Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc

signalling process involving Rac GTPase and the RINGfinger protein Unkempt Patrick Lore`s1,2,*, Orane Visvikis1,2,*, Rosa Luna1,2, Emmanuel Lemichez3,4and Ge´rard Gacon1,2 1 Institut Coc

signalling process involving Rac GTPase and the RING

finger protein Unkempt

Patrick Lore`s1,2,*, Orane Visvikis1,2,*, Rosa Luna1,2, Emmanuel Lemichez3,4and Ge´rard Gacon1,2

1 Institut Cochin, Universite´ Paris Descartes, CNRS (UMR8104), Paris, France

2 INSERM, U567, Paris, France

3 INSERM, U895, Centre Me´diterrane´en de Me´decine Mole´culaire, C3M, Toxines Microbiennes dans la relation hoˆte pathoge`nes, Nice, France

4 Universite´ de Nice Sophia-Antipolis, UFR Me´decine, Nice, France

Keywords

BAF60; Rac GTPase; RING finger; SWI ⁄ SNF

complex; ubiquitination

Correspondence

G Gacon, De´partement Ge´ne´tique et

De´veloppement, Institut Cochin, 24 rue du

Faubourg Saint-Jacques, 75014 Paris,

France

Fax: +33 1 44 41 24 48

Tel: +33 1 44 41 24 70

E-mail: gerard.gacon@inserm.fr

*These authors contributed equally to this

work

(Received 4 September 2009, revised 30

November 2009, accepted 8 January

2010)

doi:10.1111/j.1742-4658.2010.07575.x

The SWI⁄ SNF chromatin remodelling complexes are important regulators

of transcription; they consist of large multisubunit assemblies containing either Brm or Brg1 as the catalytic ATPase subunit and a variable subset of approximately 10 Brg⁄ Brm-associated factors (BAF) Among these factors, BAF60 proteins (BAF60a, BAF60b or BAF60c), which are found in most complexes, are thought to bridge interactions between transcription factors and SWI⁄ SNF complexes We report here on a Rac-dependent process leading to BAF60b ubiquitination Using two-hybrid cloning procedures,

we identified a mammalian RING finger protein homologous to drosophila Unkempt as a new partner of the activated form of RacGTPases and dem-onstrated that mammalian Unkempt specifically binds to BAF60b and pro-motes its ubiquitination in a Rac1-dependent manner Immunofluorescence studies demonstrated that Unkempt is primarily localized in the cytoplasmic compartment, but has the ability to shuttle between the nucleus and the cytoplasm, suggesting that the Rac- and Unkempt-dependent process lead-ing to BAF60b ubiquitination takes place in the nuclear compartment Ubiquitinated forms of BAF60b were found to accumulate upon treatment with the proteasome inhibitor MG132, indicating that BAF60b ubiquitina-tion is of the degradative type and could regulate the level of BAF60b in SWI⁄ SNF complexes Our observations support the new idea of a direct connection between Rac signalling and chromatin remodelling

Structured digital abstract

l MINT-7543606 : Rac1 (uniprotkb: P63000 ) physically interacts ( MI:0915 ) with Unkempt (uni-protkb: B1GXI8 ) by two hybrid ( MI:0018 )

l MINT-7543198 : Unkempt (uniprotkb: B1GXI8 ) physically interacts ( MI:0915 ) with Rac1 (uni-protkb: P63000 ) by pull down ( MI:0096 )

l MINT-7543251 : Unkempt (uniprotkb: B1GXI8 ) physically interacts ( MI:0915 ) with BAF60b (uniprotkb: B4DV56 ) by pull down ( MI:0096 )

l MINT-7543745 : Unkempt (uniprotkb: B1GXI8 ) physically interacts ( MI:0915 ) with BAF60b (uniprotkb: B4DV56 ) by two hybrid ( MI:0018 )

l MINT-7543182 : Ubiquitin (uniprotkb: P61864 ) physically interacts ( MI:0915 ) with Unkempt (uniprotkb: B1GXI8 ) by pull down ( MI:0096 )

l MINT-7543805 : Ubiquitin (uniprotkb: P61864 ) physically interacts ( MI:0915 ) with Unkempt (uniprotkb: Q6RUT6 ) by pull down ( MI:0096 )

l MINT-7543760 : Ubiquitin (uniprotkb: P61864 ) physically interacts ( MI:0915 ) with BAF60b (uniprotkb: B4DV56 ) by pull down ( MI:0096 )

Abbreviations

BAF, Brg ⁄ Brm-associated factor; GST, glutathione S-tranferase; HA, hemagglutinin; UNK-C-ter, Unkempt C-terminal region; UNK-fl, full-length Unkempt; shRNA, short hairpin RNA.

