) as treatment with endo-glycosidase F reduced the apparent mass of the enzyme (results not shown)

Fig 3 MGAnt enzyme activity with maltose as a substrate Line-weaver-Burk plot of MGAnt activity used to calculate kinetic param-eters Vmaxand Km Enzyme activity was measured by monitoring release of glucose from maltose using the glucose oxidase assay Inset shows an SDS ⁄ PAGE gel of the purified MGAnt used in the assay The size of the molecular weight markers shown in lane 1 are indicated Lanes 2 and 3 show different loadings of the protein.

Data obtained from the analysis of MGAnt activity

in the presence of increasing maltose concentration

was used in a double reciprocal Lineweaver–Burk plot

(1⁄ velocity versus 1 ⁄ substrate) in order to calculate

the Vmax and KM of the reaction (Fig 3) The Vmax

was determined to be 32.6 ± 1.4 Units⁄ mg enzyme

and the KM4.6 ± 0.5 mm maltose This differs

some-what from the previously published results for purified

murine MGA (34.7 UÆmg)1, 1.24 mm, respectively) [27]

but it must be pointed out that the purified rodent

enzyme was almost twice the size of full size human

MGA and was composed of a number of

disulfide-linked proteolytic fragments [27] The KM is close to

the 3.4 mm measured for human MGA

immunoprecip-itated from pooled clinical homogenates (B Nichols,

unpublished results)

Inhibition analysis

The availability of larger amounts of recombinant

enzyme permitted a more thorough analysis of the

inhibitor activities than was possible with the COS-1

homogenates The effectiveness of a-glucosidase

inhibi-tors on recombinant human MGAnt was tested using

maltose as a substrate in the presence of known

inhibi-tors acarbose and salacinol, and 11 newly synthesized

putative inhibitors (Fig 1) Initially, each inhibitor was

tested at a concentration of 200 lm in order to screen

for the most effective inhibitors The inhibition results

of the initial screening are listed along with each

com-pound in Fig 1 Of the 11 new putative inhibitors

tes-ted, only inhibitors 5, 13, 14 and 15 showed full

enzyme inhibition at 200 lm and were used in further

inhibition analysis As expected, the known

a-glucosi-dase inhibitor salacinol also showed full inhibition at

this concentration Acarbose did not inhibit as well as

salacinol or the four synthetic inhibitors but it was

used in further analysis for the sake of comparison

The inhibition constants (Ki) of acarbose, salacinol

and (5, 13–15; Fig 1), against MGA were determined

using the glucose oxidase assay and maltose as a

sub-strate Data points were obtained, in triplicate, for

four different inhibitor concentrations (including 0 lm)

and up to six different maltose concentrations

Tripli-cate data points pertaining to the various levels of each

inhibitor were averaged and plotted together in

Line-weaver–Burk plots and trendlines were added using

Excel The slopes of the lines corresponding to

inhib-itor concentration approximately intersected at a point

at the y-axis indicating classic competitive inhibition

The experimentally determined inhibition constants for

acarbose, salacinol and its synthetic analogues (5, 13–

15) are listed (Table 1) and the Dixon plot

visualiza-tion given in Fig 4 Salacinol and 15 showed the best inhibition against MGA (Ki¼ 0.2 lm) while acarbose showed the worst inhibition (Ki¼ 62 lm) These val-ues are comparable to the preliminary data described above in COS-1 cells, despite the differences in assays and source of enzyme

Discussion Initial expression of active MGAnt protein in COS-1 cells demonstrated the validity of the cDNA clones, but suffered from low yields and the difficulty in isola-ting large quantities for physico-chemical studies The Drosophila S2 cell expression system proved to be a successful method for the production of MGAnt in substantial quantities The N-terminal catalytic domain was expressed and secreted into the medium, from which it was purified with sufficient purity (> 95%) and yield (> 40 mg⁄ 3 L) for use in kinetic and inhibi-tion analysis as well as future use in structural studies Kinetic analysis confirmed the enzyme activity of the recombinant protein, and inhibition analysis confirmed classic competitive inhibition by a-glucosidase inhibi-tors Salacinol with a Ki of 0.2 lm was the best inhib-itor tested Acarbose had a Ki of 62 lm against MGAnt Through preliminary inhibitor screens, with maltose as a substrate for MGAnt, four new small molecules were discovered as promising a-glucosidase inhibitors from a group of 11 compounds designed and synthesized specifically for MGA inhibition

