Báo cáo khoa học: A novel inhibitor of indole-3-glycerol phosphate synthase with activity against multidrug-resistant Mycobacterium tuberculosis pptx

Abbreviations CdRP, 1-o-carboxyphenylamino-1-deoxyribulose-5¢-phosphate; CFU, colony-forming unit; DOPE, discrete optimized potential energy; IGPS, glycerol phosphate synthase; MDR-TB, m

with activity against multidrug-resistant

Mycobacterium tuberculosis

Hongbo Shen1,*, Feifei Wang1,*, Ying Zhang2, Qiang Huang1, Shengfeng Xu1, Hairong Hu1,

Jun Yue3and Honghai Wang1

1 State Key Laboratory of Genetic Engineering, School of Life Sciences, Fudan University, Shanghai, China

2 Department of Molecular Microbiology and Immunology, Bloomberg School of Public Health, Johns Hopkins University,

Baltimore, MD, USA

3 Department of Clinical Laboratory, Shanghai Pulmonary Hospital, China

Tuberculosis (TB) is the leading cause of infectious

morbidity and mortality worldwide, with nine million

new cases and two million deaths per year (http://

www.tballiance.org) Approximately two billion people are latently infected with Mycobacterium tuberculosis, comprising a critical reservoir for disease reactivation

Keywords

drug resistance; indole-3-glycerol phosphate

synthase; inhibitor; Mycobacterium

tuberculosis

Correspondence

H Wang, State Key Laboratory of Genetic

Engineering, School of Life Sciences, Fudan

University, Shanghai 200433, China

Fax: +86 21 65648376

Tel: +86 21 65643777

E-mail: hhwang@fudan.edu.cn

J Yue, Department of Clinical Laboratory,

Shanghai Pulmonary Hospital, Shanghai

200433, China

Fax: +86 21 65648376

Tel: +86 21 65643777

E-mail: yuejunnan@yahoo.com.cn

*These authors contributed equally to this

work

(Received 19 June 2008, revised 19 October

2008, accepted 28 October 2008)

doi:10.1111/j.1742-4658.2008.06763.x

Tuberculosis (TB) continues to be a major cause of morbidity and mortal-ity worldwide The increasing emergence and spread of drug-resistant TB poses a significant threat to disease control and calls for the urgent devel-opment of new drugs The tryptophan biosynthetic pathway plays an important role in the survival of Mycobacterium tuberculosis Thus, indole-3-glycerol phosphate synthase (IGPS), as an essential enzyme in this path-way, might be a potential target for anti-TB drug design In this study, we deduced the structure of IGPS of M tuberculosis H37Rv by using homol-ogy modeling On the basis of this deduced IGPS structure, screening was performed in a search for novel inhibitors, using the Maybridge database containing the structures of 60 000 compounds ATB107 was identified as

a potential binding molecule; it was tested, and shown to have antimyco-bacterial activity in vitro not only against the laboratory strain M tubercu-losis H37Rv, but also against clinical isolates of multidrug-resistant TB strains Most MDR-TB strains tested were susceptible to 1 lgÆmL)1 ATB107 ATB107 had little toxicity against THP-1 macrophage cells, which are human monocytic leukemia cells ATB107, which bound tightly

to IGPS in vitro, was found to be a potent competitive inhibitor of the sub-strate 1-(o-carboxyphenylamino)-1-deoxyribulose-5¢-phosphate, as shown

by an increased Kmvalue in the presence of ATB107 The results of site-directed mutagenesis studies indicate that ATB107 might inhibit IGPS activity by reducing the binding affinity for substrate of residues Glu168 and Asn189 These results suggest that ATB107 is a novel potent inhibitor

of IGPS, and that IGPS might be a potential target for the development

of new anti-TB drugs Further evaluation of ATB107 in animal studies is warranted

Abbreviations

CdRP, 1-(o-carboxyphenylamino)-1-deoxyribulose-5¢-phosphate; CFU, colony-forming unit; DOPE, discrete optimized potential energy; IGPS, glycerol phosphate synthase; MDR-TB, multidrug-resistant tuberculosis; MIC, minimum inhibitory concentration; mIGPS, indole-3-glycerol phosphate synthase of Mycobacterium tuberculosis; MTT, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl-tetrazolium bromide; SPR, surface plasmon resonance; TB, tuberculosis.