The SWI⁄ SNF chromatin remodelling complexes are

evolutionary conserved multimeric enzymes using ATP

hydrolysis to mobilize nucleosomes and remodel

chromatin structure [1–4]; these complexes are large

multisubunit assemblies containing either Brm or Brg1

as the catalytic ATPase subunit and a variable subset

of approximately 10 Brg⁄ Brm-associated factors

(BAF) Among the later, the 60 kDa subunit BAF60 is

found in most complexes; it can be represented by

BAF60a, BAF60b or BAF60c, which are encoded by

the smarcd1, smarcd2 and smarcd3 genes, respectively

[1] BAF60 proteins have been shown to interact with

multiple transcription factors and are thought to

bridge interactions between these transcription factors

and SWI⁄ SNF complexes, thereby allowing the

recruit-ment of SWI⁄ SNF to target genes [5–9]

Biochemical purification and analysis of SWI⁄ SNF

complexes have revealed that few to no free subunits are

present within the cells, suggesting that most, if not all,

subunits are assembled into the complexes [1] Thus,

cells must co-ordinate the expression and degradation of

SWI⁄ SNF subunits in order to maintain the

stoichiome-try of the complexes Recent studies have demonstrated

the role of protein–protein interactions, ubiquitination

and proteasomal degradation in regulating SWI⁄ SNF

subunit levels [10,11] However, the mechanisms leading

to ubiquitination of specific SWI⁄ SNF subunits and

their regulation have not been molecularly defined

Ubiquitination consists of the covalent attachment

to proteins of ubiquitin, a highly conserved 76 amino

acid polypeptide It is catalysed by three enzymes: a

ubiquitin-activating enzyme (E1), a

ubiquitin-conjugat-ing enzyme (E2) and a ubiquitin protein ligase (E3),

acting sequentially to form an isopeptide bond between

the ubiquitin C-terminus and the e-amino group of

lysines of the protein substrate; ubiquitin contains

seven lysine residues that can be attached to other

ubiquitins in a highly processive reaction to form a

polyubiquitin chain [12,13] The specificity of protein

ubiquitination is conferred by E3 ligases, which have

the ability to bind both to an E2 and to the substrate;

consistently, in contrast to two E1 genes and less than

40 E2 genes, a genome-wide annotation of human E3

ligases recently identified more than 600 genes

encod-ing putative E3s, the vast majority of which exhibit a

RING finger domain [14] Ubiquitination, which was

initially found to target proteins to proteasomal

degra-dation, has emerged more recently as a central

regula-tory mechanism that controls not only protein

stability, but also localization, interactions and

func-tions of modified proteins [15,16]

We report here on the occurrence of BAF60 ubiqui-tination We have identified and characterized a signal-ling process involving Rac GTPase and a novel partner of activated Rac, the RING finger protein Unkempt, which binds to BAF60b and promotes its specific ubiquitination