It is generally accepted that MGA, similar to SIM, has a negatively charged region in its catalytic center due to the presence of highly conserved acidic amino acid residues that are necessary for enzyme activity [8,28] This provides an explanation for the high affin-ity of inhibitors such as acarbose and miglitol because upon binding, the inhibitor is protonated at its nitro-gen atom resulting in a positive charge that interacts tightly with the negatively charged residues in the act-ive site [28,29] Salacinol, with a positact-ively charged sul-fur atom, also contains a zwitterionic sulfonium-sulfate

Table 1 Experimentally determined Kivalues Inhibition constants were determined using maltose as a substrate for MGA Kivalues were calculated according to each tested inhibitor concentration and averaged for a final result Errors indicate the range of the data.

structure that is thought to mimic the oxocarbenium

ion intermediates in glycoside hydrolysis reactions [20]

There is a current debate as to whether carbohydrate

mimics containing sulfonium ions and ammonium ions

are effective inhibitors because of their ability to mimic

the shape and charge of the presumed transition state,

or because they bind with high affinity due to

electro-static interactions with a carboxylate residue in the

enzyme active site [16,18] If electrostatic stabilization

is the key to enzyme affinity, inhibitors bearing a

permanent positive charge should function as well or better than current glycosidase inhibitors, as proven by the effectiveness of salacinol [16,18]

Inhibitors modeled after salacinol, all contain either

a sulfur or a selenium atom resulting in a permanent positive charge in the five-membered ring The differ-ences between these seven salacinol analogues involve the stereochemistry at the stereogenic centers in the polyhydroxylated, sulfated chain, as well as the num-ber of carbons in the acyclic chain linked to the

6

4

2

0

8 6 4 2

0

[Salacinol (3)] (µM)

[Acarbose (1)] (µM)

6

4

2

0

6

4

2

0

12 10 10

8 6 4 2 0

8 6 4 2 0

Fig 4 Dixon plot analysis of the inhibition of MGAnt by acarbose and compounds 3, 5, 13, 14, and 15 (Fig 1) with fixed maltose concentra-tions of 5 m M (open circles), 7.5 m M (filled circles), 15 m M (open squares) and 30 m M (filled squares).

sulfur⁄ selenium atom The remaining four of the 11

tested inhibitors, 8–11 (Fig 1), were modeled after

miglitol These inhibitors each have a six-membered,

cyclic alditol structure, with a positively charged sulfur

or nitrogen in the ring They also contain a

four-car-bon chain linked to the positively charged atom,

sim-ilar to salacinol and its derivatives As in the case of

salacinol, it was presumed that the permanent positive

charge in the six-membered ring would lead to

electro-static stabilization and increased active site affinity;

however, none of these four inhibitors proved to be

effective against MGAnt This suggests that while the

positive charge may be important in stabilizing active

site interactions, the ring size also affects binding in

the enzyme active site The fact that salacinol,

contain-ing a five-membered rcontain-ing, has proven to be as effective,

and in some cases more effective than both 1 and 2

(Fig 1), suggests that the positively charged

five-mem-bered ring is a better transition-state mimic because of

its ring shape [29,30]

