Báo cáo khoa học: Differential recognition of heat shock elements by members of the heat shock transcription factor family ppt

Human HSF1, a stress-activated regulator, preferentially bound to contin-uous HSEs rather than discontincontin-uous HSEs, and heat shock of HeLa cells caused expression of reporter genes

members of the heat shock transcription factor family

Noritaka Yamamoto1, Yukiko Takemori1, Mayumi Sakurai2, Kazuhisa Sugiyama2

and Hiroshi Sakurai1

1 Department of Clinical Laboratory Science, Kanazawa University Graduate School of Medical Science, Japan

2 Department of Ophthalmology and Visual Science, Kanazawa University Graduate School of Medical Science, Japan

Heat shock transcription factor (HSF), a protein that

is evolutionarily conserved from yeast to humans, is a

major regulator of heat shock protein (HSP)

expres-sion Many HSPs function as molecular chaperones

that aid the folding of damaged proteins, and

increased accumulation of HSPs is essential for

sur-vival of cells exposed to protein-damaging stresses,

including heat shock The structure of HSF comprises

a conserved DNA-binding domain (DBD), which

binds to the 5 bp sequence nGAAn, and two

hydro-phobic repeat (HR) regions (HR-A and HR-B), which

are necessary for homotrimer formation Trimeric

HSF recognizes a heat shock element (HSE) compris-ing at least three inverted repeats of the 5 bp unit [1,2]

Biochemical and genetic evidence indicates that HSF regulates the expression of genes encoding proteins involved not only in stress resistance but also in cell maintenance and developmental processes [3–5] Saccharomyces cerevisiae HSF (yHSF) is encoded by a single gene and is essential for cell viability even under normal physiological conditions yHSF target genes encode proteins that function in protein folding, protein degradation, detoxification, energy generation,

Keywords

crystallin; heat shock element; heat shock

protein; heat shock response; heat shock

transcription factor

Correspondence

H Sakurai, Department of Clinical

Laboratory Science, Kanazawa University

Graduate School of Medical Science,

5-11-80 Kodatsuno, Kanazawa, Ishikawa

920-0942, Japan

Fax: +81 76 234 4369

Tel: +81 76 265 2588

E-mail: sakurai@kenroku.kanazawa-u.ac.jp

(Received 5 November 2008, revised 14

January 2009, accepted 21 January 2009)

doi:10.1111/j.1742-4658.2009.06923.x

Heat shock transcription factor (HSF), an evolutionarily conserved stress response regulator, forms trimers and binds to heat shock element (HSE), comprising at least three continuous inverted repeats of the sequence 5¢-nGAAn-3¢ The single HSF of yeast is also able to bind discontinuously arranged nGAAn units We investigated interactions between three human HSFs and various HSE types in vitro, in yeast cells, and in HeLa cells Human HSF1, a stress-activated regulator, preferentially bound to contin-uous HSEs rather than discontincontin-uous HSEs, and heat shock of HeLa cells caused expression of reporter genes containing continuous HSEs HSF2, whose function is implicated in neuronal specification and spermatogenesis, exhibited a slightly higher binding affinity to discontinuous HSEs than did HSF1 HSF4, a protein required for ocular lens development, efficiently recognized discontinuous HSEs in a trimerization-dependent manner Among four human c-crystallin genes encoding structural proteins of the lens, heat-induced HSF1 preferred HSEs on the cA-crystallin and cB-crys-tallin promoters, whereas HSF4 preferred HSE on the cC-crystallin promoter These results suggest that the HSE architecture is an important determinant of which HSF members regulate genes in diverse cellular processes

Abbreviations

DBD, DNA-binding domain; EGS, ethylene glycol bis-(succinimidylsuccinate); hHSF, human heat shock transcription factor; HR, hydrophobic repeat; HSE, heat shock element; HSF, heat shock transcription factor; HSP, heat shock protein; mHSF, mouse heat shock transcription factor; SD, standard deviation; yHSF, Saccharomyces cerevisiae heat shock transcription factor.

carbohydrate metabolism, and maintenance of cell

integrity [6–8] yHSF binds to and regulates gene

expression via HSEs comprising variously arranged

nGAAn units: a continuous perfect-type HSE,

con-sisting of consecutive inverted repeats of the nGAAn

unit (nTTCnnGAAnnTTCn); and a discontinuous

gap-type or step-type HSE, which contains one

insertion [nTTCnnGAAn(5 bp)nGAAn] or two

inser-tions [nTTCn(5 bp)nTTCn(5 bp)nTTCn], respectively,

between the nGAAn units [9,10]

Schizosaccharo-myces pombe HSF is also able to recognize these

various HSE types [10]

In mammalian cells, three related HSF proteins,

HSF1, HSF2, and HSF4, are involved in different,

but in some cases similar, biological functions HSF1

is ubiquitously expressed and functions as a key

regu-lator for stress-induced transcription of HSP genes

and for acquisition of thermotolerance [1,2,11]

Analy-sis of HSF1 knockout mice indicates the involvement

of HSF1 in extraembryonic development,

carcinogene-sis, and circadian control [12–14] HSF2 is widely

expressed, and binds constitutively to the promoters

of HSP genes to modulate their expression [15]

Dur-ing development, HSF2 is important for neuronal

specification and spermatogenesis [16–18] Expression

of HSF4 is restricted to the brain and lung, and is

required for ocular lens development and fiber cell

dif-ferentiation [19–22] There are two HSF4 isoforms, a

and b HSF4b possesses a relatively weak activation

domain and activates transcription, whereas this

region is absent in HSF4a, which functions as a

repressor [23–25] HSF1, HSF2 and HSF4 share

sig-nificantly conserved DBDs, but they exhibit slightly

different specificities for HSE binding in vitro

[19,26,27]

