1. Trang chủ
  2. » Luận Văn - Báo Cáo

Báo cáo khoa học: MicroRNA-9 inhibits ovarian cancer cell growth through regulation of NF-jB1 ppt

10 413 0
Tài liệu đã được kiểm tra trùng lặp

Đang tải... (xem toàn văn)

THÔNG TIN TÀI LIỆU

Thông tin cơ bản

Tiêu đề MicroRNA-9 Inhibits Ovarian Cancer Cell Growth Through Regulation Of NF-jB1
Tác giả Li-Min Guo, Yong Pu, Zhe Han, Tao Liu, Yi-Xuan Li, Min Liu, Xin Li, Hua Tang
Người hướng dẫn H. Tang
Trường học Tianjin Medical University
Chuyên ngành Life Science
Thể loại báo cáo khoa học
Năm xuất bản 2009
Thành phố Tianjin
Định dạng
Số trang 10
Dung lượng 498,19 KB

Các công cụ chuyển đổi và chỉnh sửa cho tài liệu này

Nội dung

Our studies show that microRNA-9 miR-9 is downregulated in human ovarian cancer relative to normal ovary, and overexpression of miR-9 suppresses cell growth in vitro.. When miR-9 is over

Trang 1

regulation of NF-jB1

Li-Min Guo*, Yong Pu*, Zhe Han*, Tao Liu, Yi-Xuan Li, Min Liu, Xin Li and Hua Tang

Tianjin Life Science Research Center and Basic Medical School, Tianjin Medical University, China

Introduction

Ovarian cancer remains a leading cause of morbidity

and mortality, with little change in survival rates over

the past 30 years Previous studies have revealed

sev-eral genes related to human ovarian cancer [1], but

the common molecular mechanisms of ovarian cancer

remain to be elucidated Although focusing on known

genes has already yielded new information, previously

unknown noncoding RNAs, such as microRNAs

(miRNAs), may also lend insight into the biology of

ovarian cancer Since their discovery [2–5], miRNAs

have emerged as integrated and important

post-tran-scriptional regulators of gene expression in animals

and plants [6,7] MicroRNAs are 21-23-nucleotide

regulatory RNAs processed from 70–100-nucleotide

hairpin pre-miRNAs Their 5¢-end binds to a target complementary sequence in the 3¢-UTR of mRNA and, given the degree of complementarity, miRNA binding appears to result in translational repression,

or in some cases, cleavage of cognate mRNAs, caus-ing partial or full silenccaus-ing of the respective protein coding genes As a new layer of gene-regulation mechanism, miRNAs have diverse functions, includ-ing the regulation of cellular differentiation, prolifera-tion and apoptosis, as well as cancer initiaprolifera-tion and progression [8,9] Indeed, a number of studies have reported differentially regulated miRNAs in diverse cancer types such as breast cancer [10], lung cancer [11], chronic lymphocytic leukemia [12], colon cancer

Keywords

cell growth; miR-9; NF-jB1; ovarian cancer;

target gene

Correspondence

H Tang, Tianjin Life Science Research

Center and Basic Medical School,

Tianjin Medical University, Tianjin 300070,

China

Fax: +86 22 2354 2503

Tel: +86 22 2354 2503

E-mail: htang2002@yahoo.com

*These authors contributed equally to this

work

(Received 21 January 2009, revised 18 July

2009, accepted 24 July 2009)

doi:10.1111/j.1742-4658.2009.07237.x

MicroRNAs are emerging as important regulators of cancer-related pro-cesses Our studies show that microRNA-9 (miR-9) is downregulated in human ovarian cancer relative to normal ovary, and overexpression of miR-9 suppresses cell growth in vitro Furthermore, the 3¢-UTR of NF-jB1 mRNA is found to be regulated directly by miR-9, demonstrating that NF-jB1 is a functionally important target of miR-9 in ovarian cancer cells When miR-9 is overexpressed in ovarian cancer cells, the mRNA and protein levels of NF-jB1 are both suppressed, whereas inhibition of miR-9 results in an increase in the NF-jB1 expression level Ovarian cancer tissues display significantly low expression of miR-9 and a high level of NF-jB1 compared with normal tissues, indicating that regulation of NF-jB1 by miR-9 is an important mechanism for miR-9 to inhibit ovarian cancer proliferation

Abbreviations

ASO, antisense oligonucleotide; EGFP, enhanced green fluorescence protein; miR-9, microRNA-9; miRNA, microRNA; MTT,

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide; NF-jB, nuclear factor of kappaB.