A preliminary inhibition screen showed four

com-pounds of the group of salacinol analogues that

were the most potent inhibitors of MGAnt activity (5,

13–15) (Fig 4) The common element of these four

derivatives is the identical stereochemistry at the carbon

centers in the heteroalditol ring to that of salacinol

Inhibitor 5 is most similar to salacinol in that the only

alteration is the replacement of the ring sulfur atom by

selenium Inhibitors 6 and 7, which were not effective

as inhibitors of MGAnt, differ from salacinol (3) in

stereochemistry at the carbon centers in the ring These

results suggest that the stereochemistry at these centers

is critical for effective inhibition, the OH groups at

C-2 and C-3 interacting with complementary groups in

the enzyme active site The five-membered carbon ring

is likely the portion of the molecule that is most

important in conferring affinity for the enzyme active

site This conclusion is reinforced by the observation

that the four best inhibitors share three different

carbon chain lengths linked to the ring heteroatom,

suggesting that the chain length does not play a

pre-dominant role in the binding or effectiveness of the

inhibitors Unfortunately, kotalanol, with the longest

chain length, was not available for this study The

ana-lysis is clearly an oversimplification, since compound 12

was proven to be ineffective although it shares the same

ring stereochemistry as salacinol and compounds 5, 13,

14 and 15 The major difference between compound 12

and the four effective inhibitors is in the

stereochemis-try at C-4’ The stereochemisstereochemis-try at C-3’, and hence the

placement of the sulfate group in the enzyme active site,

does not appear to be important for enzyme inhibition

(compare 12 against 13 and 15 in Fig 1) Following the

preliminary screen, each of the four most promising inhibitors was used in further inhibition analysis

to determine their Ki values for comparison with the a-amylase inhibitor, acarbose and salacinol (Table 1) Determination of the inhibition constants showed that salacinol and its four most potent derivatives have Ki values in the low micromolar range (0.2–0.5 lm), while acarbose is approximately 15–20-fold less potent against MGAnt (Ki¼ 62 lm, Fig 4)

This poor inhibition of the purified catalytic domain

by acarbose was unexpected from previous reports in which acarbose was reported to be a powerful a-glu-cosidase inhibitor, with an effectiveness comparable to salacinol [2,28,32], although it is consistent with our preliminary data described above One study reported acarbose inhibition against human MGA isolated from intestinal scrapings to be in the low micromolar range [28] Acarbose is a very powerful inhibitor of human pancreatic a-amylase with a reported Ki of 15 nm [33] However the method of action of acarbose is quite complex and it appears to be acting as a type of sui-cide inhibitor of a-amylase in a mechanism whereby the acarbose is rearranged into an active entity by the a-amylase [33] Thus the acarbose itself is not the act-ive inhibitor The actact-ive rearranged entity may be inhibitory to MGA and could be generated in the intestinal scrapings by a-amylase present in the hetero-geneous sample or by activity in the C-terminal domain of the full-size protein, thereby accounting for the inhibition by ‘acarbose’ reported previously [28] Our previous studies of the inhibitory effect of salac-inol and its derivatives against human a-amylase and fungal glucoamylase, rather than MGA, report the effectiveness of salacinol to be in the millimolar range [16,18,20] In addition the analogues 5 and 13–15 did not inhibit human pancreatic a-amylase (S G Withers and B M Pinto, unpublished results) The present study reports activities of salacinol and synthetic deriv-atives, against active human recombinant MGAnt By confirming the higher potency of salacinol and its derivatives against human MGAnt as compared with a-amylase and fungal glucoamylase, our results suggest that the inhibitors show specificity towards different a-glucosidases This observation is important clinically because the design of a-glucosidase inhibitors for the treatment of Type II diabetes might require specificity for enzymes later in the starch digestion pathway in order to reduce unwanted side-effects

The inhibition constants of the most effective inhibi-tors found in this study, salacinol and compounds 5,

13, 14 and 15, are relatively similar, with salacinol and

15 being slightly more potent (
0.2 lm) (Table 1) Inhibitors 13 and 15 show similar inhibition, with Ki