When human HSF (hHSF)1 is expressed in

yHSF-deficient S cerevisiae cells, it fails to substitute for the

cell viability function of yHSF, because its trimer

for-mation is inhibited at normal growth temperatures

[28] Mutant forms of hHSF1 that can trimerize in the

absence of stress are able to substitute for yHSF cell

viability function [10,28] In these cells, however,

hHSF1 derivatives are defective in binding and

activat-ing transcription via discontinuous gap-type and

step-type HSEs, indicating that hHSF1 recognizes HSEs in

a different way from yHSF [10] In this study, we

ana-lyzed in vitro binding of hHSF1, hHSF2 and hHSF4

to various HSE types and characterized S cerevisiae

and HeLa cells expressing hHSFs Our results show

that the members of the hHSF family differentially

recognize HSEs, and suggest that the regulated

expres-sion of different hHSF target genes is dependent upon

the architecture of the HSE

Results

Human HSF1, HSF2 and HSF4 exhibit differential binding specificities for various HSE types

in vitro Interactions between hHSFs and various HSE types were investigated using electrophoretic mobility shift assays with in vitro-synthesized polypeptides and oligo-nucleotide probes (Fig 1A) Protein–DNA complexes were formed when binding reactions were carried out using hHSF1-programmed transcription⁄ translation mixtures, but not in control reaction mixtures that

A

B

Fig 1 Binding of hHSFs to various HSE types in vitro (A) Nucleo-tide sequences of four model HSEs The GAA and inverted TTC sequences are indicated in bold upper-case letters with arrows These HSE oligonucleotides were used as DNA probes for electro-phoretic mobility shift assays and as cis-acting sequences for HSE– SV40p–LUC reporters (B) Electrophoretic mobility shift assay of hHSFs Typical results obtained using in vitro-synthesized hHSF1 (3.6 ng), hHSF2 (0.9 ng) and hHSF4 (3.6 ng) polypeptides are shown The reaction mixture programmed with vacant vector DNA was used as a control (C) The binding reaction was carried out at

37 or 43 C for 20 min with 32 P-labeled oligonucleotides HSE4Ptt (4P), HSE3P (3P), HSEgap (G), HSEstep (S), or STRE (N) STRE oli-gonucleotide (TCGACACCCCTTATCTAGAGACCCCTTACCTCGA) was used as a nonspecific binding control Samples were subjected

to gel electrophoresis and phosphorimaging Open and closed arrowheads indicate the positions of DNA fragments bound by one and two hHSF trimers, respectively The binding affinities relative

to HSE3P are shown below each lane The experiments were performed at least three times, and yielded similar results.

were programmed with an empty vector (Fig 1B).

Human HSF1 was able to bind to HSE4Ptt and HSE3P

oligonucleotides containing four and three continuous,

inverted nGAAn repeats, respectively hHSF1–HSE4Ptt

migrated more slowly than hHSF1–HSE3P, and the

amount of hHSF1–HSE4Ptt was 1.5-fold higher than

that of hHSF1–HSE3P Previously, it was shown that

4Ptt-type HSE is bound by two trimers of Drosophila or

Saccharomyces HSFs in a cooperative manner [29,30]

This suggests that the slower migration of hHSF1–

HSE4Ptt is a result of cooperative interaction of two

hHSF1 trimers (Fig S1) Incubation of hHSF1 with

gap-type (HSEgap) or step-type (HSEstep) HSE

oligo-nucleotides resulted in complex formation, but the

amounts were threefold and 20-fold lower, respectively,

than that of hHSF1–HSE3P This demonstrates that

hHSF1 preferentially binds to continuous HSEs Note

that the interaction of hHSF1 with HSEs was

stimulated without changing HSE specificity when the

binding reaction was carried out at 43C rather than

37C (Fig 1B), as reported for binding of mouse HSF

(mHSF)1 to an HSE containing four continuous,

inverted nGAAn repeats [31]

When hHSF2 polypeptide was incubated with

perfect-type HSEs, the electrophoretic mobility and the amount

of hHSF2–HSE4Ptt were almost the same as those of

hHSF2–HSE3P (Fig 1B), indicating that a single

hHSF2 trimer binds to HSE4Ptt Gap-type and

step-type HSEs were recognized by hHSF2, although the

binding affinity for HSEstep was threefold lower than

that for HSE3P The amount of hHSF2 polypeptide

used in the assay was fourfold lower than that of hHSF1

polypeptide, and the addition of fourfold more hHSF2

polypeptide to the reaction mixture caused an increase in

the amount of hHSF2–HSE complexes without

chang-ing HSE specificity (Fig S1) Although it is unknown

whether all polypeptides synthesized are active for

binding, hHSF2 appears to have a higher binding

affin-ity for at least discontinuous HSEs than does hHSF1

Human HSF4 was observed to bind as a single

tri-mer to 4Ptt-type HSE, as judged from the amount and

mobility of the complex (Fig 1B) Notably, the

amount of complex formed with hHSF4 and HSEgap

or HSEstep was more than 70% that of hHSF4–

HSE3P Therefore, like yHSF, hHSF4 possesses the

ability to bind to various HSE types comprising

different configurations of nGAAn units

Phenotypes of S cerevisiae cells expressing

hHSF2 and hHSF4

We constructed S cerevisiae cells expressing hHSF2

and hHSF4, and analyzed their phenotypes In

agree-ment with previous reports [23,28], yeast cells harbor-ing hHSF2 and hHSF4 on low-copy-number (YCp) or high-copy-number (YEp) plasmid grew at temperatures below 35 and 33C, respectively (Fig 2A) The amounts of hHSF4 in cells harboring YCp-hHSF4 or YEp-hHSF4 (0.01–0.1 ng hHSF4Ælg)1 protein) were markedly lower than those of hHSF2 in cells harbor-ing YCp-hHSF2 or YEp-hHSF2 (1–2 ng hHSF2Ælg)1 protein), for unknown reasons (Fig 2B)