Results

Unkempt protein binds specifically to activated forms of RacGTPases

In a two-hybrid screen for partners of activated RacGTPase, we isolated a human cDNA sequence with a partial ORF showing a strong homology with a previously described drosophila protein, d-Unkempt [17], and with Unkempt-like sequences from human and mouse origin (accession UniProtKB⁄ TrEMBL Q9H9P5 and Q6RUT6, respectively) Northern blot analysis revealed ubiquitous expression of a 4.4 kb mRNA in mouse tissues (not shown) Iterative 5¢ RACE PCR amplification starting from mouse and human RNA resulted in ORFs encoding two predicted proteins of 678 and 680 amino acids, respectively, with quasi-identical sequences (87% identity; 95% similar-ity) and significant homology with the full-length dro-sophila d-Unkempt (40% identity; 64% similarity) (Fig 1A) The novel human mRNA sequence that encodes the 680 amino acid Unkempt-like protein has been assigned the accession number AM944365 by the EMBL nucleotide sequence database Alignment of drosophila Unkempt protein with mouse and human Unkempt-like sequences revealed conserved zinc finger motifs in the N-terminal part of the protein and a RING finger at the C-terminal end (Fig 1A) For further studies, we constructed plasmids encoding glutathione S-transferase (GST)- and hemagglutinin (HA)-tagged human Unkempt C-terminal region C-ter) and murine full-length Unkempt (UNK-fl), as well as mutated versions of these proteins, as shown in Fig 1B

Interestingly, the putative interaction between acti-vated Rac and UNK-C-ter could be validated by GST pull-down experiments Indeed, the results confirmed the specificity of the binding of activated Rac to UNK-C-ter, as the GTP-bound form Rac1L61 showed

a strong binding to UNK-C-ter, whereas Rac1 WT (predominantly GDP bound) and Rac1N17 (a domi-nant negative form of Rac) did not interact with UNK-C-ter (Fig 2) and neither RhoAL63 nor Cdc42L61, i.e the activated forms of archetypal

mem-bers of Rho and Cdc42 subfamilies, was able to bind

to UNK-C-ter (Fig 2) Of note, the disruption of the

RING finger in the mutant form UNK-C-ter double

mutant (C639A⁄ C670A double mutant) did not impair

the binding of RacGTP

The data indicate that Unkempt is a specific partner

of the GTP-bound form of RacGTPases and therefore

suggest that its function, whatever it is, may be

regulated by Rac signalling

Little is known about the role of Unkempt in

dro-sophila: homozygous inactivation of d-unkempt

resulted in larval lethality, whereas heterozygous flies

bearing an hypomorphic allele showed roughened eyes,

splayed wings and crossed scutellar bristles, i.e the so-called Unkempt phenotype [17] Moreover, the biochemical activity of d-Unkempt protein has not been documented

Unkempt ubiquitination is stimulated by activated Rac

As mentioned above (Fig 1A, B), Unkempt contains

in its C-terminal region a conserved RING finger,

a motif that is typical of a large group of E3 ubiquitin ligases known as RING E3s [14,18]; this prompted us

to investigate whether self-ubiquitination and ubiquitin

A

B

Fig 1 Structure of Unkempt proteins (A) Sequence alignment of human, mouse and drosophila Unkempt proteins Triple identity is shown

in red, double identity in orange Zinc finger and RING finger motifs are indicated by blue and green bars, respectively, the conserved C ⁄ H being indicated by asterisks The position of the C-terminal RING finger deletion in UNK-fl-DRF is indicated by a red arrowhead (B) Sche-matic representation of the Unkempt-derived proteins used in the present study Zinc finger and RING finger motifs are in dark and light grey, respectively The C to A mutations of the RING finger in UNK-C-ter double mutant (UNK-C-ter-DM) are indicated.