values of approximately 0.25 lm Inhibitor 5 is slightly

worse at 0.5 lm Thus, for these four salacinol

deriva-tives, the nature of the heteroatom or the length of the

acyclic chain does not appear to have a significant

effect on inhibitory activity Since the stereochemistry

at C-3¢ on the acyclic chain in 14 is opposite to that in

5, 13 and 15 it would appear that placement of the

sulfate moiety within the active site is not significant

for enzyme inhibition

It would appear then that the critical features of a

potent inhibitor with an extended acyclic chain would

be the stereochemistry at C-4¢, present in 13, 14 and

15, the stereochemistry at C-2¢ and C-3¢ being

unim-portant It would also appear that C-5¢ and C-6¢

pro-trude from the active site and make no substantial

contacts with the enzyme since similar inhibitory

activ-ities were observed for 13, 14 and 15 While the initial

results of the inhibition assays are promising, at this

point analysis of structure activity relationships can

only be somewhat speculative However the results of

this study set the stage for improvement of the

specific-ity and affinspecific-ity of these compounds towards their

potential development as antidiabetics

Further confirmation of the importance of inhibitor

stereochemistry and how it affects binding in the active

site will only be possible with an analysis of the atomic

structure of the MGA binding site in both the presence

and absence of bound inhibitor Determination of this

structural information, building on the groundwork

reported in this study, will be a valuable tool in future

design and synthesis of a-glucosidase inhibitors

effect-ive against and specific to MGA These inhibitors

should be promising lead candidates as oral agents for

the treatment and prevention of Type II diabetes

Experimental procedures

Intestinal maltase assay

Recombinant expression of C-terminally truncated human

MGA in COS-1 cells has been published [8] The COS cells

transiently transfected with MGA-P1A2 were scraped off

the tissue culture plates in 150 mm KCl Aliquots were

so-nicated and assayed for hydrolysis of 2% maltose for 2 h

at 37
C by the Dahlqvist method [34] The reaction was

stopped by boiling and glucose production was measured

by the glucose oxidase assay (below) Protein was measured

with a Bio-Rad (Hercules, CA, USA) protein assay kit

Recombinant MGAnt in Drosophila S2 cells

The N-terminal catalytic domain of human MGA was

expressed in Drosophila cells The coding sequence was

isolated from MGA-P1A2, which lacks the 903 amino acid C-terminal domain [8] We also chose to delete the base pairs coding for the N-terminal cytosolic domain, the trans-membrane domain, and most (39⁄ 52 amino acids) of the O-glycosylated stalk region to give a construct encoding only the 876 amino acid catalytic domain of MGA The expression construct was made in three steps from MGA-P1A2 In the first step deletion of the coding sequence for the 86 amino acid N-terminal region was carried out An upstream primer (ccccggCTCGAGATCTgctgaatgtccagtggt) was synthesized which contains a CG tail, overlapping XhoI and BglII sites (capitalized) and 20 bp of complementary sequence The TCT at the end of the BglII site codes for Serine87 of the full size MGA For PCR, the upstream pri-mer was used in combination with a downstream pripri-mer, ACGTTAGTGCTAGGCAGTCGAG, which binds about

60 bp downstream of the XhoI site at nt1866 in MGA-P1A2 The PCR product was digested with XhoI, and ligated with a 6322 bp fragment of XhoI cut MGA-P1A2 The resulting plasmid, pBY_1, was cut with BglII and NotI, and ligated into BglII⁄ NotI cut pMT ⁄ BiP ⁄ V5-His vector (Invitrogen, Carlsbad, CA, USA) to give pBY_2 This was

in turn digested with NotI and AgeI to remove 74 bp of extra sequence The ends were made blunt with mung bean nuclease, and ligated together to give the expression vector pMT-Bip-MGAnt-His6 This construct allows secretion of the MGAnt into the culture medium under the control of a metallothionein promoter with an in-frame C-terminal hexa-histidine tail for purification

Transfection, selection and isolation

of single-cell clones

The Drosophila Expression System (DES: Invitrogen) with Schneider 2 (S2) cells was used to express and secrete recombinant MGAnt The S2 cells were maintained at