[1] The alarming increase in drug-resistant TB,

espe-cially multidrug-resistant TB (MDR-TB, resistant to at

least isoniazid and rifampin), poses a significant threat

to effective TB control [2] Therefore, there is an

urgent need to develop novel drugs for the treatment

of TB, especially MDR-TB (http://www.who.int/gtb)

It was reported that auxotrophs of M tuberculosis

that are knocked out in the leucine, proline and

tryp-tophan biosynthetic pathways show attenuation in

their ability to infect mice [3,4] This indicates that

these amino acids might be unavailable for uptake by

the bacterium in vivo [5] The attenuation of virulence

is especially marked in the tryptophan auxotrophic

trpD knockout strain, which is essentially avirulent,

even in immunodeficient mice [4] This suggests that

the tryptophan biosynthetic pathway might play

an important role in the survival of M tuberculosis

in vitro and in vivo Additionally, tryptophan is not

synthesized by mammals, making enzymes from this

biosynthetic pathway viable targets for new anti-TB

drugs [5] Indole-3-glycerol phosphate synthase (IGPS)

catalyzes the fourth step in this biosynthetic pathway,

the indole ring-closure reaction, in which the substrate

1-(o-carboxyphenylamino)-1-deoxyribulose-5¢-phospha-te (CdRP) is conver1-(o-carboxyphenylamino)-1-deoxyribulose-5¢-phospha-ted to the product indole 3-glycerol

phosphate (IGP) [6] The trpC gene, encoding IGPS,

was demonstrated to be essential for the growth of

M tuberculosis in vitro by inactivation by transposon

mutagenesis [7] In addition, there is no homolog of

IGPS in humans [8] Thus, IGPS of M tuberculosis

(mIGPS) could be a good drug target for the design of

new anti-TB agents

Virtual high-throughput in silico screening is an

important tool in drug discovery [9] It aims to

identify chemical ligands that bind strongly to key

regions of important enzymes Consequently,

identi-fied ligands may provide excellent inhibition of

enzyme activities Several drugs discovered using this

approach have been tested clinically [10–12] In this

study, we have identified a high-affinity inhibitor,

ATB107, of mIGPS, using the virtual screening approach The inhibitor was found to be a competi-tive inhibitor of mIGPS, as it reduced the binding affinity for substrate to residues required for enzyme activity and effectively inhibited the growth of not only the virulent M tuberculosis H37Rv labora-tory strain but also of drug-resistant clinical isolates

in vitro The inhibitory effect of ATB107 could not be reversed by the addition of tryptophan, as it might affect not only the biosynthesis of tryptophan but also other essential pathways

Results and Discussion

Homology modeling of mIGPS structure IGPS is a key enzyme in the tryptophan biosynthetic pathway, which is widely present in bacteria [13] There has been significant interest in its structure [14] More than 20 crystal structures of bacterial IGPS have been determined (http://www.rcsb.org) [15] Six possi-ble templates (Protein Data Bank codes: 1A53, 1H5Y, 1I4N, 1JCM, 1PII and 1VC4) for homology modeling were identified through a homology search The struc-ture of 1VC4 was selected as the template, because of the highest sequence identity of 45.6% Furthermore, sequence alignment analysis (Fig 1) revealed a higher sequence similarity of 55.43% between the 1VC4 and mIGPS sequences Using homology modeling, five models, M1, M2, M3, M4 and M5, for mIGPS were obtained, and their modeller objective function [16] values were 1633.37, 1745.01, 1681.45, 1650.79 and 1611.09, respectively The last value is the lowest one, which means that M5 is the ‘best’ model Furthermore, the discrete optimized potential energy (DOPE) score [17] profile of M5 (Fig 2A) is very similar to that of the template (Fig 2B), which also indicates that M5 is

a reasonable model Figure 2C shows that the mIGPS structure (M5) has one typical (b⁄ a)8-barrel structure, which is the most common enzyme fold in nature [18]

Fig 1 Amino acid sequence alignment of

IGPS from M tuberculosis H37Rv and that

from Thermus thermophilus reveals high

sequence similarity (55.43%) The

second-ary structures of T thermophilus IGPS are

shown under the sequences The a-helices

are shown as red helices, and the b-sheets

as blue arrows The sequence alignment

was performed using BIOEDIT software [39].

Virtual selection of mIGPS inhibitors

To obtain a more reasonable structure, we performed

nanosecond timescale molecular dynamics simulations

for the structure of M5 The plots of potential energy

fluctuation (Fig 3A) and protein backbone rmsd (Fig 3B) from simulations show that the structure was equilibrated after 1 ns of simulation Thus, we selected the last 9 ns simulation results to obtain an average structure using the g_rmsf program of gromacs The equilibrated structure of mIGPS was used in the virtual selection of inhibitors, using the autodock approach The docking dummy center was arranged in the middle of the barrel composed of C-termini of b-sheets The radius of the docking region was 22.5 A˚, and it was beyond the width of the cavity in mIGPS, which was about 15–18 A˚ This ensured that the ligands could reach the mIGPS catalytic cavity during the docking process Figure 4A shows that the ligands with low docking energy values mostly bound in the region surrounded by the ba-loops One hundred ligands with the lowest docking energy values were selected from the 60 000 ligands, and 50 of them were purchased and used in further evaluation of their antimycobacterial activities

Antimycobacterial activities of the selected ligands in vitro

We first evaluated the antibacterial activity of 50 ligands against M tuberculosis H37Ra, which is a

A

B

C

Fig 2 Structure of IGPS The DOPE score profile of M5 (A) is

highly similar to that of the template (B), which confirms that M5 is

a reasonable model The structure (C) of IGPS from M tuberculosis

H37Rv (M5) has one typical (b ⁄ a) 8 -barrel structure.