ligase activity were associated with mammalian

Unkempt

HA-tagged versions of Unkempt and 6-His-tagged

ubiquitin were coexpressed in cultured cells and the

resulting 6-His-tagged ubiquitinated proteins were

col-lected on cobalt beads and analysed by western

blot-ting Following this procedure, we were able to

demonstrate Unkempt ubiquitination in various cell

lines, including CHO, HEK 293 (not shown) and HeLa

As shown in Fig 3A, UNK-C-ter ubiquitination

was clearly detected in HeLa cells; interestingly, the

ubiquitination pattern was enhanced by activated

Rac1(Rac1L61) and decreased by the dominant

nega-tive mutant Rac1N17, thus suggesting that Rac

activa-tion positively regulates Unkempt ubiquitinaactiva-tion Of

note, the substitution of two cysteine residues in the

RING finger motif (C639A⁄ C670A double mutant; see

Fig 1B) did not drastically impair UNK-C-ter

ubiqui-tination; the stimulating effect of activated Rac was

also maintained in the mutant (Fig 3A) Analysis of

UNK-fl ubiquitination led to similar observations, as

shown in Fig 3B: UNK-fl ubiquitination was found to

be inhibited by Rac1N17 and stimulated by activated

Rac1 and deletion of the RING finger in UNK-fl

(UNK-fl DRF) did not abrogate, but rather enhanced,

ubiquitination and did not alter the stimulating effect

of activated Rac

In all cases, proteasome inhibition through MG132 treatment resulted in the accumulation of ubiquitinated forms (as illustrated for UNK-C-ter in Fig 3A) Collectively, the above data indicate that Unkempt does undergo ubiquitination; this process is clearly up-regulated by activated Rac Surprisingly, the RING finger domain appears to be dispensable for Unkempt ubiquitination, thus suggesting the involvement of partner protein(s) contributing Ubiquitin ligase activ-ity In this connection, it is noteworthy that several

Fig 2 Unkempt interacts specifically with activated Rac GTPase.

HeLa cells were transfected with plasmids encoding myc-tagged

GTPases RhoA, Rac1 and Cdc42, either wild-type (Rac1WT and

Cdc42WT), inactive mutant form (Rac1N17) or activated mutant

forms (RhoAL63, Rac1L61, Cdc42L61).The expression level of

GTP-ases in total cellular lysates is shown (input) The GTPGTP-ases were

extracted from lysates with GST-UNK-C-ter (WT or RING finger

double mutant) beads, or with GST beads as a control, and

pull-down proteins were revealed by anti-myc western blotting

(pull-down) The results are representative of three experiments.

A

B

Fig 3 Ubiquitination of Unkempt is dependent on activated Rac Ubiquitination of Unkempt was assessed by transfecting HeLa cells with a combination of expression plasmids encoding 6His-Ub, myc-Rac1L61 ⁄ N17 and HA-UNK-C-ter or HA-UNK-fl as indicated Ubiquitinated proteins were extracted on cobalt beads and immu-noblotted with anti-HA IgG The expression of transfected proteins was monitored on total protein extracts by immunoblotting using the indicated antibodies Where indicated, cells were treated with the proteasome inhibitor MG132 for 4 h prior to lysis (A) Ubiquiti-nation of UNK-C-ter WT, UNK-C-ter wild-type; DM, UNK-C-ter dou-ble mutant C639A, C670A (B) Ubiquitination of UNK-fl WT, UNK-fl wild-type; DRF, UNK-fl with RING finger deletion The results are representative of at least three experiments.

RING finger proteins devoid of intrinsic ubiquitin

ligase activity have been found to form oligomeric

complexes, especially with other RING finger proteins,

resulting in active E3 ligases [19–22]

We therefore reasoned that Unkempt may

partici-pate in a protein complex showing an E3 ligase

activity regulated by Rac and directed towards

Unkempt itself and possibly other substrates to be

identified

BAF60b, a component of the SWI⁄ SNF chromatin

remodelling complex, shows a Rac⁄

Unkempt-dependent ubiquitination

In a search for Unkempt interacting proteins, a

two-hybrid screen using UNK-C-ter as bait allowed

the isolation of several independent cDNA clones

encoding the C-terminal part of BAF60b⁄ SMARCD2 (see Materials and methods, and Fig 4A); BAF pro-teins are constitutive of the SWI⁄ SNF multiprotein chromatin remodelling complexes that contain either Brm or Brg1 as the core ATP hydrolysing subunit [1–3] BAF60a, b and c are homologous proteins, thought to bridge interactions between transcription factors and SWI⁄ SNF complexes [5–9]

Despite the overall homology among BAF60 family members, pull-down experiments demonstrated a clear interaction of UNK-C-ter only with BAF60b (Fig 4B) Sequencing our BAF60a, b and c encoding plasmids revealed significant differences between BAF60b and both BAF60a and BAF60c within the region involved in UNK-C-ter interaction, which could explain their differential binding (Fig 4A) Substitution of two conserved cysteine residues in the

A

B

Fig 4 BAF60 proteins and their interactions with UNK-C-ter (A) Sequence alignment of human BAF60a, b and c proteins used in the pres-ent study Triple idpres-entity is indicated in red, double idpres-entity in orange The region of BAF60b involved in UNK-C-ter interaction, as mapped from two-hybrid clones, is underlined (green bar) (B) UNK-C-ter interacts specifically with BAF60b HeLa cells were transfected with expres-sion plasmids encoding FLAG-tagged BAF60a, b or c Proteins were extracted from lysates with GST-UNK-C-ter (WT or RING finger double mutant) beads, or by GST beads as a control, and pull-down proteins were revealed by anti-FLAG western blotting Identical results were obtained in two independent experiments.