25
C as a semiadherent monolayer in Schneider’s Insect Medium (Sigma, St Louis, MO, USA) enriched with 10% heat-inactivated fetal bovine serum (FBS) The cells were split with enriched media at a ratio of 1 : 4 every 3–4 days until transfection The recombinant MGAnt vector was transfected, in combination with the pCoBLAST selection vector, which contains a blasticidin resistance cassette under the control of the Drosophila copia promoter, into S2 cells using the calcium phosphate procedure Cells at a concen-tration of 3· 106

cellsÆmL)1 were transfected with 19 lg

of expression vector and 1 lg of selection vector The procedure is carried out in duplicate to allow for one tran-siently and a second stably transfected cell line Transfected cells were washed the next day with enriched medium to remove the calcium phosphate solution Two days later, the transiently transfected cells were induced with 10 lm CdCl2

and after a further three days, the cell medium was assayed for protein expression by SDS⁄ PAGE and immunoblotting

with antipentaHis antibody (Qiagen, Montreal, Canada) In

order to obtain stably transfected cells, transfectants were

passaged for one month in selective medium [enriched

med-ium containing 16 lgÆmL)1 blasticidin (Invitrogen)] These

stably transfected blasticidin-resistant populations were

used for subsequent single cell selection and scale-up

Successfully transfected cells were diluted with

blastici-din-containing enriched medium to 10–50 cellsÆmL)1, mixed

with nontransfected S2 cells (to serve as a feeder layer), and

grown in 100 lL volumes in a 96-well tissue culture plate

until single colonies of cells developed Levels of active

MGAnt secreted into the medium were analyzed by

hydro-lysis of pNP-glucose A stable line of optimally expressing

single cell clone was adapted to Ex-Cell 420 Insect Serum

Free Media (JRH Biosciences, Lenexa, KS, USA) and then

scaled up to 3200 mL in shaker flasks Cells were then

induced with 2 lm CdCl2, and the secreted protein was

har-vested after 3 days

Protein purification

Secreted protein was batch-bound from the media using

chelating Sepharose resin (GE Healthcare, Montreal,

Can-ada) at a ratio of approximately 3 lL resin to 1 mL media

Copper sulfate was added to 200 lm and imidazole was

added to 2 mm to reduce nonspecific binding Resin was

poured into a column and washed with 20 column volumes

of 20 mm Tris pH 8.5, 300 mm NaCl Protein was eluted

step-wise with 2, 6, 10, 20, 30, and 50 mm imidazole in

wash buffer Eluted fractions were analyzed using

SDS⁄ PAGE and the pNP-glucose activity assay to identify

fractions containing active MGAnt These fractions were

pooled, concentrated, and dialyzed against 100 mm NaCl,

20 mm Tris pH 8.5 to remove residual copper and

imidaz-ole, and to lower the salt concentration of the sample in

preparation for ion exchange chromatography

A BioCAD Poros-HQ anion exchange column

(PerSep-tive Biosystems, Framingham, MA, USA) was used to

further purify the MGAnt The column was washed and

equilibrated with starting buffer, 100 mm Bis-Tris Propane

pH 7 Sample was diluted by half with 100 mm Bis-Tris

Propane pH 7 then was loaded on column and washed with

starting buffer Sample was eluted over a linear gradient of

0–1 m NaCl Eluate was collected in 3 mL fractions and

assayed for active MGA using SDS⁄ PAGE and

pNP-glu-cose assay Fractions containing pure, active MGAnt were

pooled and concentrated to
23 mgÆmL)1

Inhibitors

Acarbose 1, salacinol 3 and synthesized derivatives were

analyzed as inhibitors for recombinant human MGAnt

using the glucose oxidase enzyme activity assays described

below The inhibitors were dissolved in water as 50 mm

stock solutions and stored at)20
C

Enzyme activity assay

Two methods were used to assess MGAnt activity For rapid measurements of cell supernatants and assessment of column fractions the pNP-glucose assay was used For detailed kinetic analysis the glucose-oxidase assay was used

pNP-glucose assay

Reactions were carried out in 50 mm Mes buffer, pH 5.75, with 5 mm of para-nitrophenol-d-glucopyranoside (pNP-glucose, Sigma) as substrate Reaction volumes were 50 lL

in 96-well microtiter dishes Reactions were incubated at

37
C, and at the completion of the reaction (typically 30–

45 min) were stopped with 50 lL of 0.5 m sodium carbon-ate The absorbance of the reaction product was measured

at 405 nm with 520 nm background correction in a micro-titer plate reader

Glucose-oxidase assay

Analysis of MGAnt inhibition was performed using maltose

as the substrate, and measuring the release of glucose Reac-tions were carried out in 100 mm Mes buffer, pH 6.5, at