Fig 3 Plots of the potential energy fluctuation (A) and protein backbone rmsd (B) in mIGPS molecular dynamics simulations The results showed that the structure was equilibrated after 1 ns of simulation Thus, the last 9 ns simulation results were selected to obtain an average structure of mIGPS using the G_RMSF program of

GROMACS

highly attenuated M tuberculosis strain [19] The

mini-mum inhibitory concentration (MIC) of ATB107

(Fig 4B) is 0.1 lgÆmL)1 for M tuberculosis H37Ra

and also vaccine strain BCG (Table 1) ATB107 is a

nitrogen heterocyclic ligand fused with polycyclic rings

Its molecular formula is C21H28N8, its chemical name

is

1-azabicyclo[2.2.2]octan-3-one[4-(phenylamino)-6-(1-piperidinyl)-1,3,5-triazin-2-yl]hydrazone, and its

molec-ular mass is 392.5 Da There are four hydrogen bond

donors, eight acceptors, and six rotatable bonds, and

its xlogP (partition coefficient in octanol⁄ water) is 4.46

(http://www.maybridge.com) This suggests that the ligand obeys Lipinski’s ‘rule of five’ [20]

ATB107 also had high activity against M tuberculosis H37Rv, with an MIC of 0.1 lgÆmL)1 (Table 1) Using the BACTEC culture system, we observed inhibition of bacterial growth when clinical isolates of M tuberculo-siswere exposed to two concentrations of ATB107 All

50 fully susceptible clinical isolates tested were suscep-tible to ATB107 at 1 lgÆmL)1; of these, 41(82%) were susceptible to ATB107 at 0.1 lgÆmL)1(Table 2) Using the same approach, we evaluated the activity of ATB107 against 80 clinical MDR-TB isolates The results showed that 67 (83.8%) MDR-TB isolates were susceptible to ATB107 at 1 lgÆmL)1, and 25 (31.3%) isolates were susceptible to ATB107 at 0.1 lgÆmL)1 (Table 2)

Interaction of ATB107 with mIGPS

We performed a surface plasmon resonance (SPR) analysis to identify the interaction of ATB107 with mIGPS Kinetic analysis of the binding interaction between ATB107 and mIGPS (Fig 5) showed that the binding ability of ATB107 was well correlated with its concentrations The equilibrium dissociation contant

Fig 4 Ligands with low docking energy values binding to the

region surrounded by the ba-loops of mIGPS (A) The deep yellow

ball is the dummy center of the docking region The colored

mole-cules are the ligands The most effective ligand, ATB107 (B), is a

nitrogen heterocyclic ligand fused with polycyclic rings.

Table 1 MICs of ATB107 for different M tuberculosis strains Bacteria (105CFUÆmL)1) were inoculated in Middlebrook 7H9 broth with OADC ATB107 was added to obtain concentrations ranging from 0.01 to 200 lgÆmL)1 After 3 weeks of incubation, the cul-tures were diluted and plated on agar plates for CFU determination The MIC was defined as the lowest concentration that inhibited 99% of growth The tests were repeated three times for each strain.

Mycobacterial species No strains MIC (lgÆmL)1)

Table 2 Susceptibility of M tuberculosis clinical isolates to ATB107 measured by the BACTEC radiometric system The tests were repeated twice for each strain.

M tuberculosis strains

Total number

of strains

No (%) strains inhibited by 1.0 lgÆmL)1

No (%) strains inhibited by 0.1 lgÆmL)1

M tuberculosis, fully susceptible clinical isolates

MDR-TB strains (resistant to at least isoniazid and rifampin)