Trang 2

During tumorigenesis and development,

overexpres-sed miRNAs may potentially target tumor suppressor

genes, whereas downregulated miRNAs would

theoret-ically regulate oncogenes For example, the let-7

miR-NAs, which have low expression in lung cancer, can

negatively regulate the oncogenes RAS [16] and

HMGA2 [17], resulting in the upregulation of these

oncogenes Conversely, miR-27a, which is highly

expressed in gastric adenocarcinoma and breast cancer,

acts as an oncogene by downregulating tumor

suppres-sor genes [18,19] These facts indicate that miRNAs

may play a critical role in cancer-related processes

Here, we elucidate a general reduction in miR-9 level

in ovarian cancer tissues compared with normal

tis-sues In ovarian cancer cell line ES-2, overexpression

of miR-9 could suppress cell growth, which showed a

dose-dependent effect Subsequent experiments

con-firmed that nuclear factor jB1 (NF-jB1) was a target

of miR-9 and was downregulated by miR-9 at both

the transcriptional level and the translational level

These results suggest that regulation of NF-jB1 by

miR-9 is a mechanism by which miR-9 may inhibit

ovarian cancer proliferation

Results

miR-9 is downregulated in ovarian cancer cells

Currently, almost all of the miRNA-related studies on

cancers are based on the different expression profile of

miRNAs in cancer cells versus normal cells Thus,

methods used to detect mRNA expression can also be

used in studies on the potential roles of miRNAs in

cancers [20] and a recent study reported that miR-9

may be of potential importance as biomarker in

recur-rent ovarian cancer Results show that miR-9 was

downregulated in recurrent cancers [21] We were

therefore led to ask whether miR-9 was downregulated

in ovarian cancer relative to normal ovary Using

real-time RT-PCR, we compared miR-9 expression profiles

between four pairs of ovarian cancers and normal

ovarial tissues As a result, miR-9 showed on average

0.3-fold lower expression in ovarian cancer tissues than

in normal ovarial tissues (Fig 1), suggesting that

miR-9 was downregulated in ovarian cancers

Overexpression of miR-9 suppresses cell growth

in vitro

Previous studies have indicated that miR-9 is seen to

be markedly downregulated in ovarian cancers, and

may function as a tumor suppressor gene Thus, we tested whether overexpression of miR-9 in ES-2 cells could affect cell growth In a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay, cells transfected with miR-9 expression vector pcDNA3B⁄ pri-iR-9 were found to grow more slowly than the control group, with an inhibition of  30% (Fig 2A) Moreover, as the concentration of pcDNA3B⁄ pri-miR-9 increased in transfection, cell proliferation activity showed a gradual decrease, indi-cating the dose-dependent effect of miR-9 on the inhi-bition of cell proliferation (Fig 2B) We also found that overexpression of miR-9 suppressed cell growth in

a time-dependent manner Although there was no dif-ference between control and pcDNA3B⁄ pri-miR-9 groups during the first 2 days after transfection, exoge-nously expressed miR-9 in ES-2 cells caused a 20% reduction in cell proliferation at 72 h after transfection (Fig 2C) These results indicated that the expression level of miR-9 had an influence on cell growth To fur-ther validate the antiproliferative effect of miR-9 on the growth of ES-2 cells, a colony formation assay was performed It was shown that the colony number of ES-2 cells transfected with pcDNA3B⁄ pri-miR-9 was significantly lower than those transfected with control vector (Fig 2D) The dramatic contrast in colony formation activity indicated that overexpression of miR-9 could suppress the colony formation activity of ES-2 cells These results were consistent with the MTT assay and further suggested that overexpression of miR-9 suppresses cell growth in vitro

Fig 1 Dysregulation of miR-9 in ovarian cancer tissues The miR-9 expression level of four pairs of human ovarian cancer tissue sam-ples (Ca) and four matched normal ovarial tissue samsam-ples (N) was detected by real-time RT-PCR The relative expression of miR-9 was defined as: quantity of miR-9 ⁄ quantity of U6 in the same sam-ple The expression of normal ovarian samples was regarded as the normalizer and the relative miR-9 quantity (mean ± SD) are shown (*P < 0.05).

Trang 3

NF-jB1 is a candidate target of miR-9

According to the above data, we hypothesized that

miR-9 might inhibit the malignant phenotype of

ovar-ian cancer cells by regulating oncogenes and⁄ or genes

that control cell proliferation or apoptosis [20] Thus,

to investigate how miR-9 operates during the

progres-sion of ovarian cancer, we tried to search for the target

genes of miR-9 The gene that was predicted by all the

three algorithm programs (pictar, targetscan and

mirbase targets) was chosen as the candidate target

of miR-9 Among these genes, NF-jB1, a transcription

regulator that is involved in a wide variety of

biologi-cal functions, was found to have a putative miR-9

binding site within its 3¢-UTR We therefore chose it

for further research

NF-jB1 gene 3¢-UTR carries a putative miR-9

binding site and is negatively regulated by miR-9

It is well known that miRNAs cause mRNA cleavage

or translational repression by forming imperfect base

pairing with the 3¢-UTR of target genes

Further-more, the 2–8 nucleotides of miRNA, known as the

‘seed region’, are suggested to be the most important factor for target recognition [22] Therefore, we pre-dicted that NF-jB1 mRNA 3¢-UTR might contain a miR-9 binding site, which was reversed complemen-tary with the miR-9 ‘seed region’ With the help of the TargetScan database, we found a binding site for miR-9 in NF-jB1 mRNA 3¢-UTR (Fig 3A) To con-firm that miR-9 can bind to this region and cause translational repression, we constructed an enhanced green fluorescence protein (EGFP) reporter vector ES-2 cells were transfected with the reporter vector along with pcDNA3B⁄ pri-miR-9 or control vector

As a result, the intensity of EGFP fluorescence in pcDNA3B⁄ pri-miR-9-treated cells is significantly lower than that in the control vector group (Fig 3B) Similarly, we constructed another EGFP reporter vec-tor containing the mutational NF-jB1 3¢-UTR (Fig 3A) It was shown that overexpression of miR-9 could not affect the intensity of EGFP fluorescence in this 3¢-UTR mutant vector (Fig 3C) These facts sug-gested that miR-9 may bind directly to the 3¢-UTR

of NF-jB1 mRNA and repress gene expression These data highlight the prediction that NF-jB1 is a direct target for miR-9

Fig 2 Overexpression of miR-9 suppresses

cell growth in vitro (A) Cell growth was

measured using the

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT)

assay ES-2 cells were transfected with

pcDNA3B ⁄ pri-miR-9 (Pri-miR-9) or control

vector (Ctrl) and at 72 h post transfection

the MTT assay was performed The

histo-gram shows mean (± SD) of A n from three

independent experiments (*P < 0.05).