RING finger motif of UNK-C-ter (C639A⁄ C670A

double mutant) did not significantly alter the binding of

BAF60b (Fig 4B)

Considering that BAF60b may be a partner of

Unkempt, we investigated BAF60b ubiquitination and

its regulation by Rac and Unkempt Attempts to

detect the ubiquitinated fraction of endogenous

BAF60b were unsuccessful, possibly due to the low

sensitivity of available antibodies (not shown)

There-fore, a FLAG-tagged version of BAF60b was

expressed in HeLa cells, and the resulting ubiquitina-tion of FLAG-BAF60b could be analysed

As illustrated in Fig 5A, ubiquitinated forms of BAF60b were detected in HeLa cells in the absence of ectopic expression of Unkempt; they were found to accumulate upon treatment with the proteasome inhibi-tor MG132, indicating that BAF60b ubiquitination is at least partly of the degradative type Interestingly, simi-lar patterns of BAF60b ubiquitination were observed

in HEK 293 and CHO cell lines (Fig 5A) Most

Fig 5 Ubiquitination of BAF60b (A) Ubiquitinated BAF60b is detected in HeLa, HEK 293 and CHO-K1 cells in the absence of exogenous Unkempt and accumulates upon treatment with proteasome inhibitor MG132 Ubiquitination of BAF60b was assessed by transfecting cells with plasmids encoding 6His-Ub and FLAG-BAF60b; where indicated, cells were treated with the proteasome inhibitor MG132 for 4 h prior

to lysis Ubiquitinated proteins were collected on cobalt beads and immunoblotted with anti-FLAG IgG (B) BAF60b ubiquitination is downreg-ulated by an Unkempt-specific shRNA HeLa cells were transfected with pSUPER plasmids containing either no additional sequence (h), a scrambled sequence (SCR) or an Unkempt targeting sequence (UNK) prior to performing ubiquitination assays (see Experimental procedures for details and sequences) The same experiment was performed four times with similar results (C) BAF60b is the preferred substrate of Unkempt-dependent ubiquitination Ubiquitination of BAF60a, b and c was assessed by transfecting HeLa cells with a combination of expres-sion plasmids encoding 6His-Ub, FLAG-BAF60a, b or c, and HA-UNK-C-ter Ubiquitinated proteins were collected on cobalt beads and immu-noblotted with anti-FLAG Ig Where indicated, cells were treated with the proteasome inhibitor MG132 for 4 h prior to lysis (D) BAF60b ubiquitination is strongly dependent on Rac activation Ubiquitination assays were carried out as previously described, in HeLa cells express-ing either no exogenous Unkempt, UNK-C-ter, or UNK-fl and Rac1N17 or Rac1L61, as indicated The results are representative of at least three experiments.

importantly, in HeLa cells, the expression of an

Unkempt-specific short hairpin RNA (shRNA) led to a

more than 80% knockdown of Unkempt mRNA, as

measured by semiquantitative RT-PCR, and resulted in

a clear decrease in the amount of ubiquitinated BAF60b

(Fig 5B), implying that endogenous Unkempt is

involved in BAF60b ubiquitination

As expected, expression of UNK-C-ter resulted in

enhanced ubiquitination of BAF60b (Fig 5C, left

panel); of note, ubiquitination assays run in parallel

with BAF60a, b and c demonstrated that, in agreement

with interaction studies (see Fig 4), BAF60b is the

preferred substrate of Unkempt-dependent

ubiquitina-tion Similar to the pattern observed in the absence of

ectopic expression of Unkempt (Fig 5A),

ubiquiti-nated forms of BAF60b generated in the presence of

UNK-C-ter strongly accumulated upon MG132

treat-ment (Fig 5C, right panel)