(kD) was 3· 10)3m These results indicate that

ATB107 can bind tightly to mIGPS in vitro

To elucidate the effect of ATB107 binding on

enzyme activity, we tested the catalytic activity of

mIGPS in the presence of this ligand A plot of the

ligand concentrations against mIGPS activity (Fig 6A)

showed that the activity decreased significantly with

increase in ligand concentration The 50% inhibitory

concentration was about 0.41 lm The results indicate

that binding of ATB107 reduces the catalytic activity

of mIGPS, and that ATB107 is a high-affinity

inhi-bitor of mIGPS

Mechanism of inhibition by ATB107

To identify whether ATB107 is a competitive or

non-competitive inhibitor, we tested the effect of inhibitor

on the Michaelis constant Km of the substrate CdRP

Inhibitors were added to the reaction solutions to

achieve concentrations of 0.2 and 2 lm, respectively A

plot of reciprocal velocity versus reciprocal substrate

concentration (Fig 6B) showed that the inhibitor

increased the Km, and that the Kmincrease was

corre-lated with higher concentrations of inhibitors It is

concluded that ATB107 might be a competitive

inhibi-tor of mIGPS

In order to ascertain the mechanism by which

ATB107 inhibits the catalytic activity of mIGPS, we

mutated the residues close to the ATB107-binding sites

in mIGPS (Fig 7A) and tested the enzyme activities of

these mutants There are 11 residues surrounding

ATB107 within a distance of 5 A˚ Ten of them were

mutated to alanine, with a methyl group side chain,

except for Ala190 The enzyme activities of mutants were assayed under the same conditions The results (Table 3) demonstrate that mutations of Glu168 and Asn189 greatly affected the activities of the enzymes and increased the Km values 19-fold and 18-fold, respectively These results suggest that the above resi-dues might play an important role in the catalytic pro-cess of mIGPS and may be related to the inhibition mechanism of ATB107

To investigate the role of these residues in the inhib-itory effect of ATB107, we compared the binding sites

of CdRP and of ATB107 The substrate-binding sites were also calculated using autodock software The results showed that eight of the 11 residues surround-ing ATB107 (yellow) within 5 A˚ in mIGPS (Fig 7A) are the same as eight of the 14 residues surrounding the substrate (red) within 5 A˚ (Fig 7B) This suggests that CdRP might bind to a similar region as the inhib-itor Structure superposition results (Fig 7C) con-firmed this conclusion Therefore, these results suggest that the inhibitor competes with substrate in binding

150

100

50

0

–50

–100

50 60 70 80 90 100 110 120 130

a b c d e f

140 150 160 Time (s)

Fig 5 Kinetic analysis of ATB107 binding to mIGPS by SPR

tech-nology using BIAcore 3000 The results show that the binding

abil-ity of ATB107 is well correlated with its concentrations, which

means that ATB107 binds well to mIGPS in vitro Representative

sensorgrams obtained from injection of ATB107 at concentrations

of: (A) 0.50 · 10)5M ; (B) 0.25 · 10)5M ; (C) 0.13 · 10)5M ; (D)

0.31 · 10)6M ; (E) 0.78 · 10)7M ; (F) 0.39 · 10)7M

Fig 6 Effect of ATB107 binding on mIGPS activity ATB107 inhib-ited mIGPS enzyme activity (A), and the catalytic activity of mIGPS decreased significantly with the increase in ATB107 concentrations The results of reciprocal velocity plotted versus reciprocal substrate concentration (r, no inhibitor; , 0.2 l M inhibitor; , 2.0 l M inhibi-tor) (B) demonstrated that ATB107 increased the K m value of sub-strate, and that the increase in K m value correlated with larger amounts of inhibitor.