(B) A gradually increased concentration of

pcDNA3B ⁄ pri-miR-9 (pri-miR-9) from 0 to

15 ngÆlL)1was transfected into ES-2 cells

and the dose-dependent anti-proliferative

effects were detected using the MTT assay.

(C) ES-2 cells were transfected with

pcDNA3B ⁄ pri-miR-9 and he MTT assay was

used to determine relative cell growth

activ-ity at 24, 48 and 72 h (D) The effect of

miR-9 on cell proliferation was evaluated

using a colony formation assay ES-2 cells

were transfected with pcDNA3B ⁄ pri-miR-9

(Pri-miR-9) or control vector (Ctrl) at a final

concentration of 10 ngÆlL)1and then

seeded in 12-well plates The number of

colonies was counted at the sixth day after

seeding and the colony formation rate was

calculated (*P < 0.05).

Trang 4

MiR-9 regulates NF-jB1 mRNA and protein

expression in ES-2 cells

miRNAs may suppress the expression of target genes

through translational repression or degradation of a

target’s transcript To assess whether miR-9 had a

functional role in the downregulation of endogenous

NF-jB1 expression, ES-2 cells were transfected with the

miR-9 blockage, known as miR-9 antisense

oligonucleo-tide (ASO) or pcDNA3B⁄ pri-miR-9 to alter the miR-9

expression level; the NF-jB1 mRNA level was measured

by real-time RT-PCR As a result, when miR-9 was

blocked, NF-jB1 mRNA was elevated compared with

the control group, with an 80% increase (Fig 4A)

Conversely, when miR-9 was enhanced, NF-jB1

mRNA showed a 30% decrease compared with the

control group (Fig 4B), indicating that miR-9 could

downregulate the endogenous NF-jB1 mRNA level

Furthermore, the effects of miR-9 on NF-jB1 protein

expression in ES-2 cells were examined using a western

blot assay It was shown that knockdown of miR-9

enhanced NF-jB1 protein expression, including its

cytoplamsic precursor p105 and corresponding

process-ing product p50 (Fig 4C) By contrast, overexpression

of miR-9 reduced the NF-jB1 protein level (Fig 4D)

These results demonstrated that miR-9 regulates

endog-enous NF-jB1 expression through both the mRNA degradation and translational repression pathways

To confirm the validity of miR-9 blocking or over-expression, we checked the expression level of miR-9 using real-time RT-PCR, and found that when ES-2 cells were transfected with miR-9 ASO, the miR-9 level was decreased 60% (Fig 4E) Conversely, the miR-9 level in pcDNA3B⁄ pri-miR-9 transfected ES-2 cells was enhanced 5.05-fold in contrast to the control group (Fig 4F) These data indicated that miR-9 was indeed altered by the blockage or the expression vector

NF-jB1 is overexpressed in ovarian cancer tissues

Given that miR-9 is downregulated in ovarian cancer and that NF-jB1 is a target of miR-9, we hypothesized that NF-jB1 might be overexpressed in ovarian cancer tissues relative to normal tissues A real-time RT-PCR assay was used to detect the NF-jB1 profile in four pairs of ovarian cancer tissue samples and normal ovarian tissue samples As a result, NF-jB1 mRNA had on average 1.96-fold higher expression in ovarian cancer tissues than in normal ovarial tissues (Fig 5), which is consistent with the dysregulation of miR-9 in ovarian cancer

Fig 3 Validation of NF-jB1 as the target of miR-9 by fluorescent reporter assay (A) As predicted in the TargetScan database, the NF-jB1 3¢-UTR carries a miR-9 binding site The NF-jB1 3¢-UTR mutation containing a mutated miR-9 ‘‘seed region’ binding site is shown Arrows indicate the mutated nucleotides (B) ES-2 cells were transfected with the pcDNA3 ⁄ EGFP-NF-jB1 3¢-UTR reporter vector (EGFP-NF-jB1 3¢-UTR) and pcDNA3B ⁄ pri-miR-9 (Pri-miR-9) or control vector Cells were lysed at 72 h after transfection and the intensity of EGFP fluores-cence was detected The RFP expression vector pDsRed2-N1 was spiked in and used for normalization (*P < 0.05) (C) ES-2 cells were transfected with the pcDNA3 ⁄ EGFP-NF-jB1 3¢-UTR mutation reporter vector (EGFP-NF-jB1 3¢-UTR mutant) as well as pcDNA3B ⁄ pri-miR-9 (Pri-miR-9) or control vector and the fluorescent intensity was detected (**P > 0.05).