37
C for 15 min The reaction was stopped by boiling for

3 min 20 lL aliquots were taken and added to 100 lL of glu-cose oxidase assay reagent (Sigma) in a 96-well plate Reac-tions were developed for 1 h and absorbance was measured

at 450 nm to determine the amount of glucose produced by MGA activity in the reaction One unit of activity is defined

as the hydrolysis of one micromole of maltose per minute All reactions were performed in triplicate and absorbance measurements were averaged to give a final result

Enzyme kinetics

Kinetic parameters of recombinant MGAnt were deter-mined using the glucose oxidase assay to follow the produc-tion of glucose upon addiproduc-tion of enzyme (25 nm) at increasing maltose concentrations (from 2.5 to 30 mm) with

a reaction time of 15 min Reactions were linear within this time frame The program GraFit 4.0.14 was used to fit the data to the Michaelis-Menten equation and estimate the kinetic parameters, Km and Vmax, of the enzyme Kivalues for each inhibitor were determined by measuring the rate of maltose hydrolysis by MGAnt at varying inhibitor concen-trations Data were plotted in Lineweaver-Burk plots (1⁄ rate versus1 ⁄ [substrate]) and Ki values for the compet-itive inhibition were determined by the equation Ki¼

Km[I]⁄ (Vmax)s) Km, where ‘s’ is the slope of the line The

Kireported for each inhibitor was estimated by averaging the Kivalues obtained from each of the different inhibitor concentrations For ease of visualization, the inhibition analyses are presented as Dixon plots in Fig 4

We thank Brenda Yun, Tara Signorelli, and Marees

Harris-Brandts for technical assistance Supported by

PENCE (Protein Engineering Network of Centres of

Excellence), Canadian Institutes for Health Research

(CIHR), Natural Sciences and Engineering Research

Council of Canada, and University Medical

Discover-ies Inc., Swiss National Science Foundation (grant

3100A0-100772 to E.E.S)

References

1 Sherwood L (1995) Fundamentals of Physiology: a

Human Perspective, 2nd edn West Publications Co.,

St Paul⁄ Minneapolis

2 Asano N (2003) Glycosidase inhibitors: update and

per-spectives on practical use Glycobiology 13, 93R–104R

3 Holman RR, Cull CA & Turner RC (1999) A

rando-mized double-blind trial of acarbose in type 2 diabetes

shows improved glycemic control over 3 years Diabetes

Care 22, 960–964

4 Jacob GS (1995) Glycosylation inhibitors in biology and

medicine Curr Opin Struct Biol 5, 605–611

5 Simpson RW, Shaw JE & Zimmet PZ (2003) The

pre-vention of type 2 diabetes – lifestyle change or

pharmac-otherapy? A challenge for the 21st century Diabetes Res

Clin Pract 59, 165–180

6 Chiasson JL, Josse RG, Gomis R, Hanefeld M, Karasik

A & Laakso M (2002) Acarbose for prevention of type

2 diabetes mellitus: the STOP-NIDDM randomised

trial Lancet 359, 2072–2077

7 Scheen AJ (2003) Is there a role for alpha-glucosidase

inhibitors in the prevention of type 2 diabetes mellitus?