Using RT-PCR, we analyzed the mRNA levels of yHSF target genes containing 4P-type HSE (HSP42, HSP78, and KAR2), 3P-type HSE (APA1, HSP10, and SSA2), gap-type HSE (CPR6, CUP1, and HSP82), step-type HSE (FSH1, SGT2, and SSA3), and atypical HSE consisting of directly repeating nGAAn units and several irregular nGAAn units (DR-type; AHP1 and TIP1) [10] When yHSF cells grown at 28C were heat-shocked at 39 C, the mRNA levels of target genes were significantly increased (Fig 2C) In yeast cells expressing hHSF2, the heat-induced transcription of all target genes analyzed was appropriately regulated, with the excep-tion of transcripexcep-tional activaexcep-tion via step-type HSEs, which was slightly lower in hHSF2-expressing cells than

in yHSF-expressing cells hHSF4 was also able to compensate for yHSF in the regulation of target gene expression; however, mRNA levels were slightly reduced in hHSF4 cells as compared to yHSF cells The low mRNA levels may be due to the relatively weak transcriptional activity [19,23] and⁄ or the low-level expression of hHSF4 (Fig 2B) Unlike trimerization-prone hHSF1 derivatives, which fail to activate transcription of genes containing gap-type, step-type or DR-type HSEs in yeast cells [10], hHSF2 and hHSF4 activate transcription of various target genes, and thus support cell viability at elevated temperatures

Heat-induced expression of reporter genes containing various HSE types in HeLa cells The transcriptional activity of various HSE types in mammalian cells was analyzed using reporter genes con-taining HSE oligonucleotides positioned upstream of the SV40 promoter–luciferase gene fusion (HSE– SV40p–LUC) In HeLa cells, insertion of HSEs in the reporter gene did not significantly affect the basal expression level under normal culture conditions (Fig 3A) This suggests that endogenous hHSFs are not involved in the expression, although it is possible that they bind to HSEs of reporter genes without affect-ing the expression When cells were heat-shocked at

43C for 1 h and allowed to recover at 37 C for 5 h, expression of the reporter gene containing 4Ptt-type

HSE (HSE4Ptt–SV40p–LUC) was induced by more

than 15-fold (Fig 3A) After heat shock, expression

directed by 3P-type HSE was modestly induced

( 5-fold), but discontinuous gap-type and step-type

HSEs failed to mediate the induction This suggests that

heat-induced hHSF1 preferentially activates

transcrip-tion of genes containing continuous HSEs

Expression of HSE–SV40p–LUC reporter genes

by hHSF–VP16 fusion proteins

The activation potential of hHSF2 is significantly

lower than that of hHSF1 [32], and hHSF4 is not

appreciably expressed in HeLa cells [19] To explore

HSE architecture-specific functions, the herpes simplex

virus VP16 activation domain was fused to the

C-ter-mini of hHSF1, hHSF2, and hHSF4, and the resulting hHSF–VP16 constructs were introduced into HeLa cells Fusion of the VP16 activation domain did not significantly affect the HSE specificity of hHSFs, as judged by electrophoretic mobility shift assay of

in vitro-synthesized polypeptides (Fig S2) As shown

by immunoblot analysis with an antibody against VP16, these fusion proteins were expressed in HeLa cells; however, the amount of hHSF2–VP16 was much lower than that of hHSF1–VP16 or of hHSF4–VP16, even when cells were transfected with 10-fold more hHSF2–VP16 expression construct (Fig 3B) It has been shown in HeLa cells that transfected hHSF1 forms oligomers and binds to HSEs at physiological temperatures [33] Consistent with the results of heat shock response, hHSF1–VP16 activated constitutive expression of SV40p–LUC reporters containing contin-uous HSEs, but the levels of activation for reporters containing discontinuous HSEs were less than twofold (Fig 3C) The reporter gene expression in the presence

of hHSF2–VP16 was similar in pattern to that observed in the presence of hHSF1–VP16, except that HSEgap–SV40p–LUC expression was activated three-fold In contrast, hHSF4–VP16 was a potent activator

of reporter genes containing gap-type and step-type HSEs The HSE type-specific differences in transcrip-tion of these reporters were consistent with the in vitro binding affinity of each hHSF and HSE type, suggest-ing that hHSF1, hHSF2 and hHSF4 differentially recognize various HSEs in mammalian cells

yHSF

hHSF4

45

15

0 0 15 45 0 15 45 0 15 45

hHSF2

45

15

0

YCp YEp YCp YEp

C

HSP42

HSP78

Gap

3P

4P

control

Step

CPR6

HSP10

CUP1

HSP82

SGT2

FSH1

ACT1

APA1

KAR2

SSA2

TIP1

SSA3

AHP1

DR

39 o C (min)