to mIGPS, which is consistent with the conclusion that

ATB107 is a competitive inhibitor of the enzyme

Among the residues surrounding CdRP within 5 A˚ in

mIGPS (Fig 7B), there are four hydrogen bonds

between the substrate and these residues, including two

bonds formed with the atoms in the backbone and

another two bonds formed with side chains of Glu168

and Asn189 Interestingly, they are the residues that

have been shown to play an important role in the

cata-lytic process of mIGPS by site-directed mutagenesis

Thus, we conclude that ATB107 is a substrate

compet-itive inhibitor, and that it inhibits mIGPS catalytic

activity through reducing the binding affinity for

substrate of Glu168 and Asn189

Evaluation of the cytotoxicity of ATB107

To determine the cytotoxicity of ATB107, we

exam-ined its effect on the proliferation of THP-1

macro-phage cells The important first-line TB drugs isoniazid

and ethambutol were included as controls in the

exper-iments The results (Fig 8) showed that at the highest

concentration of 200 lgÆmL)1, the drugs and ATB107

could inhibit cell proliferation, with cell survival of

about 60% With the lower concentration of

50 lgÆmL)1, cell survival was more than 80% for

ATB107 and both isoniazid and ethambutol These

results indicate there is no obvious difference in

cyto-toxicity between ATB107 and isoniazid and

ethambu-tol Thus, ATB107 did not have obvious cytotoxicity

Effect of tryptophan on inhibition of activity of

ATB107 against M tuberculosis strains

To identify whether the inhibitory effect of ATB107

could be reversed by the addition of tryptophan, we

evaluated the inhibitory effect of ATB107 against

M tuberculosisH37Ra strains in the presence of

trypto-phan The results (Fig 9) showed that tryptophan

inhibited the growth of M tuberculosis H37Ra at high

concentrations, even without ATB107 The numbers

of bacteria decreased significantly with increases in

tryp-tophan concentrations, and there were few bacteria in

Fig 7 Comparison between the binding region of ATB107 and that

of CdRP in the mIGPS structure (A) Residues surrounding ATB107

(yellow) within 5 A ˚ in mIGPS (B) Residues surrounding substrate

(yellow) within 5 A ˚ in mIGPS Dashed lines (green) represent the

hydrogen bonds The comparison result revealed that eight

(num-bering in red) of the 11 residues surrounding ATB107 within 5 A ˚ in

mIGPS (A) were also included in the 14 residues surrounding

sub-strate within 5 A ˚ (B) (C) Binding regions of substrate (red) and

ATB107 (yellow) in mIGPS.

the medium when the tryptophan concentration was

more than 5% The results also showed that there was

no obvious difference among the inhibitory effects of

ATB107 against M tuberculosis H37Ra in media with different concentrations of tryptophan These results suggest that IGPS’s role in M tuberculosis might not be confined to tryptophan synthesis, or that ATB107 might affect not only the biosynthesis of tryptophan but also other essential pathways Further studies are needed to determine the mechanism of action of ATB107

Conclusion

In conclusion, through the combination of computa-tional prescreening and biological studies, we identified ATB107 as a high-affinity inhibitor of mIGPS ATB107 was found to be highly active against

M tuberculosis, including MDR-TB clinical isolates with MICs of 0.1–1 lgÆmL)1 mIGPS represents a novel drug target that is different from those of exist-ing TB drugs Enzymology and site-directed mutagene-sis studies have identified Glu168 and Asn189 as key residues affecting enzyme activity Further evaluation

of ATB107 in vivo in animal models in terms of toxic-ity, pharmacology and activity against M tuberculosis

is warranted

Experimental procedures

Homology modeling The 3D structure of mIGPS was generated by homology modeling using modeller 8.0 software [21] The mIGPS amino acid sequence (GI:15608749) was put into the PIR format that is readable by modeller Subsequently, a search for potentially related sequences of known structures was performed by the profile.build() command of model-ler, using default parameters We assessed the structural and sequence similarities between the possible templates to select the most appropriate template for the query sequence over other similar structures We finally picked the A-chain

of 1VC4 as a template, because of its better crystallogophic resolution (1.8 A˚) and higher overall sequence identity to the query sequence (45.6%) Then, the query sequence was aligned with the template, and the model was constructed and evaluated

Table 3 K m values of wild-type and mutant enzymes for the substrate CdRP ND, not determined.

K m (mutant) ⁄ K m

K m (mutant) ⁄ K m (wild-type)

Fig 8 Effect of ATB107 on the growth of THP-1 macrophages.

The effect was detected with the MTT method The results

sug-gest that ATB107 is not very toxic and has a similar toxicity pattern

to the first-line TB drugs The tests were repeated five times INH,

isoniazid; ETH, ethambutol.

Fig 9 Effect of tryptophan on the growth of M tuberculosis

strains in culture media with ATB107 Bacteria (105CFUÆmL)1)

were inoculated in Middlebrook 7H9 broth with OADC ATB107 at

three concentrations (0 · MIC, 1 · MIC and 0.1 · MIC; MIC is

0.1 lgÆmL)1) was added to the culture media with tryptophan at six

concentrations After 3 weeks of incubation, the cultures were

diluted and plated on agar plates for CFU determination The results

show that tryptophan at high concentrations had definite inhibitory

activity against M tuberculosis but did not antagonize the activity

of ATB107 The tests were repeated three times.

Molecular dynamics simulations

Nanosecond timescale molecular dynamics simulation with

explicit solvent representation was performed with the

gromacssuite of programs (Version 3.3) [22,23], using the

all-hydrogen force fields OPLS-AA [24] A simulation

sys-tem was built for mIGPS The mIGPS was solvated with

TIP4P [25] water molecules in a rectangular box, with the

thickness of the water layer between the protein and the

closest box boundary being 1.5 nm Counterpart ions were

placed into the box to make the system neutral The

simu-lation was performed using an ensemble of constant

num-ber of molecules, pressure, and temperature (N–P–T

ensemble), with the pressure P = 1 bar and the

tempera-ture T = 300 K The Berendsen temperatempera-ture coupling

method [26] was used, with a constant coupling of 0.1 ps

The cutoff distance for van der Waals forces was 1.0 nm

Electrostatic forces were treated with the particle mesh

Ewald method [27] The lincs algorithm [28] was used to

constrain the bonds containing hydrogen The simulation

was run under periodical boundary conditions, using a time

step of 2 fs The period for each simulation run was 10 ns

The simulation was completed on the Lenovo Shenteng1800

computer with 32 Intel 2.8 GHz Xeon CPUs in the State

Key Laboratory of Genetic Engineering, Fudan University

Molecular graphics were created using the programs pymol

(http://pymol.sourceforge.net) and vmd [29]