Trang 5

Knockdown of NF-jB1 inhibits ES-2 cells growth

in vitro

An abundance of data indicates that the IjB kinase and

NF-jB subunits can act to promote tumorigenesis, and

NF-jB functions as a tumor promoter [23] Hence, we

tested whether knockdown of NF-jB1 affects cell

growth The siRNA expression vector pSilencer⁄

si-NF-jB1 was constructed, and by transfection with pSilencer⁄

si-NF-jB1, the endogenous NF-jB1 expression was

effectively suppressed, with a 50% decrease for P105 and

a 40% decrease for P50 (Fig 6A) Next, pSilencer⁄

si-NF-jB1 was transiently transfected into ES-2 cells and cell

growth activity was detected using a MTT assay It was indicated that knockdown of NF-jB1 suppressed cell growth in a time-dependent manner A significant reduc-tion in cell proliferareduc-tion was found at 72 h post transfec-tion, with  20% inhibition (Fig 6B), similar to the effect of pri-miR-9 on ovarian cell growth (Fig 2C) These results are consistent with the finding that overex-pression of miR-9 suppresses cell growth in vitro, provid-ing further evidence that NF-jB1 is involved in miR-9-mediated suppression of ovarian cancer Accordingly, identification of NF-jB1 as a miR-9 target gene may explain, at least in part, why overexpression of miR-9 suppresses cell growth

Fig 4 MiR-9 regulates NF-jB1 at

transcrip-tional and translatranscrip-tional level (A,B) Large

RNA was extracted from ES-2 cells

trans-fected with miR-9 ASO [anti-(miR-9)] or

control oligonucleotides (Ctrl); pcDNA3B⁄

pri-miR-9 (Pri-miR-9) or control vector (Ctrl),

and the NF-jB1 mRNA level was measured

by real-time RT-PCR b-actin mRNA was

regarded as the endogenous normalizer.

The relative NF-jB1 expression level

(mean ± SD) is shown (*P < 0.05) (C,D)

Protein was extracted from ES-2 cells

trans-fected with miR-9 ASO [anti-(miR-9)] or

control oligonucleotides (Ctrl); pcDNA3B⁄

pri-miR-9 (Pri-miR-9) or control vector (Ctrl),

and the NF-jB1 protein level was measured

by western blotting GAPDH protein was

regarded as the endogenous normalizer and

the relative NF-jB1 protein level is shown

(*P < 0.05) (E,F) Small RNA was extracted

from ES-2 cells transfected with miR-9 ASO

[anti-(miR-9)] or control oligonucleotides

(Ctrl); pcDNA3B⁄ pri-miR-9 (Pri-miR-9) or

con-trol vector (Ctrl), and the expression of

miR-9 was measured by real-time RT-PCR.

U6 snRNA was regarded as the endogenous

normalizer and the relative miR-9 expression

level (mean ± SD) is shown (*P < 0.05).

Trang 6

miRNA expression correlates with various cancers,

and miRNAs are thought to function as either tumor

suppressors or oncogenes A recent study reported that

miR-9 may be of potential importance as a biomarker

in recurrent ovarian cancer Expression of 180

miR-NAs was detected in primary and recurrent serous

papillary adenocarcinomas, and the result showed that

miR-9 was downregulated in recurrent cancers [21] In

early breast cancer development, miR-9 was also

trans-criptionally downregulated in a methylation-dependent

way [24]

Previous studies led us to ask whether miR-9 was

dysregulated in ovarian cancer compared with normal

ovary [25] Given that miR-9 has a lower expression

level in cancer cells, we used a gain-of-function

approach by transfecting the ovarian cancer cell line

ES-2 with miR-9 expression vector pcDNA3B⁄

pri-miR-9 In the MTT assay, overexpression of miR-9

resulted in cell growth arrest, which showed

dose-dependent and time-dose-dependent effects In addition,

col-ony formation is typical of malignant transformed

cells, and is inconspicuous in normal cells Using a

colony formation assay, we found that the colony

for-mation activity of ES-2 cells transfected with

pcDNA3B⁄ pri-miR-9 was significantly suppressed

Also, we tend to believe that miR-9 affects ovarian cell

growth activity over the long term, because the

inhibi-tion rate of pri-miR-9 in the MTT assay was not as significant as in the colony formation assay These experiments indicated that miR-9 overexpressed ovar-ian cancer cells showed a suppression of malignant phenotypes, suggesting the role of miR-9 in the growth inhibition of malignant cells

The fundamental function of miRNA is to regulate their targets by direct cleavage of the mRNA or by inhibition of protein synthesis, according to the degree

of complementarity with their target 3¢-UTRs Identifi-cation of miRNA target genes has been a great

Fig 5 Dysregulation of NF-jB1 in ovarian cancer tissue samples.

The NF-jB1 expression level in the four pairs of human ovarian

can-cer tissue samples (Ca) and matched four normal ovarial tissue

samples (N) was detected by real-time RT-PCR b-actin mRNA was

regarded as the endogenous normalizer and the relative NF-jB1

expression level (mean ± SD) is shown (*P < 0.05).

