Báo cáo khoa học: The Saccharomyces cerevisiae orthologue of the human protein phosphatase 4 core regulatory subunit R2 confers resistance to the anticancer drug cisplatin pot

cerevisiae diploid strains with homozygous deletion of YBL046wand two or one functional copies of the TUB2 gene were viable and no more sensitive to microtubule-depolymerizing drugs than

protein phosphatase 4 core regulatory subunit R2 confers resistance to the anticancer drug cisplatin

C James Hastie1,*, Cristina Va´zquez-Martin1,*, Amanda Philp1, Michael J R Stark2 and

Patricia T W Cohen1

1 Medical Research Council Protein Phosphorylation Unit, School of Life Sciences, University of Dundee, UK

2 Division of Gene Regulation and Expression, School of Life Sciences, University of Dundee, UK

Cisplatin and oxaliplatin are potent chemotherapeutic

agents currently used in the treatment of many

can-cers, including lung, gonadal, head, neck and bowel

neoplasias However, the unpredictable resistance of

certain tumours to these platinum-based agents, which

bind to DNA, poses significant problems The

mechan-ism by which resistance arises is obscure, and one approach to dissecting it has been to examine the sen-sitivity of lower organisms carrying different gene dele-tions or disrupdele-tions to these drugs In a recent genome-wide screen of Saccharomyces cerevisiae dele-tion strains, most of the genes identified as conferring

Keywords

cisplatin; platinum-based anticancer drugs;

Pph3; protein phosphatase 4; Psy4

Correspondence

P T W Cohen, MRC Protein

Phosphorylation Unit, School of Life

Dundee, Dow Street, Dundee DD1 5EH, UK

Fax: +44 1382 223778

Tel +44 1382 384240

E-mail: p.t.w.cohen@dundee.ac.uk

*These authors contributed equally to this

work.

(Received 28 April 2006, revised 22 May

2006, accepted 24 May 2006)

doi:10.1111/j.1742-4658.2006.05336.x

The anticancer agents cisplatin and oxaliplatin are widely used in the treat-ment of human neoplasias A genome-wide screen in Saccharomyces cere-visiae previously identified PPH3 and PSY2 among the top 20 genes conferring resistance to these anticancer agents The mammalian ortho-logue of Pph3p is the protein serine⁄ threonine phosphatase Ppp4c, which is found in high molecular mass complexes bound to a regulatory subunit R2 We show here that the putative S cerevisiae orthologue of R2, which

is encoded by ORF YBL046w, binds to Pph3p and exhibits the same unusually high asymmetry as mammalian R2 Despite the essential function

of Ppp4c–R2 in microtubule-related processes at centrosomes in higher eukaryotes, S cerevisiae diploid strains with homozygous deletion of YBL046wand two or one functional copies of the TUB2 gene were viable and no more sensitive to microtubule-depolymerizing drugs than the con-trol strain The protein encoded by YBL046w exhibited a predominantly nuclear localization These studies suggest that the centrosomal function of Ppp4c–R2 is not required or may be performed by a different phosphatase

in yeast Homozygous diploid deletion strains of S cerevisiae, pph3D, ybl046wD and psy2D, were all more sensitive to cisplatin than the control strain The YBL046w gene therefore confers resistance to cisplatin and was termed PSY4 (platinum sensitivity 4) Ppp4c, R2 and the putative ortho-logue of Psy2p (termed R3) are shown here to form a complex in Drosophila melanogaster and mammalian cells By comparison with the yeast system, this complex may confer resistance to cisplatin in higher eukaryotes

Abbreviations

ERK, extracellular signal-regulated kinase; 5-FOA, 5-fluoro-orotic acid; HEK293, human embryonic kidney cell line 293; IRS4, insulin receptor substrate 4; JNK, c-Jun N-terminal kinase; NF-jB, nuclear factor jB; MMS, methyl methanesulphonate; Pph, Saccharomyces cerevisiae

subunit (also termed PP4, PPX); Psy, platinum sensitivity; SMN, survival of motor neuron; TNF-a, tumour necrosis factor-a; TOR, target of rapamycin.

sensitivity to oxaliplatin and cisplatin were in the

DNA damage and repair pathways However, one

strain with a deletion of the protein serine⁄ threonine

phosphatase, Pph3p, was ranked 10th and 14th in

sen-sitivity to oxaliplatin and cisplatin, respectively [1]