A

33 o C

37 o C

35 o C

hHSF2 YCp YEp

B

39 o C (min) 0 15 15 0

50

70

yHSF

hHSF2

28 o C

YCp

YEp

hHSF4 YEp

YCp

hHSF4 YCp YEp

15

NS

Fig 2 Characterization of yeast cells expressing hHSF2 and hHSF4 (A) Growth of hHSF cells Cells of strains HS170T yHSF), YYT49 hHSF2), YYT42 (YEp-hHSF2), YYT50 (YCp-hHSF4) and YYT17 (YEp-(YCp-hHSF4) were streaked onto YPD medium and incubated at the indicated temperatures for 2 days (B) Immu-noblot analysis of hHSF proteins Cells were grown in YPD medium

at 28 C and heat-shocked at 39 C for the indicated times Extracts of cells expressing hHSF2 (2 lg of protein) or hHSF4 (20 lg of protein) and recombinant hHSF proteins (not shown) were subjected to immunoblot analysis with antibodies against hHSF2 and hHSF4 The positions of molecular mass markers are shown on the left in kilodaltons NS denotes nonspecific band The experiments were performed at least twice, and yielded similar results Cell extracts (1 lg of protein) of YYY49 and YYT42 con-tained approximately 1 and 2 ng of hHSF2, and those of YYT50 and YYT17 contained approximately 0.01 and 0.1 ng of hHSF4, as judged by the intensity of each band (C) mRNA levels in heat-shocked hHSF cells Cells were grown in YPD medium at 28 C and heat-shocked at 39 C for the indicated times Total RNA pre-pared from the cells was subjected to RT-PCR analysis The genes targeted by yHSF are classified according to the structure of their HSEs: 4P, 3P, Gap, Step and DR (directly repeating nGAAn units and several irregular nGAAn units) types The experiments were performed at least three times and yielded similar results.

Efficient trimerization of hHSF4–VP16 is

necessary for activation via discontinuous HSEs

To locate the HSF4 region responsible for

transcrip-tional regulation via discontinuous HSEs, we analyzed

the transcriptional activity of various hHSF4–VP16

derivatives (Fig 4A,B) Human HSF4 contains a DBD

at the N-terminus, HR-A and HR-B in the central

region, and a relatively weak activation domain at the

C-terminus [19] Deletion of the C-terminal half of

hHSF4 (hHSF4-n355–VP16 and hHSF4-n217–VP16)

did not significantly affect transcriptional activity or

HSE specificity, with the exception of a slight decrease

of HSE3P–SV40p–LUC expression by hHSF4-n355–

VP16 hHSF4–VP16 lacking HR-B (hHSF4-n178–

VP16) exhibited transcriptional activation via 3P-type

HSE, but failed to do so via gap-type or step-type

HSEs An extended deletion construct leading to partial

removal of HR-A (hHSF4-n159–VP16) was abundantly

expressed but failed to activate transcription

The roles of HR-A and HR-B were examined by

introducing amino acid substitutions In

hHSF4-L140P–VP16 and hHSF4-I186P–VP16, a

helix-destabi-lizing residue (proline) was substituted for a hydro-phobic residue (leucine or isoleucine) in HR-A and HR-B, respectively To analyze oligomer formation of these hHSF4–VP16 derivatives, polypeptides synthe-sized in vitro were subjected to chemical crosslinking with ethylene glycol bis-(succinimidylsuccinate) (EGS) (Fig 4C) The band of approximately 220 kDa, which corresponds to the size of a trimer, was detected by treatment of wild-type hHSF4–VP16 with EGS The L140P and I186P substitutions appeared to inhibit tri-mer formation, and most of the polypeptides migrated

at the position of a monomer (75 kDa) When an elec-trophoretic mobility shift assay was conducted (Fig 4D), the substitution derivatives and 3P-type HSE formed complexes exhibiting mobilities similar to that of wild-type hHSF4–VP16 trimer–HSE3P complex [this may be somewhat surprising; however, the com-plex formation might be supported by DBD–DBD and DBD–HSE3P interactions (see Discussion)] However, they exhibited reduced binding affinities for gap-type and step-type HSEs In HeLa cells, the L140P and I186P substitutions in hHSF4–VP16 inhibited tran-scriptional activation via gap-type and step-type HSEs,

C

Gap 3P 4Ptt

Step None

0

Fold activation

0

0

0

Gap 3P 4Ptt

Step None

0

62 83

Fold activation

*

*

*

*

*

*

*

NS

Fig 3 Expression of artificial reporter genes containing various HSE types in HeLa cells (A) Heat shock-induced expression Cells were transfected with DNA mixtures containing 100 ng of SV40p–LUC plasmid (none) or HSE–SV40p–LUC plasmids (4Ptt, 3P, Gap, and Step) For heat shock experiment, cells were incubated at 43 C for 1 h, and culture was continued at 37 C for 5 h Luciferase activity (fold activation) was expressed relative to that of SV40p–LUC plasmid-transfected cells (control, left panel) or to that of cells grown at 37 C (heat shock, right panel) Each bar represents the mean ± standard deviation (SD) for at least five experiments Asterisks indicate significant differences (P < 0.01) as compared with SV40p–LUC control as determined by Student’s t-test (B) Immunoblot analysis of hHSF–VP16 fusion proteins Cells were transfected with DNA mixtures containing 100 ng of reporter plasmid (lane –) and hHSF1–VP16 (10 ng), hHSF2–VP16 (100 ng) or hHSF4–VP16 (10 ng) expression constructs Extracts prepared from cells grown at 37 C were subjected to immunoblotting using an anti-body against VP16 The positions of molecular mass markers are shown on the left in kilodaltons NS denotes nonspecific band The experi-ments were performed at least twice, and yielded similar results (C) Constitutive expression in cells cotransfected with hHSF–VP16 plasmids Transfection was carried out described for (B) Luciferase activity (fold activation) was expressed relative to that of cells transfected with the reporter plasmid alone Each bar represents the mean ± SD for at least five experiments Asterisks indicate significant differences (P < 0.01) as compared with SV40p–LUC control as determined by Student’s t-test.