Fig 6 Knockdown of NF-jB1 inhibits growth of ES-2 cells in vitro (A) The validity of pSilencer ⁄ si-NF-jB1 (si-NF-jB1) was examined in ES-2 cells by western blotting with anti-(NF-jB1) serum and the relative protein level is shown (*P < 0.05) (B) Knockdown of NF-jB1 suppresses cell growth in a time-dependent manner Growth of ES-2 cells transfected with pSilencer ⁄ si-NF-jB1 (si-NF-jB1) showed a 20% reduction at 72 h post-transfection Values are means ± SD of three independent experiments and the relative cell growth activity

is shown (*P < 0.05).

Trang 7

challenge Computational algorithms have been the

major driving force in predicting miRNA targets,

which are based mainly on base pairing of miRNA

and target gene 3¢-UTR [26–28] According to the

pre-diction result, NF-jB1 is found to have a putative

miR-9 binding site within its 3¢-UTR; we therefore

chose it for further research

An effective method to identify the direct targets of

miRNAs is the fluorescent reporter assay We used an

EGFP-NF-jB1 3¢-UTR reporter vector in the

fluores-cent report assay and found a decrease in EGFP

inten-sity following overexpresstion of miR-9 Furthermore,

when another reporter vector containing a mutational

miR-9 ‘seed region’ binding site was used in the

fluorescent reporter assay, overexpresstion of the

miR-9-mediated fluorescent decrease could no longer

be detected These results suggested that miR-9 can

bind directly to the NF-jB1 3¢-UTR and negatively

regulate NF-jB1 gene expression In addition, using

quantitative RT-PCR and western blotting, we

con-firmed that overexpression of miR-9 could cause the

decrease in NF-jB1 mRNA and protein levels, whereas

inhibition of miR-9 results in an increase in NF-jB1

expression levels Furthermore, NF-jB1 displayed a

higher expression level in ovarian cancer tissues

com-pared with normal ovary, which is consistent with the

dysregulation of miR-9 in ovarian cancer These data

indicated that NF-jB1 is a direct target of miR-9

According to existing research, NF-jB transcription

factors can both induce and repress gene expression by

binding to discrete DNA sequences, known as jB

ele-ments, in promoters and enhancers In mammalian

cells, there are five NF-jB family members, RelA

(p65), RelB, c-Rel, p50⁄ p105 (NF-jB1) and p52 ⁄ p100

(NF-jB2), and different NF-jB complexes are formed

from their homodimers and heterodimers In most cell

types, NF-jB complexes are retained in the cytoplasm

by a family of inhibitory proteins known as inhibitors

of NF-jB (IjB) Activation of NF-jB typically

involves the phosphorylation of IjB by IjB kinase

complex, which results in IjB degradation This

releases NF-jB and allows it to translocate freely to

the nucleus [29]

An abundance of data indicates that the IjB kinases

and NF-jB subunits can act to promote tumorigenesis,

and this subject has been extensively reviewed

else-where [30] Briefly, the pro-oncogenic effect of NF-jB

can be thought of as arising from the overproduction

of its normal target genes as a consequence of its

chronic activation and nuclear localization in tumor

cells For example, NF-jB can stimulate tumor cell

survival through the continual induction of

anti-apop-totic genes such as Bcl-xL, X-IAP, cIAP1 and cIAP2,

and A20[31] Through this antiapoptotic activity, NF-jB can also reduce the effectiveness of many common cancer therapies, which themselves activate NF-kB By regulating gene expression, NF-jB can also promote other oncogenic processes including tumor cell proliferation through its ability to induce proto-oncogenes such as cyclin D1 and c-Myc, metastasis through its ability to induce the expression of cellular adhesion molecules and matrix metalloproteinases, angiogenesis through the regulation of vascular endo-thelial growth factor and cell immortality through reg-ulating telomerase Finally, in some model systems, NF-jB provides the critical link between tumor devel-opment and chronic inflammation, a process thought

to be the basis of up to 20% of human cancers It is not difficult to see that any pathway affecting the expression level or transcriptional activity of NF-jB can also alter the oncogenic activity of NF-jB Our research validated the upregulation of NF-jB in ovar-ian cancer by quantitative RT-PCR, which may pro-mote the oncogenic activity of NF-jB and contribute

to tumorigenesis Because NF-jB1 is a target gene of miR-9, suppression of miR-9 may account for the overexpression of NF-jB1 in ovarian cancer, although other mechanisms cannot be excluded

In conclusion, miR-9 displays a low level in ovarian cancer tissues compared with normal ovarian tissues, and overexpression of miR-9 represses cell growth A new target gene of miR-9, NF-jB1, was found to be upregulated in ovarian cancer tissues These findings indicate that inhibition of miR-9 in ovarian cancer may contribute to the malignant phenotype by main-taining a high level of NF-jB1 Thus, the identification

of miR-9 and its target gene, NF-jB1, in ovarian can-cer may help us to understand the potential molecular mechanism of tumorigenesis, and may have diagnostic and therapeutic value in the future

Materials and methods

Materials

Four pairs of ovarian tissues, including four human ovarian cancer tissues and the matched normal ovarial tissues from the same patient, were used in this study The normal ovar-ian tissues were the distal end of the operative excisions far away from the tumors The samples were received from the Tumor Bank Facility of Tianjin Medical University Cancer Institute and Hospital and National Foundation of Cancer Research All of the samples were obtained with patients’ informed consent and were confirmed by the pathologic analysis Large and small RNA of tissue samples was extracted and purified using mirVana miRNA Isolation