Suprisingly, Pph21p and Pph22p, the most closely

rela-ted protein phosphatases to Pph3p in the PPP family

(Table 1 [2]), were not found to be sensitive to these

drugs Previous studies on Pph3p function had shown

that it was encoded by a nonessential gene and had

overlapping properties with Pph21p and Pph22p,

allowing limited growth in some genetic backgrounds

when the PPH21 and PPH22 genes were deleted [3,4]

In addition, Pph3p and the other Tap42p interacting

phosphatases (Sit4p, Pph21p and Pph22p) are involved

in the target of rapamycin (TOR) kinase-mediated

modification of Gln3p, a GATA-type transcription

fac-tor responsive to different nitrogenous nutrients and

starvation [5]

In higher organisms, the orthologue of Pph3p is

believed to be the protein phosphatase 4 catalytic

sub-unit (Ppp4c), and the Pph21⁄ 22 phosphatases are

othologous to PP2Ac ([2,6] Table 1) In contrast to

S cerevisiae Pph3p, Ppp4c is encoded by an essential

gene in Drosophila melanogaster, where it is required

for the recruitment of c-tubulin to the centrosomes

and formation of the mitotic spindle [7] In

Caenorhab-ditis elegans, Ppp4c is encoded by two genes, one of

which is similarly required for the maturation of

cen-trosomes and the formation of the spindle in mitosis

as well as for sperm meiosis and the formation of

chi-asmata during meiosis [8] Recently, it has become

increasingly clear that Ppp4c may perform a

multipli-city of functions in higher eukaryotes A Ppp4

com-plex interacts with the survival of motor neuron

(SMN) complex and enhances the temporal

localiza-tion of the small nuclear ribonucleoproteins in human

cells, indicating a function in spliceosomal assembly

[9] Ppp4c may participate in cellular signalling

path-ways, including the tumour necrosis factor-a (TNF-a)-induced activation of c-Jun N-terminal kinase (JNK), the hematopoietic progenitor kinase JNK pathway [10,11] and the TNF-a downregulation of insulin receptor substrate 4 (IRS4) [12] Members of the nuc-lear factor jB (NF-jB) family of transcription factors associate with Ppp4c, which stimulates NF-jB-medi-ated transcription and DNA binding [13] Interest-ingly, Ppp4c has recently been implicated in the cisplatin-mediated activation and dephosphorylation of NF-jB p65 (also termed RelA), which may underlie the increased cisplatin resistance found in cell lines fol-lowing suppression of the extracellular signal-regulated kinase (ERK) pathway, which leads to the activation

of NF-jB [14]

The subunit composition of the Ppp4 complexes that may be involved in cisplatin resistance are not delinea-ted Ppp4 holoenzymes isolated from mammalian tis-sues have led to the identification of two regulatory subunits of Ppp4c that do not interact with the closely related PP2Ac, namely R1 (105 kDa) [15] and R2 (55 kDa) [16] These regulatory subunits form inde-pendent heterodimers with Ppp4c A further regulatory subunit, a4 (39 kDa, putative orthologue of Tap42p), associates with protein phosphatase catalytic subunits

of Ppp4, PP2A and Ppp6 to form heterodimeric com-plexes [17] R2 is likely to be a core regulatory subunit, such that the Ppp4c–R2 complex may then interact with a variable third subunit, as observed for PP2A complexes Gemin3/gemin4 or gemin4 of the SMN complex has been identified as a possible variable sub-unit associating with the human Ppp4c–R2 complex [9] Putative orthologues of mammalian R2 were iden-tified in several species from sequence similarities, including D melanogaster, C elegans and S cerevisiae [16] Here we examine the properties of the putative

S cerevisiae R2 orthologue, YBL046w, and show that deletion of YBL046w, similarly to deletion of PPH3, confers sensitivity to the anticancer drug cisplatin

Table 1 Putative protein phosphatase subunit orthologues of S cerevisiae, D melanogaster and H sapiens in the PP2A subfamily of the PPP family R1, R2 and a4 show mutually exclusive binding to Ppp4c.