Docking studies

Protein–ligand docking simulations were carried out using

the software autodock 3.0.5 [30], which combines a rapid

energy evaluation through precalculated grids of affinity

potentials with a variety of search algorithms to find suitable

binding positions for a ligand on a given macromolecule The

3D structure of mIGPS was built by homology modeling

Polar hydrogens were added to the macromolecule, and

par-tial charges were assigned to the macromolecule using

auto-docktools[31] The ligands from the Maybridge database

were transformed using a modified autodocktools program

(written by Q Huang) to 3D structures, adding partial

atomic charges for each atom, and defining the rigid root and

rotatable bonds for each ligand automatically The 3D

struc-ture and parameters of CdRP were generated by the program

prodrg

(http://davapcl.bioch.dundee.ac.uk/programs/prod-rg) [32] Mass-centered grid maps were generated with the

default 0.375 A˚ spacing by the autogrid program for the

whole protein target The sigmoidal distance-dependent

dielectric permittivity of Mehler and Solmajer [33] was used

for the calculation of the electrostatic grid maps The

Lamarckian genetic algorithm [31] and the pseudo-Solis and

Wets methods were applied for minimization, using default

parameters Random starting positions on the entire protein

surface, random orientations and torsions (flexible ligands

only) were used for the ligands

Mycobacterial strains and culture conditions

M tuberculosisH37Rv, M tuberculosis H37Ra and clinical isolates of M tuberculosis were provided by Shanghai Pul-monary Hospital of China M tuberculosis and Mycobacte-rium bovis BCG strains were grown in Middlebrook 7H9 broth and on Middlebrook 7H10 agar supplemented with 10% oleic acid⁄ albumin ⁄ dextrose ⁄ catalase-enriched Middle-brook (OADC) The other plasmids and strains used in this study were purchased from Novagen (Madison, WI, USA)

Effect of ligands on inhibition of bacterial growth

in vitro Stock solutions of 5 mgÆmL)1 for each ligand were pre-pared in sterile dimethylsulfoxide Appropriate dilutions for each ligand were added to 1 mL cultures to obtain concen-trations ranging from 0.01 to 200 lgÆmL)1 The bacteria were inoculated at about 105colony-forming units (CFUs)⁄ mL After incubation at 37 C for 3 weeks, the cul-tures were diluted and plated on agar plates for CFU deter-mination The MIC was defined as the lowest concentration inhibiting 99% of growth

The radiometric BACTEC 460 method [34] (Becton Dickinson, Sparks, MD, USA) was used to determine sus-ceptibility to 0.1 lgÆmL)1and 1.0 lgÆmL)1 ATB107 for 50 clinical isolates of drug-sensitive and 80 clinical isolates of MDR-TB (resistant to at least isoniazid and rifampin)

M tuberculosis, with M tuberculosis H37Rv as a control

Effect of ATB107 on mIGPS activity in vitro The concentration of mIGPS was determined with the Bradford method, using the kit from Bio-Rad (Hercules,

CA, USA) [35] The substrate CdRP was chemically synthe-sized, with a yield of 30 mm [36] Ten microliters of 30 mm CdRP and 10 lL of 1.24 lm IGPS were added to 480 lL

of 5 mm Tris⁄ HCl (pH 7.0), and incubated at 37 C for

20 min The enzyme activity was measured with a spectro-photometer by following the increase in absorbance of the solution at 280 nm [37,38] ATB107 was added to the assay mixture to obtain concentrations of 10)4m, 7.5· 10)5m,

5· 10)5m, 2.5· 10)5m, and 10)5m, respectively The 50% inhibitory concentration (IC50) of ATB107 was calcu-lated from the equation fitted by the curve of enzyme activ-ity versus ATB107 concentration

SPR analysis The interaction of mIGPS and ATB107 was investigated through SPR analysis, using a BIAcore 3000 instrument with software version 4.0 and Sensor Chip CM5 (carbo-xymethylated dextran surface) mIGPS was directly immo-bilized to the preactivated chip surface via amine groups

The concentrations of ATB107 were 0.50· 10)5m,

0.25· 10)5m, 0.13· 10)5m, 0.31· 10)6m, 0.78· 10)7m,

and 0.39· 10)7m All assays were carried out at 25C

Site-directed mutagenesis

Residues surrounding ATB107 within 5 A˚ distance in

mIGPS were mutated Site-directed mutagenesis was carried

out according to the protocol described in the QuikChange

Site-Directed Mutagenesis Kit (Catalog #200518;