but not via 3P-type HSE (Fig 4A) These results show

that trimerization facilitated by HR-A⁄ B is obligatory

for binding of hHSF4 to discontinuous HSEs

Differential expression of c-crystallin promoter–

luciferase reporter genes by heat-induced hHSF1

and hHSF4–VP16

We next analyzed expression of the luciferase gene

dri-ven by promoters of the human c-crystallin genes,

whose mouse orthologs are transcriptionally regulated

by HSF1 and HSF4 [21,22] As shown in Fig 5A, the

HSE of the cA-crystallin (CRYGA) promoter contains

six GAA-like sequences, at positions 1, 2, 3, 4, 6, and

7 CRYGA–LUC expression was induced eightfold by

heat shock, and cotransfection of hHSF4–VP16 caused

a fivefold increase in expression The cB-crystallin (CRYGB) HSE is similar to the CRYGA HSE in sequence and configuration of GAA-like sequences CRYGB–LUC expression was induced by heat shock and by hHSF4–VP16 cotransfection In electrophoretic mobility shift assays, DNA fragments containing the CRYGA and CRYGB HSEs were bound by hHSF1 and hHSF4–VP16 (Fig 5B) The cC-crystallin (CRY-GC) promoter contains two HSEs: a distal 3P-like HSE, and a proximal HSE comprising six GAA-like sequences (p1, p2, p3, p5, p6, and p7) (Fig 5A) Unlike the expression observed for CRYGA–LUC and CRYGB–LUC, CRYGC–LUC expression was induced only threefold by heat shock, whereas cotransfection

of hHSF4–VP16 caused a 14-fold increase in expres-sion Human HSF1 bound to the proximal but not

Gap 3P Step

WT

n159

n355 n217 n178 A

I186P L140P

159

178 217 355

VP16

493

HR-A/B

DBD

VP16

VP16 VP16 VP16

VP16 VP16

Fold activation

0

493 493

C

B

240

100

140

70

175

62 83

47.5

WT n217 n178 n159 L140P I186P

32.5

25

D

3P G S 3P G S 3P G S

EGS

3.0 1.0

(mM)

*

*

*

*

*

*

*

NS

Fig 4 Expression of reporter genes by hHSF4–VP16 derivatives in HeLa cells (A) Expression in cells cotransfected with hHSF4–VP16 deriv-atives Structures of hHSF4–VP16 derivatives are shown on the left The DBD and two HRs (HR-A ⁄ B) are shown Numbers indicate amino acid positions Vertical bars show the positions of amino acid substitutions Cells were transfected with DNA mixtures containing 100 ng of reporter plasmid and 10 ng of the indicated hHSF4–VP16 derivatives Luciferase activity (fold activation) was expressed relative to that of cells transfected with the reporter plasmid alone Each bar represents the mean ± SD for at least four experiments Asterisks indicate signif-icant differences (P < 0.01) as compared with hHSF4–VP16 control as determined by Student’s t-test (B) Immunoblot analysis of hHSF4– VP16 derivatives Extracts were prepared from cells transfected as described for (A), and were subjected to immunoblot analysis Positions

of molecular mass markers are shown on the left in kilodaltons NS denotes nonspecific band The experiments were performed at least twice, and yielded similar results (C) Chemical crosslinking analysis of hHSF4–VP16 derivatives In vitro-synthesized polypeptides (4.0 ng) were incubated without or with 1.0 and 3.0 m M EGS, and were subjected to immunoblot analysis Positions of molecular mass markers are shown on the left in kilodaltons Open and closed circles indicate the positions of hHSF4–VP16 monomers and trimers, respectively The experiments were performed at least twice, and yielded similar results (D) Electrophoretic mobility shift assay of hHSF4–VP16 derivatives Typical results using in vitro-synthesized polypeptides (4.0 ng) are shown as described for Fig 1B Open arrowheads indicate the positions

of DNA fragments bound by a single hHSF4–VP16 trimer The experiments were performed at least three times, and yielded similar results.

Fig 5 Expression of c-crystallin promoter-luciferase reporter genes in HeLa cells (A) Expression by heat-induced hHSF1 and by cotransfected hHSF4–VP16 Structures of the c-crystallin promoter–luciferase reporter genes are shown on the left Bars represent the crystallin genes, and open boxes indicate the HSEs The cC-crystallin promoter contains two HSEs, one at a distal (dHSE) position and one

at a proximal (pHSE) position Numbers indicate nucleotide positions relative to the translation initiation site HSE sequences are shown in which the GAA and inverted TTC sequences are indicated by bold upper-case letters with numbers The nucleotides alterations are shown below the HSEs For heat shock experiments, cells were transfected with DNA mixtures containing 200 ng of the indicated reporter plasmid, and luciferase activity (fold activation) was determined as described for Fig 3A For cotransfection experiments, cells were transfected with DNA mixtures containing 200 ng of the indicated reporter plasmid and 10 ng of hHSF4–VP16 expression construct Luciferase activity (fold activation) was determined as described for Fig 3C Each bar represents the mean ± SD for at least four experiments Asterisks indicate significant differences (P < 0.01) as compared with wild-type control as determined by Student’s t-test (B) Electrophoretic mobility shift assay of hHSF1 and hHSF4–VP16 Typical results obtained using in vitro-synthesized hHSF1 (4.8 ng) and hHSF4–VP16 (3.0 ng) are shown as described for Fig 1B Probe fragments were prepared by PCR with primers flanking the putative HSEs

of CRYGA ( )217 to )157), CRYGB ()228 to )168), CRYGC (distal, )367 to )307; proximal, )234 to )174), and CRYGD ()247 to )187) The binding reaction was carried out at 37 C (hHSF4–VP16) or 43 C (hHSF1) for 20 min Brackets indicate protein–DNA complexes (C) Electrophoretic mobility shift assay of hHSF1 The gel was electrophoresed longer than the gels of (B) to resolve DNA fragments bound by one (open arrowhead) and two (closed arrowhead) hHSF1 trimers.