Drugs 63, 933–951

8 Nichols BL, Avery S, Sen P, Swallow DM, Hahn D &

Sterchi E (2003) The maltase-glucoamylase gene:

com-mon ancestry to sucrase-isomaltase with complementary

starch digestion activities Proc Natl Acad Sci USA 100,

1432–1437

9 Nichols BL, Eldering J, Avery S, Hahn D, Quaroni A

& Sterchi E (1998) Human small intestinal

maltase-glu-coamylase cDNA cloning: homology to

sucrase-isomal-tase J Biol Chem 273, 3076–3081

10 Semenza G & Auricchio S (1989) The Metabolic Basis of

Inherited Disease II(Scriver, C R, Beaudet, A L, Sly, W S,

Valle, D, Stanbury, J B, Wyngaarden, J B & Fredrickson,

D S, eds), pp 2975–2997 McGraw-Hill Inc., New York

11 Roy R, Gautier M, Hayes H, Laurent P, Zaragoza P,

Eggen A & Rodellar C (2002) Assignment of maltase

glucoamylase (MGAM) gene to bovine chromosome

4q34 by in situ hybridization and confirmation by

radiation hybrid mapping Cytogenet Genome Res 98,

311C

12 Lee SS, He S & Withers SG (2001) Identification of the catalytic nucleophile of the family 31 alpha-glucosidase from Aspergillus niger via trapping of a 5-fluoroglyco-syl-enzyme intermediate Biochem J 15, 381–386

13 Yoshikawa M, Murakami T, Shimada H, Matsuda H, Yamahara J, Tanabe G & Muraoka O (1997) Salacinol, potent antidiabetic principle with unique thiosugar sul-fonium sulfate structure from the Ayurvedic traditional medicine Salacia reticulata Sri Lanka and India Tetra-hedron Lett 38, 8367–8370

14 Yoshikawa M, Murakami T, Yashiro K & Matsuda H (1998) Kotalanol, a potent alpha-glucosidase inhibitor with thiosugar sulfonium sulfate structure, from antidia-betic ayurvedic medicine Salacia reticulate Chem Pharm Bull (Tokyo) 46, 1339–1340

15 Shimoda H, Fujimura T, Makino K, Yoshijima K, Naitoh K, Ihota H & Miwa Y (1999) Safety profile of extractive from trunk of Salacia reticulata (Celastra-ceae) J Food Hygienic Soc Japan 40, 198–205

16 Ghavami A, Johnston BD, Jensen MT, Svensson B & Pinto BM (2001) Synthesis of nitrogen analogues of salacinol and their evaluation as glycosidase inhibitors

J Am Chem Soc 123, 6268–6271

17 Ghavami A, Johnston BD, Maddess MD, Chinapoo

SM, Jensen MT, Svensson B & Pinto BM (2002) Synth-esis of 1,4-anhydro-d-xylitol heteroanalogues of the naturally occurring glycosidase inhibitor salacinol and their evaluation as glycosidase inhibitors Can J Chemis-try-Revue Canadienne De Chimie 80, 937–942

18 Ghavami A, Johnston BD & Pinto BM (2001) A new class of glycosidase inhibitor: synthesis of salacinol and its stereoisomers J Org Chem 66, 2312–2317

19 Ghavami A, Sadalapure KS, Johnston BD, Lobera M, Snider BB & Pinto BM (2003) Improved syntheses of the naturally occurring glycosidase inhibitor salacinol Synlett 9, 1259–1262

20 Johnston BD, Ghavami A, Jensen MT, Svensson B & Pinto BM (2002) Synthesis of selenium analogues of the naturally occurring glycosidase inhibitor salacinol and their evaluation as glycosidase inhibitors J Am Chem Soc 124, 8245–8250

21 Liu H & Pinto BM (2005) Efficient synthesis of the glu-cosidase inhibitor blintol, the selenium analogue of the naturally occurring glycosidase inhibitor salacinol

J Org Chem 70, 753–755

22 Szczepina MG, Johnston BD, Yuan Y, Svensson B & Pinto BM (2004) Synthesis of alkylated deoxynojirimy-cin and 1,5-dideoxy-1,5-iminoxylitol analogues: polar side-chain modification, sulfonium and selenonium het-eroatom variants, conformational analysis, and evalua-tion as glycosidase inhibitors J Am Chem Soc 126, 12458–12469

23 Pinto BM, Johnston BD, Ghavami A, Szczepina MG, Liu H & Sadalapure K (2004) Glycosidase inhibitors