Trang 8

Cell culture

Human ovarian cancer cell line ES-2 was grown in RPMI

1640 (GIBCO BRL, Grand Island, NY, USA)

supple-mented with 10% fetal bovine serum, 100 UÆmL)1penicillin

and 100 lgÆmL)1streptomycin, and incubated at 37C in a

humidified chamber supplemented with 5% CO2

Construction of expression vectors

To construct the miR-9 expression vector pcDNA3B⁄

pri-miR-9, we first modified pcDNA3 by mutating the BglII

site outside the mutiple cloning site, then amplified a

386 bp DNA fragment carrying pri-miR-9 from genomic

DNA using PCR primers miR-9-sense, 5¢-CGGAGAT

CTTTTCTCTCTTCACCCTC-3¢, and miR-9-antisense,

5¢-CAAGAATTCGCCCGAACCAGTGAG-3¢ The amplified

fragment was cloned into modified pcDNA3 at BamHI and

EcoRI sites To construct the siRNA expression vector

pSi-lencer⁄ si-NF-jB1, an  70 bp double-stranded si-NF-jB1

was obtained by annealing using two single-strands

NF-jB1-Top, 5¢-GATCCCGCCTGAACAAATGTTTCATTTG

GTCAAGAGCCAAATGAAACATTTGTTCAGGCTTTG

GAAA-3¢; and NF-jB1-Bot, 5¢-AGCTTTTCCAAAAAA

GCCTGAACAAATGTTTCATTTGGCTCTTGACCAAA

TGAAACATTTGTTCAGGCGG-3¢, and then cloned into

pSilencer 2.1 neo vector (Ambion) Annealing was

per-formed as: 95C for 5 min and room temperature for 2 h

Transfection

Transfection was performed with Lipofectamine 2000

Reagent (Invitrogen, Carlsbad, CA, USA) following the

manufacturer’s protocol Briefly, cells were seeded in plates

the day before transfection to ensure a suitable cell

conflu-ent on the day of transfection pcDNA3B⁄ pri-miR-9 or

pSilencer⁄ si-NF-jB1 and respective control vectors were

used at 5 ngÆlL)1, and miR-9 ASO (5¢-TCATAC

AGCTAGATAACCAAAGA-3¢) or control

oligonucleo-tides (5¢-GTGGATATTGTTGCCATCA-3¢) were used at

200 nm for each transfection in antibiotic-free Opti-MEM

medium (Invitrogen) Transfection efficiency was monitored

by Cy5-oligonucleotide and spiking RFP-expressing vector

when necessary

Cell proliferation assay

Cells were seeded in 96-well plate at 4000 cells per well the

day before transfection and then transfected with

pcDNA3B⁄ pri-miR-9 or control vector as mentioned

above Furthermore, to detect the dose-dependent effect,

effect of pSilencer⁄ NF-jB1 on ES-2 cells, we detected via-ble proliferation cells 24, 48 and 72 h after transfection respectively MTT assay was used to detect viable prolifera-tion cells The absorbance at 570 nm (A570) was detected using lQuant Universal Microplate Spectrophotometer (Bio-tek Instruments, Winooski, VT, USA)

Colony formation assay

After transfection, cells were counted and seeded in 12-well plates in triplicate at 100 cellsÆwell)1 Fresh culture medium was replaced every 3 days The colony was counted only if

it contained > 50 cells, and the number of colonies was counted from the sixth day after seeding The rate of col-ony formation was calculated with the equation: colcol-ony formation rate = (number of colonies⁄ number of seeded cells)· 100%

Bioinformatics method

The miRNA targets predicted by computer-aided algorithms were obtained from pictar (http://pictar.mdc-berlin.de/cgi-bin/new_PicTar_vertebrate.cgi), targetscan (http://www targetscan.org) and mirbase targets (http://microrna sanger.ac.uk/cgi-bin/targets/v5/search.pl)

Fluorescent report assay

The EGFP expression vector pcDNA3⁄ EGFP was con-structed as previously described [18] The 3¢-untranslated mRNA sequences of NF-jB1 containing the miR-9 binding site were amplified by PCR using the following primers: NF-jB1 sense, 5¢-CCGGGATCCGCAAACTCAGCTTTAC-3¢; and NF-jB1 antisense, 5¢-CGGAATTCGTGGCGACCGT GATACC-3¢ PCR products were cloned into pcDNA3 ⁄ EGFP at BamHI and EcoRI sites Moreover, the fragment of NF-jB1 3¢-UTR mutant, which contained a mutational miR-9 binding site, was amplified using PCR site-directed mutagenesis and cloned into pcDNA3⁄ EGFP at the same sites The two more primers carrying the mutated NF-jB1 3¢-UTR fragment were used in the mutagenesis: NF-jB1

and NF-jB1 MA, 5¢-GAATTTTAGGGGTATGCTTTA CACGGTG-3¢

ES-2 cells were transfected with pcDNA3B⁄ pri-miR-9 or control vector, miR-9 ASO or control oligonucleotides at 24-well plate, and then with the reporter vector pcDNA3⁄ jB1 3¢-UTR or pcDNA3 ⁄ EGFP-NF-jB1 3¢-UTR mutant on the next day The RFP expression vector pDsRed2-N1 (Clontech, Mountain View, CA, USA) was spiked in and used for normalization The cells were lysed with radioimmunoprecipitation assay lysis buffer