distal HSE, and hHSF4–VP16 bound to both HSEs

(Fig 5B) The cD-crystallin (CRYGD) promoter

con-tains an HSE-like sequence comprising four GAA-like

sequences, and CRYGD–LUC expression was induced

twofold by heat shock (Fig 5A) However, hHSF1

may not be involved in the heat shock response,

because it failed to bind the putative HSE under our

assay conditions (Fig 5B) The putative HSE was only

weakly bound by hHSF4–VP16, but hHSF4–VP16

cotransfection did not affect the expression of

CRYGD–LUC (Fig 5A,B) These results show that

heat shock-induced hHSF1 prefers cA-crystallin and

cB-crystallin promoters, whereas hHSF4–VP16 prefers

the cC-crystallin promoter

HSF–HSE interactions were analyzed by introducing

base alterations in the HSEs of reporter genes

(Fig 5A) In CRYGA–LUC derivatives, the m1

repor-ter gene contained a 3P-like HSE (units 2, 3, and 4), a

gap-like HSE (units 3, 4, and 6), and a step-like HSE

(units 2, 4, and 6); the m2 reporter gene contained a

gap-like HSE (units 3, 4, and 6); the m3 reporter

con-tained a step-like HSE (units 2, 4, and 6); the m4

reporter gene lacked any apparent HSE; and the m6

reporter contained a 3P-like HSE (units 2, 3, and 4)

The m1 and m6 reporter gene alterations significantly,

but not completely, inhibited heat shock-induced

expression, although these reporters contained a

3P-like HSE This result could be explained by a

model in which wild-type CRYGA promoter is bound

by two hHSF1 trimers; one trimer binding to units 1,

2, and 3, and the other binding to units 4 and 6

Consistently, hHSF1–wild-type complex migrated more

slowly than hHSF1–m1 complex or hHSF1–m6

com-plex in electrophoretic mobility shift assays (Fig 5C)

Expression of m2 and m3 reporters was reduced to the

level of the m4 reporter, suggesting that gap-like and

step-like HSEs of these reporters are nonfunctional for

binding by hHSF1 (Fig 5A) In hHSF4–VP16

cotrans-fection experiments, unit 1 of the CRYGA HSE was

dispensable for activation (m1), although alterations of

other units, including unit 6, caused significant

inhibi-tion of activainhibi-tion (m2, m3, m4, and m6) Similar

results were obtained in electrophoretic mobility shift

assays (Fig 5B) The observation that hHSF4–VP16

did not bind stably to sequences containing either

3P-like, gap-like or step-like HSEs might be explained

by the divergence of GAA-like sequences from the

canonical GAA sequence

An alteration of either the distal or proximal HSE

of CRYGC–LUC caused inhibition of

hHSF4–VP16-induced expression, suggesting that both HSEs are

involved in hHSF4–VP16 binding (mdHSE and mp3,6)

(Fig 5A) Notably, changing GAC to GAA in unit 3

resulted in robust activation by hHSF4–VP16, without changing the magnitude of the heat shock response (cp3) The mutational analysis of the CRYGA and CRYGC HSEs suggests that the nucleotide sequences and configuration of nGAAn-like units are important for interaction with hHSF1 and hHSF4

Discussion

In this study, we demonstrate that hHSF1, hHSF2 and hHSF4 differentially recognize HSEs comprising diversely arranged nGAAn units in vitro, in yeast cells, and in HeLa cells All three hHSFs bind to HSEs with continuous, inverted repeats of nGAAn In addition, hHSF4 exhibits a relatively higher affinity for discon-tinuous HSEs containing gaps between nGAAn units Trimerization facilitated by the HR-A⁄ B is obligatory for hHSF4 recognition of discontinuous HSEs In addition to these results obtained with synthetic, model HSEs, hHSF4 exhibited a different specificity from heat shock-induced hHSF1 in interactions with the human c-crystallin promoters These results show that the configuration of nGAAn units in the promoter is important in determining which hHSF members are involved in the regulation of the gene

Footprint analysis of the hHSF4–HSE interaction has shown that hHSF4 binding on the HSP70 pro-moter corresponds to a region that is identical to that observed with mHSF1 but is distinct from that observed with mHSF2 [19] It has been reported that, similar to hHSF1, hHSF4 expressed in yeast cells strongly activates transcription of SSA3, but only slightly activates transcription of CUP1 [23] Recently, Fujimoto et al [34] have shown that mHSF4 is required for induction of a set of genes in response to heat shock, in part by facilitating mHSF1 binding Although these results implied a similarity between hHSF1 and hHSF4 in HSE binding specificity, our data show that hHSF4 exhibits a binding specificity clearly distinguishable from that of hHSF1 and hHSF2, and is able to recognize discontinuously posi-tioned nGAAn units We suggest that genes containing discontinuous HSEs are preferred targets for hHSF4 but not for hHSF1 or hHSF2 Consistently, Fujimoto

et al [34] identified genomic regions that are occupied

by only mHSF4, and showed that the HSF4 binding consensus sequence is more ambiguous than that of HSF1 and HSF2 Two hHSF4 isoforms, hHSF4a and hHSF4b, share the same DBD and HR-A⁄ B, but func-tion as a repressor and activator, respectively [23–25] Phosphorylation of HSF4b by extracellular signal-related kinase leads to increased ability of hHSF4b to bind DNA [35] Therefore, genes containing