Common regulatory subunit of all the

above catalytic subunits

Identification of the protein encoded by YBL046w

as a regulatory subunit of Pph3

The protein encoded by S cerevisiae ORF YBL046w

(SPTREMBL P38193) was suggested to be a putative

orthologue of the mammalian R2 core regulatory

sub-unit of Ppp4c (Table 1) from an alignment of amino

acids 97–135 with amino acids 176–212 of the human

protein, which showed 46% identity [16] However,

out-side this region, the proteins are difficult to align

because identity between the two proteins is low

Never-theless, the alignment in Fig 1 shows that the overall

similarity of the protein encoded by YBL046w to

human⁄ Drosophila R2 sequences is 36% We sought to

determine whether the properties of R2 and the protein

encoded by ORF YBL046w were also similar

Bacteri-ally expressed human GST–R2 was shown to interact

with native Ppp4c and not with other protein

phospha-tase catalytic subunits in the PPP family [16] S

cerevisi-ae cells expressing YBL046w tagged at its C-terminus

with an MYC13epitope were independently transformed

with specific PCR-generated transformation modules

such that derivatives were generated in which either

Pph3p, Pph21p, Sit4p or Ppg1p was expressed with

a triple haemagglutinin (HA) tag at the N-terminus

(Tables 2 and 3) Figure 2 shows that when HA-tagged

Pph3p (the putative orthologue of Ppp4c) was

immuno-adsorbed from cell extracts, MYC13-tagged YBL046w

was also adsorbed together with the HA-tagged

phos-phatase In contrast, even though Pph21p, Sit4p and

Ppg1p are the most closely related yeast protein

phos-phatases to Pph3p, MYC13-tagged YBL046w did not

coimmunoprecipitate with any of these other three

HA-tagged phosphatase catalytic subunits (Fig 2)

A further characteristic of human R2 was that,

although its molecular mass calculated from its amino

acid sequence is 55 kDa, it eluted from Superose 6 with

an apparent molecular size of 450 kDa [16] Bacterially

expressed S cerevisiae Flag-tagged YBL046w

(calcula-ted molecular mass 51.6 kDa and 50.6 kDa with and

without the Flag tag, respectively) elutes from Superose

6 at the same anomalous position of 450 kDa as

Dro-sophilaHis6–R2 (Fig 3) and human His6–R2 [16]

Examination of the phenotype of S cerevisiae

strains carrying a deletion of the YBL046w gene

Haploid yeast strains carrying a null allele of YBL046w

in AY925 and AY926 backgrounds and diploid strains

homozygous for this allele in an AY927 background are

viable and showed no growth differences from wild-type

control cells on agar plates of rich medium (YPD), syn-thetic medium (SC) containing either glucose or galac-tose, or rich medium depleted in nitrogen Cell size was similar to that of the wild type in both log and station-ary phases, as visualized by microscopy Mating and sporulation were normal The YBL046w null mutants did not show increased sensitivity to low or high temper-atures in the range 14–37
C, heat shock at 55
C, caf-feine (1.5–6 mm) or vanadate (2 mm) The sensitivity of the YBL046w null mutants to calcofluor white (0.1– 0.2%), calcium chloride (100 mm), sorbitol (1 m) and SDS (0.005–0.01%) indicated that the integrity of the cell wall was not compromised compared with the wild type Sensitivities to reagents that block the cell cycle, hydroxyurea (0.2 m), nocodazole (2–45 lgÆmL)1) and benomyl (2–25 lgÆmL)1), were identical to those of the wild-type cells

Examination of the phenotype of S cerevisiae carrying deletions for both the YBL046w gene and the TUB2 gene

Since decreased expression of Ppp4c in D melanogaster and C elegans leads to aberrant growth and⁄ or organ-ization of microtubules at centrosomes, coupled with an arrest during mitosis, it seemed likely that mutation of the core regulatory subunit R2 and its orthologues in lower eukaryotes would also lead to a similar pheno-type Although ybl046wD mutants of S cerevisiae did not show increased sensitivity to the microtubule-depo-lymerizing drugs nocodazole and benomyl, we sought to test whether compromising the function of TUB2 enco-ding b-tubulin might uncover a role for YBL046w in microtubule nucleation or organization in yeast Since homozygous deletion of TUB2 in diploid S cerevisiae strains is lethal, whereas heterozygous null TUB2 mutants are more sensitive to benomyl [18], S cerevisiae strains heterozygous for a TUB2 deletion in the Euro-scarf background were created (Table 4) Figure 4 shows that there is an effect of TUB2⁄ tub2D::HISMX6 heterozygosity on benomyl sensitivity in the BY4743 background, as expected (compare the growth of strains BY4743 and BY4743 TUB2⁄ tub2D::HISMX6 on plates containing 12 and 16 lgÆmL)1 benomyl) However, there is no clear effect of the homozygous deletion of YBL046won benomyl sensitivity with either two or one functional copies of TUB2