Strata-gene, Cedar Creek, TX, USA) The primers for site-directed

mutagenesis are listed in Table 4 The wild-type trpC

gene-encoding plasmid was constructed as previously described

[8] This plasmid was used as the template in the

construc-tion of the mutant IGPS plasmids The plasmids were

puri-fied and transformed into Escherichia coli strain BL21

(DE3) for expression of IGPS proteins The conditions for

protein purification and enzyme assay were as described

previously [8]

Cell proliferation assay

The tetrazolium dye reduction assay

[3-[4,5-dim-ethylthiazol-2-yl]-2,5-diphenyl-tetrazolium bromide (MTT);

Sigma-Aldrich, USA] was used to determine the effect of

ATB107 on cell survival and growth At first, the THP-1

macrophage cells were inoculated at 8· 104cellsÆmL)1

into 96-well plates and incubated at 37C in a 5%

CO2⁄ 95% air atmosphere for 24 h ATB107, isoniazid and

ethambutol were each added to give concentrations of 50,

100, 150 and 200 lgÆmL)1 After incubation of cells trea-ted with compounds for 12 h, 20 lL (5 gÆL)1) of MTT solution was added to each well; this was followed by incubation for another 4 h to allow the formation of for-mazan crystals Finally, 10% SDS was added to dissolve the formazan crystals, and the plates were read on a Dy-natech MR600microplate reader at 570 nm Controls were included in which only culture media were added to wells containing cells

Effect of tryptophan on activity of ATB107

M tuberculosis H37Ra was cultured in Middlebrook 7H9 broth with 10% OADC containing ATB107 at three concen-trations (0· MIC, 1 · MIC and 0.1 · MIC; MIC is 0.1 lgÆmL)1) Tryptophan was added to the media to give concentrations of 10%, 5%, 2.5%, 1%, and 0.5% After incubation for 3 weeks, the cultures were diluted to different extents and plated on Middlebrook 7H10 agar with 10% OADC The CFUs were counted after another 2–3 weeks

Acknowledgements

This work was supported by the National Natural Science Foundation of China (30670109), the China Postdoctoral Scientific Program (20060390605), and the National Basic Research Program of China (973 Program) (2009CB918604)

References

1 Keshavjee S & Becerra MC (2000) Disintegrating health services and resurgent tuberculosis in post-soviet Tajiki-stan: an example of structural violence JAMA 283, 1201

2 Lenaerts A, Degroote M & Orme I (2008) Preclinical testing of new drugs for tuberculosis: current challenges Trends Microbiol 16, 48–54

3 Hondalus MK, Bardarov S, Russell R, Chan J, William

R, Jacobs J & Bloom BR (2000) Attenuation of and protection induced by a leucine auxotroph of Mycobac-terium tuberculosis Infect Immun 68, 2888–2898

4 Smith DA, Parish T, Stoker NG & Bancroft GJ (2001) Characterization of auxotrophic mutants of Mycobacte-rium tuberculosisand their potential as vaccine candi-dates Infect Immun 69, 1142–1150

5 Lee CE, Goodfellow C, Javid-Majd F, Baker EN & Lott

JS (2006) The crystal structure of TrpD, a metabolic enzyme essential for lung colonization by Mycobacterium tuberculosis, in complex with its substrate phosphoribo-sylpyrophosphate J Mol Biol 355, 784–797

6 Creighton TE & Yanofsky C (1966) Indole-3-glycerol phosphate synthetase of Escherichia coli, an enzyme of the tryptophan operon J Biol Chem 241, 4616–4624

Table 4 Primers used in site-directed mutagenesis studies.

Changes in DNA sequences are expected to change the amino

acids to alanine.

Mutation type Mutagenic primers (5¢- to 3¢)