Trang 9

(150 mm NaCl, 50 mm Tris⁄ HCl, pH 7.2, 1% Triton

X-100, 0.1% SDS) 72 h later and the proteins were

har-vested The intensities of EGFP and RFP fluorescence were

detected with Fluorescence Spectrophotometer F-4500

(HITACHI, Tokyo, Japan)

Real-time RT-PCR

Small RNA (5 lg) was reverse transcribed to cDNA using

M-MLV reverse transcriptase (Promega, Madison, WI,

USA) with primers miR-9-RT or U6-RT respectively RT

primers were as follows: miR-9-RT, 5¢-TCGTATCCAG

TGCAGGGTCCGAGGTGCACTGGATACGACTCATA

CAG-3¢; and U6-RT, 5¢-GTCGTATCCAGTGCAGGGT

CCGAGGTATTCGCACTGGATACGACAAAATATGG

AAC-3¢, which can fold to stem–loop structures The

cDNA was used to amplify mature miR-9 and an

endoge-nous control U6 snRNA, respectively, through PCR PCR

primers were: miR-9-Fwd, 5¢-GCCCGCTCTTTGGTTAT

CTAG-3¢; and U6-Fwd, 5¢-TGCGGGTGCTCGCTTCGG

CAGC-3¢, which could ensure the specificity of the PCR

products, and reverse, 5¢-CCAGTGCAGGGTCCGAGGT-3¢,

which was universal All the primers were purchased from

Invitrogen PCR cycles were as follows: 94C for 5 min,

fol-lowed by 40 cycles of 94C for 30 s, 50 C for 30 s and 72 C

for 40 s Real-time PCR was performed using SYBR Premix

Ex Taq (TaKaRa, Otsu, Shiga, Japan) on a 7300 Real-Time

PCR system (ABI, Foster City, CA, USA) The relative

expression of miR-9 was defined as follows: quantity of

miR-9⁄ quantity of U6 in the same sample

To detect the relative level of NF-jB1 transcription,

real-time RT-PCR was performed Briefly, a cDNA library was

generated through reverse transcription using M-MLV

reverse transcriptase (Promega) with 5 lg of the large

RNA The cDNA was used to amplify the NF-jB1 gene

and b-actin gene as an endogenous control through PCR

PCR primers were as follows: NF-jB1 sense and NF-jB1

antisense were as above; b-actin sense, 5¢-CGTGAC

ATTAAGGAGAAGCTG-3¢; and b-actin antisense,

5¢-CTAGAAGCATTTGCGGTGGAC-3¢ PCR cycles were

as follows: 94C for 5 min, followed by 40 cycles of 94 C

for 1 min, 56C for 1 min and 72 C for 1 min Real-time

PCR was performed as described above, and the relative

NF-jB1 expression level was defined as follows: quantity of

NF-jB1⁄ quantity of b-actin in the same sample

Western blot

ES-2 cells were transfected with pri-miR-9 or control

vec-tor, miR-9 ASO or control oligonucleotides Forty-eight

hours later the cells were lysed with RIPA lysis buffer and

proteins were harvested All proteins were resolved on 10%

SDS denatured polyacrylamide gel and then transferred

onto a nitrocellulose membrane Membranes with

anti-(NF-jB1) serum or anti-GAPDH serum were incubated

with blotting overnight at 4C Membranes were then washed and incubated with horseradish peroxidase-conju-gated secondary antibody Protein expression was assessed

by enhanced chemiluminescence and exposure to chemilu-minescent film Lab Works Image Acquisition and Ana-lysis Software (UVP, Upland, CA, USA) were used to quantify band intensities Antibodies were purchased from Saier Inc (Tianjin, China) or Sigma-Aldrich (St Louis, MO, USA)

Statistical analysis

Statistical analysis utilized two-tailed Student’s t-test Statis-tical significance was set as P < 0.05

Acknowledgements

We thank the Tumor Bank Facility of Tianjin Medical University Cancer Institute and Hospital and National Foundation of Cancer Research for providing human ovarian cancer samples We also thank the College of Public Health of Tianjin Medical University for the technical assistance in fluorescent detection This work was supported by the National Natural Science Foundation of China (NO: 30873017) and the Natural Science Foundation of Tianjin (NO: 08JCZDJC23300 and 09JCZDJC17500)

References

1 Corney DC & Nikitin AY (2008) MicroRNA and ovarian cancer Histol Histopathol 23, 1161–1169

2 Lee RC, Feinbaum RL & Ambros V (1993) The

C elegansheterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14 Cell 75, 843–854

3 Lee RC & Ambros V (2001) An extensive class of small RNAs in Caenorhabditis elegans Science 294, 862–864

4 Lau NC, Lim LP, Weinstein EG & Bartel DP (2001) An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans Science 294, 858–862

5 Lagos-Quintana M, Rauhut R, Lendeckel W & Tuschl

T (2001) Identification of novel genes coding for small expressed RNAs Science 294, 853–858

6 Pillai RS, Bhattacharyya SN & Filipowicz W (2007) Repression of protein synthesis by miRNAs: how many mechanisms? Trends Cell Biol 17, 118–126