Effect of cisplatin on PPH3 (YDR075w), YBL046w and PSY2 (YNL201c) deletion strains

A genome-wide screen of S cerevisiae genes that, when individually deleted, conferred sensitivity to the

anticancer agents cisplatin and oxaliplatin, identified

among the top 20 most sensitive genes PPH3 and a

gene of unknown function, YNL201c, which the

authors termed PSY2 (for platinum sensitivity 2) [1]

Psy2p and YBL046w were among several proteins

found to associate with Pph3p in each of two separate

genome-wide screens for interacting proteins [19,20]

However, ybl046wD was not identified as sensitive to

cisplatin and oxaliplatin We therefore decided to

compare the sensitivity of pph3D, ybl046wD and psy2D diploid strains to increasing concentrations of cisplatin Figure 5A shows that all three homozygous diploid deletion strains were more sensitive than the control strain to 4 mm and 5 mm cisplatin, and that ybl046wD was just as sensitive to cisplatin as pph3D and psy2D

In order to corroborate the effects of cisplatin on the ybl046wD strain, this strain was transformed with YCplac111 YBL046w We found that the growth of

Fig 1 Alignment of the Saccharomyces cerevisiae protein encoded by ORF YBL046w with human (Hs) and Drosophila melanogaster (Dm) R2 Identities between any two proteins are in black and similarities are in grey (GenEMBL accession numbers AJ271448 and AJ271449).

this rescued strain on plates containing 4 mm and

5 mm cisplatin was the same as that of the control strain transformed with the vector YCplac111 (data not shown) The YBL046w gene was therefore termed PSY4 (for platinum sensitivity 4)

The primary target of cisplatin in cells is DNA Since interaction with DNA may impair the DNA and activate the DNA damage response pathways, we sought to examine whether Pph3p, YBL046w and Psy2p are involved in cisplatin effects via participation

in the Rad53p pathways In response to DNA damage caused by treatment of cells with methyl methanesul-phonate (MMS), Rad53p becomes phosphorylated, as can be seen in Fig 5B However, cisplatin did not elicit the Rad53p phosphorylation in control, pph3D, ybl046wD or psy2D cells Thus, we have no evidence that cisplatin activates the Rad53p DNA damage path-ways or that the Pph3p–Psy4p–Psy2p complex modu-lates the phosphorylation of Rad53p in response to cisplatin

Ppp4c, R2 and R3 form a complex in human and Drosophila cells

A putative human orthologue of YNL201c⁄ Psy2p was identified in the NCBI database from sequence similarit-ies, and termed R3 (accession number BC02409) Immunoadsorption of endogenous R2 from Drosophila

Kc and S2 cell lysates showed the presence of endog-enous R3 and Ppp4c in the immunopellets (Fig 6) Con-versely, immunoadsorption of endogenous R3 from the same cells showed the presence of R2 and Ppp4c in im-munopellets In addition, anti-FLAG immunopellets from human cells (HEK293) cells expressing FLAG–R2 showed the presence of R3 and Ppp4c (Fig 6) These results demonstrate that Ppp4c, R2 and R3 form a com-plex in higher eukaryotes

Discussion

Diploid S cerevisiae strains that are homozygous for deletion of the protein phosphatase catalytic subunit gene PPH3 are more sensitive to the anticancer drugs cisplatin and oxaliplatin than wild-type yeast [1] Pph3p is believed to be the orthologue of mammalian Ppp4c, although it shows only marginally greater sequence similarity to human Ppp4c than to human PP2A or Ppp6c [2] In mammalian cells, Ppp4c is found in high molecular mass complexes, some of which comprise Ppp4c bound to a regulatory subunit R2 [16] We show here that Pph3p specifically interacts with YBL046w⁄ Psy4p, a protein with sequence similar-ity to R2 In addition, YBL046w⁄ Psy4p shows