Arg191 fi Ala Up: GCGTTAACGCCCGGCACCTCATGACG

7 Sassetti CM, Boyd DH & Rubin EJ (2003) Genes

required for mycobacterial growth defined by high

density mutagenesis Mol Microbiol 48, 77–84

8 Yang Y, Zhang M, Zhang H, Lei J, Jin R, Xu S, Bao J,

Zhang L & Wang H (2006) Purification and

characteriza-tion of Mycobacterium tuberculosis indole-3-glycerol

phosphate synthase Biochemistry (Moscow) 71, S38–

S43

9 Amzel L (1998) Structure-based drug design Curr Opin

Biotechnol 9, 366–369

10 Greer J, Erickson J, Baldwin J & Varney M (1994)

Application of the three-dimensional structures of

protein target molecules in structure-based drug design

J Med Chem 37, 1035–1054

11 Hilpert K, Ackermann J, Banner DW, Gast A,

Guber-nator K, Hadva´ry P, Labler L, Mu¨ller K, Schmid G &

Tschopp TB (1994) Design and synthesis of potent and

highly selective thrombin inhibitors J Med Chem 37,

3889–3901

12 Varghese J, Smith P, Sollis SL, Blick TJ, Sahasrabudhe

A, McKimm-Breschkin JL & Colman PM (1998) Drug

design against a shifting target: a structural basis for

resistance to inhibitors in a variant of influenza virus

neuraminidase Structure 6, 735–746

13 Ely B & Pittard J (1979) Aromatic amino acid

biosynthesis: regulation of shikimate kinase in

Escherichia coliK-12 J Bacteriol 138, 933–943

14 Hennig M, Darimont BD, Jansonius JN & Kirschner K

(2002) The catalytic mechanism of indole-3-glycerol

phosphate synthase: crystal structures of complexes of

the enzyme from Sulfolobus solfataricus with substrate

analogue, substrate, and product J Mol Biol 319, 757–

766

15 Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat

TN, Weissig H, Shindyalov IN & Bourne PE (2000)

The protein data bank Nucleic Acids Res 28, 235–242

16 Braun W & Go˜ N (1985) Calculation of protein

conformations by proton–proton distance constraints: a

new efficient algorithm J Mol Biol 186, 611–626

17 Eramian D, Shen MY, Devos D, Melo F, Sali A &

Marti-Renom MA (2006) A composite score for

pre-dicting errors in protein structure models Protein Sci

15, 1653–1666

18 Gerlt J & Raushel F (2003) Evolution of function in

(alpha⁄ beta)8-barrel Enzymes 7, 252–264

19 Soto CY, Andreu N, Gibert I & Luquin M (2002)

Simple and rapid differentiation of Mycobacterium

tuberculosis H37Ra from M tuberculosis clinical

isolates through two cytochemical tests using neutral

red and nile blue stains J Clin Microbiol 40, 3021–

3024

20 Lipinski C, Lombardo F, Dominy B & Feeney P (2001)

Experimental and computational approaches to estimate

solubility and permeability in drug discovery and

devel-opment settings Adv Drug Deliv Rev 46, 3–26

21 Marti-Renom MA, Stuart A, Fiser A, Sa´nchez R, Melo

F & Sali A (2000) Comparative protein structure mod-eling of genes and genomes Annu Rev Biophys Biomol Struct 29, 291–325

22 Spoel DVD, Lindahl E, Hess B, Groenhof G, Mark AE

& Berendsen HJC (2005) GROMACS: fast, flexible and free J Comp Chem 26, 1701–1718

23 Lindahl E, Hess B & Spoel DVD (2001) GRO-MACS 3.0: a package for molecular simulation and trajectory analysis J Mol Mod 7, 306–317

24 Jorgensen WL (1998) OPLS force field In The Encyclo-pedia of Computational Chemistry(Schleyer PVR, ed.),

pp 1986–1989 Wiley, New York

25 Jorgensen WL & Madura JD (1985) Temperature and size dependence for Monte Carlo simulations of TIP4P water Mol Phys 56, 1381–1392

26 Berendsen HJC, Postma JPM, van Gunsteren WF, DiNola A & Haak JR (1984) Molecular dynamics with coupling to an external bath J Chem Phys 81, 3684– 3690

27 Essmann U, Perera L, Berkowitz ML, Darden T, Lee

H & Pedersen LG (1995) A smooth particle mesh Ewald method J Chem Phys 103, 8577–8593

28 Hess B, Bekker H, Berendsen H & Fraaije J (1997) LINCS: a linear constraint solver for molecular simula-tions J Comp Chem 18, 1463–1472

29 Humphrey W, Dalke A & Schulten K (1996) VMD – visual molecular dynamics J Mol Graphics 14, 33–38

30 Goodsell DS & Olson AJ (1990) Automated docking of substrates to proteins by simulated annealing Proteins

8, 195–202

31 Morris GM, Goodsell DS, Halliday RS, Huey R, Hart

WE, Belew RK & Olson AJ (1998) Automated docking using a Lamarckian genetic algorithm and an empirical binding free energy function J Comput Chem 19, 1639– 1662

32 Aalten DMF, Bywater R, Findlay JBC, Hendlich M, Hooft RWW & Vriend G (1996) PRODRG, a program for generating molecular topologies and unique molecu-lar descriptors from coordinates of small molecules

J Comput Aided Mol Des 10, 255–262

33 Mehler EL & Solmajer T (1991) Eletrostatic effects in proteins: comparison of dielectric and charge models Protein Eng 4, 903–910

34 Siddiqi SH, Libonati JP & Middlebrook G (1981) Eval-uation of rapid radiometric method for drug susceptibil-ity testing of Mycobacterium tuberculosis J Clin Microbiol 13, 908–912

35 Bradford MM, McRorie RA & Williams WL (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle

of protein-dye binding Anal Biochem 72, 248–254

36 Kirschner K, Szadkowski H, Jardetzky TS & Hager V (1987) Phosphoribosylanthranilate