discontin-uous HSEs are subject to positive and negative

regula-tion by phosphorylated and unphosphorylated hHSF4

isoforms

The L140P and I186P substitutions in hHSF4–VP16

inhibited binding to gap-type and step-type HSEs but

not to 3P-type HSE In mammalian HSF1, HR-A⁄ B

interacts with the third HR region (HR-C) and

main-tains HSF1 in an inactive monomeric form under

physiological conditions HR-A⁄ B of transcriptionally

active HSF1 mediates interactions among three

mono-mers to form a trimer, thereby facilitating binding to

the HSE [33,36,37] The linker region located between

the DBD and HR-A⁄ B also plays a role in oligomer

formation [38] However, it remains unknown whether

HR-A⁄ B of mammalian HSFs is involved in the

speci-ficity of the HSF–HSE interaction In yHSF, HR-A⁄ B

has been shown to be necessary for interaction with

promoters containing not only gap-type or step-type

HSEs but also 3P-type HSE, but not with those

con-taining four or more nGAAn units [9] Notably, the

yHSF HR-A⁄ B region can be substituted with a

dimerization domain from an unrelated protein with

no effect on the HSE-binding properties of the protein,

which suggests that yHSF HR-A⁄ B does not play an

important role in the binding of HSEs, other than

olig-omerization [9,39] It has been shown that DBD–DBD

interaction affects HSF trimerization and HSE binding

[9,40–42] The HR-A⁄ B-facilitated trimerization of

hHSF4 was not obligatory for binding to continuous

HSEs, suggesting that other, as yet unknown regions,

including, potentially, the DBD, have roles in hHSF4–

HSE interaction However, efficient trimerization was

required for the interaction of hHSF4 with

discontinu-ous HSEs, which indicates that this as yet unidentified

region is not sufficient for binding to discontinuous

HSEs

By using synthetic model HSEs, we have shown that

both hHSF1 and hHSF2 preferentially bind to

contin-uous HSEs in vitro and in HeLa cells hHSF1 and

hHSF2 consistently share the same target genes as

judged by chromatin immunoprecipitation analysis

[43] In binding to continuous HSEs, mHSF1 prefers

long arrays of the nGAAn unit, whereas mHSF2

pre-fers short arrays [27] These differences are related to

differences in the capability for cooperative

interac-tions of trimers [26,27], which was confirmed by our

electrophoretic mobility shift assay (Fig 1B) The

wing region of the DBD facilitates interactions among

mHSF1 trimers [41] We have shown that in vitro and

in HeLa cells, hHSF2 exhibits a slightly higher

bind-ing affinity for discontinuous HSEs than observed for

hHSF1, and that unlike hHSF1 [10], hHSF2 expressed

in yeast cells properly regulates gene expression via

atypical HSEs as well as discontinuous HSEs In this regard, it should be noted that the mouse p35 gene, a specific target of mHSF2, contains a putative HSE that diverges from the canonical HSE [17] It was recently reported that mammalian HSF1 and HSF2 form heterotrimers and that HSF2 modulates the activity of stress-induced HSF1 in a gene-specific manner [44,45] Differences in cooperativity and HSE specificity are likely to be important determinants of the interaction between HSF1–HSF2 heterotrimers and HSEs

In mouse, expression of the c-crystallin gene family

in the lens is regulated by various transcription factors, including HSF1 and HSF4 [21,22,46] Our analysis of the four human c-crystallin promoters has shown that heat-induced hHSF1 preferentially activates the CRYGA and CRYGB promoters, and hHSF4–VP16 activates the CRYGC promoter, whereas neither acti-vates the CRYGD promoter Five GAA-like sequences

in the CRYGA promoter may provide a site for coop-erative hHSF1 binding In the CRYGC promoter, the proximal and distal HSEs were necessary for activation

by hHSF4–VP16 Mice lacking HSF4 develop cata-racts during the early postnatal period, probably due

to decreased expression of c-crystallin and⁄ or HSP25 [21,22] In humans, the CRYGC and CRYGD genes encode abundant lens c-crystallins [47], and CRYGC transcription is regulated by HSF4 This may be one

of the reasons why missense mutations in the HSF4 gene are associated with congenital cataracts [20] Transcriptional regulation of genes by three mam-malian HSFs is implicated in a variety of cellar processes, including cell maintenance and differentia-tion, as well as stress resistance [3–5] Which HSF members are expressed in cells is important in deter-mining which genes are activated or repressed Although hHSF1, hHSF2 and hHSF4 contain similar DBDs and HR-A⁄ B regions, they possess differential binding specificities for various HSE types This differential specificity may give HSFs the ability to distinguish their target genes