CATAGTGGAAAGAGGGATATAAATTATCGCATAAAACAATAAACAAAAAGAAAAATG AGGGAACAAAAGCTGGAG

GTATCCCCACTGTGTACTTTTATTTTTGGTTAGAGAATTGGCCCAGTAGAGATGGAA AGGGAACAAAAGCTGGAG

GGCAATTGGAGTGACATAGCAGCTACTACAACTACAAAAGCAAAATCTCCACAAAGTAAT CGGATCCCCGGGTTAATTAA

CCAAGTGCTTCAATCCTAGAGAAGAAGAAAGGTAAGAAAAAGAAAGGAAAGCAACTTAAT GAATTCGAGCTCGTTTAAAC

the same anomalous behaviour as both human and

Drosophila R2 on gel filtration, suggesting that

YBL046w⁄ Psy4p, like human and Drosophila R2, is a

highly asymmetrical or unfolded protein

The major phenotype seen in D melanogaster and

C elegans deficient in Ppp4c expression is defective

nucleation or growth of microtubules at centrosomes

leading to an arrest in the formation of the mitotic

spindle [7,8] We therefore sought to examine whether

deletion of YBL046w⁄ PSY4 in S cerevisiae would lead

to any abnormalities in microtubule-related processes

by testing growth in the presence of the

microtubule-depolymerizing drug benomyl We used strains

hetero-zygous for deletion of the TUB2 gene, which encodes

b-tubulin, in an attempt to make cells more sensitive

to any defects in tubulin-related processes However,

this did not uncover a role for YBL046w⁄ PSY4 in any

microtubule-related events In accordance with these

studies, we found that C-terminally MYC13-tagged

YBL046w⁄ Psy4p has a nuclear localization with no

evidence of localization at the spindle pole bodies

(data not shown) This contrasts with the situation in

human A431 and HeLa cells, where R2 has been

localized to centrosomes [16] Ppp4c has been localized

to centrosomes in human, Drosophila and C elegans

cells [7,8,21], but there are no reports of Pph3p being

present at spindle pole bodies, and pph3 deletion

strains are viable [3] Thus it appears that the essential

function of Ppp4c–R2 in microtubule-related processes

at centrosomes in higher eukaryotes is not required or

may be performed by a different phosphatase in yeast

Two different screens of the S cerevisiae proteome

identified several proteins showing association with

Pph3p [19,20] However, there were only two proteins

identified that were common to both screens; one was

YBL046w⁄ Psy4p, the orthologue of R2, and the other

was an unknown protein YLN201c, later named Psy2p because it was also found to be sensitive to cisplatin and oxaliplatin [1] Data from the proteome analysis indicate that Psy2p, like YBL046w⁄ Psy4p, is found in acomplex with Pph3p From sequence similarities, we have identified putative human and Drosophila ortho-logues (termed R3) of yeast Psy2p and shown that R3 forms a complex with R2 and Ppp4c in both higher eukaryotes These studies point to the existence of a trimeric complex, indicating that Ppp4 and Pph3 sub-unit structures may thus resemble those of PP2A and Pph21⁄ Pph22, where a core regulatory subunit forms a complex with the catalytic subunit to which a third variable subunit may bind Since YBL046w⁄ Psy4p would appear to be an obligatory core subunit of Pph3p required for the binding of Psy2p, we examined the sensitivity of the YBL046w⁄ Psy4p deletion strain

to cisplatin The comparable increased sensitivities to cisplatin of the homozygous diploid deletion strains pph3D, ybl046w⁄ psy4D and psy2D compared to wild-type yeast indicate a role for the Pph3p–(YBL046w⁄ Psy4p)–Psy2p complex in conferring resistance to the anticancer drug cisplatin and suggest that the Ppp4c– R2–R3 complex in human cells may perform a similar function

Cisplatin and oxaliplatin are platinum-based drugs that bind to DNA The results suggest that Pph3p– (YBL046w⁄ Psy4p)–Psy2p and possibly the human orthologue Ppp4c–R2–R3 may regulate processes directly related to DNA function The low pI of all subunits (£ 5.1) indicates that the Pph3p and Ppp4c complexes are unlikely to bind directly to DNA but are more likely to modulate the function of transcription factors or other DNA-binding proteins In this respect,

it is relevant that Pph3p has been found to play a role

in the regulation of Gln3p, a transcription factor

Table 3 Oligonucleotide primers used for amplification of markers and⁄ or genes subsequent to gene deletion or tagging The numbers relat-ive to the initiating ATG of the gene are indicated.