7 Nilsen TW (2007) Mechanisms of microRNA-mediated gene regulation in animal cells Trends Genet 23, 243–249

8 Croce CM & Calin GA (2005) miRNAs, cancer, and stem cell division Cell 122, 6–7

9 Chen CZ, Li L, Lodish HF & Bartel DP (2004) MicroRNAs modulate hematopoietic lineage differ-entiation Science 303, 83–86

Trang 10

M et al (2005) MicroRNA gene expression

deregula-tion in human breast cancer Cancer Res 65, 7065–7070

11 Yanaihara N, Caplen N, Bowman E, Seike M,

Kumam-oto K, Yi M, Stephens RM, OkamKumam-oto A, Yokota J,

Tanaka T et al (2006) Unique microRNA molecular

profiles in lung cancer diagnosis and prognosis Cancer

Cell 9, 189–198

12 Calin GA, Liu CG, Ferracin M, Hyslop T, Spizzo R,

Sevignani C, Fabbri M, Cimmino A, Lee EJ, Wojcik

SE et al (2007) Ultraconserved regions encoding

ncR-NAs are altered in human leukemias and carcinomas

Cancer Cell 12, 215–229

13 Akao Y, Nakagawa Y & Naoe T (2007)

MicroRNA-143 and -145 in colon cancer DNA Cell Biol 26,

311–320

14 Visone R, Pallante P, Vecchione A, Cirombella R,

Ferracin M, Ferraro A, Volinia S, Coluzzi S, Leone V,

Borbone E et al (2007) Specific microRNAs are

down-regulated in human thyroid anaplastic carcinomas

Oncogene 26, 7590–7595

15 Bloomston M, Frankel WL, Petrocca F, Volinia S, Alder

H, Hagan JP, Liu CG, Bhatt D, Taccioli C & Croce CM

(2007) MicroRNA expression patterns to differentiate

pancreatic adenocarcinoma from normal pancreas and

chronic pancreatitis JAMA 297, 1901–1908

16 Johnson SM, Grosshans H, Shingara J, Byrom M,

Jarvis R, Cheng A, Labourier E, Reinert KL, Brown D

& Slack FJ (2005) RAS is regulated by the let-7

micro-RNA family Cell 120, 635–647

17 Mayr C, Hemann MT & Bartel DP (2007) Disrupting

the pairing between let-7 and Hmga2 enhances

onco-genic transformation Science 315, 1576–1579

18 Liu T, Tang H, Lang Y, Liu M & Li X (2009)

MicroRNA-27a functions as an oncogene in gastric

adenocarcinoma by targeting prohibitin Cancer Lett

273, 233–242

19 Mertens-Talcott SU, Chintharlapalli S, Li X & Safe S

(2007) The oncogenic microRNA-27a targets genes that

regulate specificity protein transcription factors and the

G2–M checkpoint in MDA-MB-231 breast cancer cells

Cancer Res 67, 11001–11011

Biol 302, 1–12

21 Laios A, O’Toole S, Flavin R, Martin C, Kelly L, Ring

M, Finn SP, Barrett C, Loda M, Gleeson N et al (2008) Potential role of miR-9 and miR-223 in recurrent ovarian cancer Mol Cancer 7, 35, doi:10.1186/1476-4598-7-35

22 Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP & Bartel DP (2007) MicroRNA targeting speci-ficity in mammals: determinants beyond seed pairing Mol Cell 27, 91–105

23 Perkins ND (2004) NF-kappaB: tumor promoter or suppressor? Trends Cell Biol 14, 64–69

24 Lehmann U, Hasemeier B, Christgen M, Muller M, Romermann D, Langer F & Kreipe H (2008) Epigenetic inactivation of microRNA gene hsa-mir-9-1 in human breast cancer J Pathol 214, 17–24

25 Zhang L, Huang J, Yang N, Greshock J, Megraw MS, Giannakakis A, Liang S, Naylor TL, Barchetti A, Ward

MR et al (2006) microRNAs exhibit high frequency genomic alterations in human cancer Proc Natl Acad Sci USA 103, 9136–9141

26 Stark A, Brennecke J, Russell RB & Cohen SM (2003) Identification of Drosophila microRNA targets PLoS Biol 1, E60

27 Lewis BP, Shih IH, Jones-Rhoades MW, Bartel DP & Burge CB (2003) Prediction of mammalian microRNA targets Cell 115, 787–798

28 Kiriakidou M, Nelson PT, Kouranov A, Fitziev P, Bouyioukos C, Mourelatos Z & Hatzigeorgiou A (2004)

A combined computational–experimental approach pre-dicts human microRNA targets Genes Dev 18, 1165– 1178

29 Hayden MS & Ghosh S (2004) Signaling to NF-kappaB Genes Dev 18, 2195–2224

30 Luo JL, Kamata H & Karin M (2005) IKK⁄ NF-kappaB signaling: balancing life and death – a new approach to cancer therapy J Clin Invest 115, 2625– 2632

31 Kucharczak J, Simmons MJ, Fan Y & Gelinas C (2003)

To be, or not to be: NF-kappaB is the answer – role of Rel⁄ NF-kappaB in the regulation of apoptosis Onco-gene 22, 8961–8982

Ngày đăng: 07/03/2014, 00:20

TỪ KHÓA LIÊN QUAN

TÀI LIỆU CÙNG NGƯỜI DÙNG

TÀI LIỆU LIÊN QUAN

🧩 Sản phẩm bạn có thể quan tâm