Experimental procedures

Plasmids

The ORFs of hHSF1, hHSF2 and hHSF4b were cloned into plasmid pcDNA3.1(+) (Invitrogen, Carlsbad, CA, USA) For expression of hHSFs in Escherichia coli, hHSF1, hHSF2 and hHSF4b (amino acids 220–493) were cloned into plasmid pGEX6P-1 (GE Healthcare, Piscataway, NJ, USA) For expression in yeast cells, hHSF2 and hHSF4b were inserted between the ADH1 promoter and terminator

of low-copy-number plasmid pSK484 (YCp-TRP1–PADH1–

TADH1) [48] and high-copy-number plasmid pK346

(YEp-LEU2–PADH1–TADH1) [10] For expression of hHSF–VP16

fusion proteins in HeLa cells, hHSF1, hHSF2 and hHSF4b

were cloned into pK543, a derivative of pcDNA3.1(+)

con-taining an activation domain of herpes simplex virus VP16

(amino acids 413–490) Derivatives of hHSF4–VP16 were

created by using standard methods The reporter gene

HSE–SV40p–LUC contained an HSE oligonucleotide (see

Fig 1A) upstream of the SV40 promoter–firefly luciferase

gene fusion (SV40p–LUC) of pGL3-Promoter vector

(Pro-mega, Madison, WI, USA) The promoter regions of the

human cA-crystallin, cB-crystallin, cC-crystallin and

cD-crystallingenes were cloned upstream of the luciferase gene

of pGL3-Basic vector (Promega) to create CRYGA–LUC,

respectively

In vitro polypeptide synthesis, electrophoretic

mobility shift assay, and chemical crosslinking

analysis

hHSF polypeptides were synthesized by in vitro

transcrip-tion⁄ translation reaction (TNT Coupled Reticulocyte

Lysate System with T7 RNA polymerase; Promega) using

pcDNA3.1(+) derivatives that carried the hHSF ORFs as

templates The synthesized polypeptides were detected as a

single band of the expected molecular mass, as judged by

immunoblot analysis with antibodies against hHSF1,

hHSF2, and hHSF4 (kindly provided by A Nakai,

Yama-guchi University School of Medicine, Japan) The amounts

of polypeptides were determined by immunoblot analysis

using purified recombinant hHSFs as references (data not

shown) The recombinant proteins were expressed in

E coli as fusion proteins with glutathione S-transferase

Fusion proteins were purified on glutathione Sepharose 4B

beads and were treated with PreScission Protease

accord-ing to the manufacturer’s protocol (GE Healthcare)

For electrophoretic mobility shift assays, the binding

reaction was carried out in 16 lL of mixture containing

0.2–2.0 lL of in vitro transcription⁄ translation reaction

glycerol, 200 ng of poly(dI-dC) and 0.02 ng of 32P-labeled

HSE oligonucleotide for 20 min at 37 or 43C The

samples were electrophoresed on a 3.5% polyacrylamide gel

at room temperature, and subjected to phosphorimaging as

described previously [9,10]

Oligomer formation of polypeptides was analyzed by

chemical crosslinking with EGS [9] In vitro-synthesized

polypeptides (1.0–1.5 lL, 4.0 ng of protein) in 5 lL of

13 mm Tris⁄ Cl (pH 7.6) and 100 mm NaCl were incubated

without or with 1.0 and 3.0 mm EGS for 20 min at room

temperature The reaction was quenched by the addition of

glycine to 75 mm Samples were subjected to SDS⁄ PAGE

and immunoblot analysis using an antibody against VP16 (Abcam, Cambridge, UK)

Yeast strains, immunoblot analysis, and RT-PCR

Yeast strain HS126 (MATa ade2 his3 leu2 trp1 ura3 can1 hsf1::HIS3 YCp-URA3–yHSF) contains a null mutation of the chromosomal yHSF gene and bears wild-type yHSF on

a URA3-marked centromeric plasmid [10] For construction

of strains HS170T, YYT49, YYT42, YYT50, and YYT17, HS126 was transformed respectively with YCp-TRP1–

PADH1–hHSF2–TADH1, YCp-TRP1–PADH1–hHSF4b–TADH1, and YEp-LEU2–PADH1–hHSF4b–TADH1, and the resident YCp-URA3–yHSF was evicted by streaking transformed cells on medium containing 5-fluoroorotic acid [10] Cells were grown in YPD medium consisting of 1% yeast extract, 2% polypeptone, and 2% glucose

Cells expressing hHSF2 and hHSF4 were disrupted by vortexing with glass beads as described previously [9] After centrifugation at 20 000 g for 5 min, protein concentration was measured by the Bio-Rad assay The cleared extracts and recombinant hHSF proteins were subjected to immuno-blot analysis with antibodies against hHSF2 and hHSF4 Total RNA was prepared from yeast cells, and mRNA levels of genes were analyzed by RT-PCR as described pre-viously [10] The amounts of PCR products were compared after normalizing RNA samples to the levels of control ACT1mRNA (encoding actin)

Cell culture, transfection, luciferase assay, and immunoblot analysis

HeLa cells (cell number RCB0007; RIKEN Bio Resource Center, Ibaraki, Japan) were cultured in minimal essential medium supplemented with 10% newborn bovine serum at

37C in a 5% CO2atmosphere Cells grown in 12-well plates were transfected using HilyMax (Dojindo Laboratories, Kumamoto, Japan), with DNA mixtures including 100 or

200 ng of firefly luciferase reporter plasmid, 10 ng of

pRL-TK control plasmid containing the Renilla luciferase gene driven by the HSV-TK promoter (Promega), 10 or 100 ng of hHSF–VP16 expression plasmid, and sufficient carrier pcDNA3.1(+) to bring the total amount of DNA to 1.6 lg Cells were cultured for 20–24 h following transfection, and firefly and Renilla luciferase activities were measured using the Dual-Luciferase Reporter Assay System (Promega) and a luminometer (AB-2200-R; ATTO Co., Tokyo, Japan) The Renilla luciferase activity of each sample was used to nor-malize firefly luciferase for transfection efficiency

The expression of hHSF–VP16 fusion proteins in trans-fected cells was analyzed as follows Cells were lysed in buffer containing 50 mm Tris⁄ Cl (pH 8.0), 150 mm NaCl, 1% Triton X-100, 0.5 mm phenylmethanesulfonyl fluoride, and protease inhibitor cocktail (Nakarai Tesque, Kyoto,