A B

D C

E

Fig 2 Analysis of the interaction between the YBL046w protein and several protein phosphatase catalytic subunits Extracts were prepared

phosphatase catalytic subunits Supernatant and pellet fractions of the cell lysates were obtained by centrifugation following immunoadsorp-tion from lysates with HA antibodies and protein G Sepharose Ten micrograms of lysate protein and the equivalent relative loadings of

and pellet fractions of the cell lysates were obtained by centrifugation following immunoadsorption from lysates with MYC antibodies and protein G Sepharose; WT, AY925; MTAY925, YBL046w-MYC13, HA3PPA4 Twenty micrograms of lysate protein, 30 lg of protein from the

responsive to nitrogenous nutrients and starvation In humans, rapidly growing cancer cells may become starved of certain nutrients and therefore more depend-ent on the Ppp4-regulated systems However, the sensi-tivity of yeast to cisplatin was seen in optimal growth conditions, suggesting a wider role of the Pph3p– (YBL046w⁄ Psy4p)–Psy2p complex in transcription and⁄ or other DNA-related processes

Recent studies have suggested that Psy2p may play

a role in the DNA damage response [22], and a two-hybrid study identified an interaction between Psy2p and Rad53p [23], which lies on the DNA damage response pathways We therefore investigated whether Rad53p is phosphorylated in response to cisplatin treatment Although we were able to show that Rad53p is phosphorylated in response to MMS, which causes DNA damage, we did not observe phosphoryla-tion of Rad53p on treatment of control yeast strains

or those carrying deletions of PPH3, YBL046w⁄ PSY4 and PSY2 with cisplatin It is therefore unlikely that the Pph3p–(YBL046w⁄ Psy4p)–Psy2p complex confers resistance to cisplatin through the Rad53p pathways

We also found no evidence that the cell wall permeab-ility was compromised in the YBL046w⁄ PSY4 deletion strain, suggesting that cisplatin resistance was unlikely

to be caused by increased entry of the drug Thus, other possibilities, such as a role for Pph3p– (YBL046w⁄ Psy4p)–Psy2p in DNA repair processes, appear more likely to underlie the cisplatin sensitivity

Table 4 Saccharomyces cerevisiae strains Accession numbers for the Euroscarf strains (http://www.uni-frankfurt.de/fb15/mikro/euroscarf/ data/) are given in parentheses Diploid strain are indicated; all other strains are haploid PPH3 is ORF YDR075w, PSY4 is ORF YBL046w, and PSY2 is ORF YNL201c Ac number, Accession number.

Ac number

A

B

R2 were subjected to gel filtration on Superose 6 Column eluate

fraction numbers are indicated above each lane Molecular mass

elution position of the molecular mass markers for Superose 6 gel

filtration, thyroglobulin (670 kDa) and ferritin (450 kDa).

of strains carrying deletions of PPH3, YBL046w⁄ PSY4

and PSY2

Experimental procedures

Yeast strains, plasmids, media and general

methods

Saccharomyces cerevisiaestrains used in this study are

des-cribed in Table 4 The HIS3MX marker was employed as a

selective marker for deletion of the PSY4⁄ YBL046w gene

using a single-step PCR-based method [24] with plasmid

pFA6aHis3MX6 as template and source of the HIS3 gene

and primers F1 and R1 (Table 2) Single-step tagging of

YBL046w with sequences encoding MYC13at the

C-termi-nus was performed by an initial PCR [24] using primers F2

and R2 with the template pFA6a-13MYC-HisMX6, a

pro-tein-tagging module consisting of DNA encoding MYC13

together with the S cerevisiae ADH1 terminator

Transfor-mation of yeast cells with the PCR products was carried

out using a lithium acetate method [25] N-terminal HA tagging of PPH21, PPH3, PPG1 and SIT4 was performed

by PCR with template pMPY-3xHA and primers F3 and R3 to F6 and R6 (Table 2) The template contained the URA3 gene flanked by three direct repeats of the HA epi-tope tag [26] After transformation with the PCR fragment (selecting on Ura dropout plates to allow integration of the PCR product), strains were grown on 5-fluoro-orotic acid (5-FOA) plates to select for direct repeat mediated ‘pop-out’

of the URA3 gene, leaving behind the 3HA epitope All transformants were verified by PCR of genomic DNA using gene-specific primers (Table 3) Oligonucleotides were syn-thesized by K Jarvie (School of Life Sciences, University of Dundee)

YPD medium contained 1% yeast extract, 2% peptone and 2% glucose Synthetic complete medium (SC) contained 0.67% yeast nitrogen base (Difco Laboratories, Detroit,

MI, USA), 2% glucose and amino acids and bases as described [27], omitting histidine as required for selection or adding G418 (200 lgÆmL)1 on agar plates) to select for

Fig 4 Examination of the benomyl sensitiv-ity of Saccharomyces cerevisiae strains

heterozygous for tub2D Cultures of BY4743

overnight Suitable 10-fold serial dilutions

 25 cells) were spotted in that order (from left to right) on plates containing the indicated concentrations of benomyl and grown at

kanamycin resistance Sporulation medium contained 1%

potassium acetate and 0.1% yeast extract Medium

deple-ted in nitrogen was YPD without the yeast nitrogen base

S cerevisiae cells were grown at 28
C unless otherwise

stated To analyse the response to different media and

sensitivity to various compounds, S cerevisiae cells were

grown from independent colonies overnight in YPD, cooled

to 4
C, sonicated briefly and counted in a CASY1 cell

counter (Scha¨rfe Systems, Rentlingen, Germany), and

dilu-ted in YPD to 2–5· 106

cellsÆmL)1; this was followed by three serial 10-fold dilutions, and all dilutions were spotted

onto agar plates (5 lL per spot) using a multipronged

inoculation device (Dan-Kar Corp St Woburn, MA, USA)

Benomyl was dissolved in DMSO and added to near-boiling

YPD agar Plates for each concentration of benomyl were

poured from the same batch and so are directly comparable

Cisplatin was dissolved in DMSO and diluted immediately

into YPD agar before pouring the plates Plates were used

on the day of preparation and incubated at 26–30
C for

2 days for colony growth

Immunological analyses of S cerevisiae protein phosphatase complexes and Rad53

S cerevisiae transformants expressing different 3HA-tagged protein phosphatase catalytic subunits and Psy4p⁄ YBL046w-MYC13 were grown at 26
C to a density of

107cellsÆmL)1 in selective media without histidine Yeast cells were harvested by centrifugation at 5000 g for 10 min

in a SX4750 rotor (Beckman Coulter, High Wycombe, UK), washed in an equal volume of water, and suspended in lysis buffer [50 mm Tris⁄ HCl, pH 7.5, 100 mm MgCl2, 5 mm EDTA, 0.1% (v⁄ v) 2-mercaptoethanol, 1% (v ⁄ v) Triton X-100, 1· complete protease inhibitors (Roche Diagnostics, Lewes, UK) Acid-washed glass beads (0.4 mm diameter; 0.7 gÆmL)1) were added and the cells were lysed by 20 cycles

of vortexing for 30 s followed by 30 s on ice Extracts were centrifuged in a F45-24-11 rotor (Eppendorff, Cambridge, UK) for 5 min at 14 000 g at 4
C and the supernatant was removed The glass beads were washed with one pellet volume of lysis buffer and the supernatants were pooled

A

B

Fig 5 (A) Investigation of the effects of the

cisplatin sensitivity of Saccharomyces

cere-visiae homozygous for pph3D, ybl046wD

and psy2D Serial dilutions of independent

colonies (WT 1, 2 and 3) on all plates are

from the control Y20000 (BY4743) strain.

Serial dilutions of independent colonies (MT

4, 5 and 6) are from strain Y32011 (BY4743

(BY4743 ybl046wD⁄ ybl046wD, middle

panel), and strain Y34010 (BY4743

concentration in each row of plates is

indica-ted on the right Plates were incubaindica-ted at

was repeated three times with similar

results (data not shown) (B) Comparison of

the effects of cisplatin and methyl

methane-sulphonate (MMS) on Rad53p Control strain

Y20000 (BY4743), strain Y33072 (BY4743

ybl046wD⁄ ybl046wD) and strain Y32011

in the absence and presence of 0.03%

prepared and the lysate proteins were

with antibodies to Rad53, which also

recog-nize phosphorylated Rad53 (Rad53-P).