Next, we analysed the effects of Rac activation on

BAF60b ubiquitination When coexpressed with the

dominant negative mutant Rac1N17 (i.e in the

absence of activated Rac), BAF60b was poorly

ubiqui-tinated; by contrast, the ubiquitination profile was

strikingly enhanced by coexpression of Rac1L61

(Fig 5D, lane 1 versus 4) Similarly, in the presence of

exogenous Unkempt, either UNK-C-ter or UNK-fl,

the amount of BAF60b ubiquitination appeared

strongly dependent on Rac activation (Fig 5D, lane 2

versus 5 and lane 3 versus 6) Interestingly, the

stimu-lation of BAF60b ubiquitination could be replicated

by treating HeLa cells with CNF1, a toxin from

uro-pathogenic Escherichia coli known to strongly activate

endogenous Rac [23], thus confirming the results of

ectopic expression of activated Rac (not shown)

Although Unkempt seems to play a critical role in

BAF60b ubiquitination, it is noteworthy that

muta-ted⁄ deleted forms UNK-C-ter and UNK DRF retained

full efficiency in BAF60b ubiquitination and

Rac-dependent regulation (Fig S1), thus suggesting that

the RING finger domain of ectopically expressed

Unkempt is not critical for these effects

The above data indicate that BAF60b ubiquitination

is an Unkempt-dependent process and is tightly

regu-lated by Rac GTPase

Unkempt protein shuttles between cytosolic and

nuclear compartments in HeLa cells

Assuming that BAF60b is ubiquitinated through a

process depending on Unkempt and activated Rac, the

question arises of the cellular compartment where this

process takes place Indeed, although Rac activation is

believed to occur primarily at the plasma membrane,

BAF60b, as well as BAF60a and BAF60c, were found,

as expected, entirely localized to the nuclear compart-ment (Fig 6A) Conversely, UNK-fl was detected mostly in the cytosol; however, it was found to accu-mulate in the nucleus upon treatment of the cells with leptomycin B, a specific inhibitor of the nuclear export protein exportin 1 (Fig 6B) This observation is strong evidence that UNK-fl has the ability to shuttle between the nucleus and the cytoplasm and can therefore reach its putative substrate BAF60b in the nuclear compart-ment Interestingly in this regard, several studies have reported on the localization of Rac1GTPase in the nuclear compartment; specifically, it has been shown that the polybasic sequence in the Rac1 C-terminal region behaves like an active nuclear localization signal (NLS) [24] Moreover, Rac1, in association with Mgc-RacGAP, has also been implicated in the nuclear entry

of signal transducer and activator of transcription (STAT) transcription factors [25] Finally, recent studies have convincingly demonstrated a cell cycle-dependent modulation of the amount of Rac1 in the nucleus (i.e accumulation in late G2 and exclusion in early G1) [26] These results prompted us to investigate whether the binding of activated Rac might influence the shuttling of Unkempt between cytosol and nucleus:

so far we have not been able to demonstrate any dif-ferential effect of Rac1L61 or Rac1N17 on nuclear accumulation of Unkempt (not shown)

However, taken together, these data support the idea that Rac and Unkempt can translocate in the nuclear compartment and activate BAF60b ubiquitination; how these processes are co-ordinated remains to be analysed

Discussion

Although the results reported above are consistent with BAF60b being ubiquitinated through a Rac- and Unkempt-dependent process, the molecular composi-tion of the E3 ligase involved and the role of Unkempt RING finger remain uncertain On the basis of the results of a mutational analysis (Figs 3 and S1), it appears that the RING finger of exogenously expressed Unkempt is not critically involved in the ubiquitination reaction A possible explanation is that exogenously expressed mutants of Unkempt form dimers⁄ oligomers with endogenous Unkempt and ⁄ or associates with other RING finger protein(s), resulting

in active E3 ligase As already mentioned, there are multiple examples of RING E3s, the activity of which critically depends on multiprotein complexes, including homo- or hetero-oligomers of RING finger proteins

Of note, interaction between RING finger proteins

does not necessarily depend on the RING finger motif

itself Thus, yBRE1, a RING finger protein involved

in H2B ubiquitination in budding yeast, forms a

homomeric complex, possibly a tetramer, through

multiple intermolecular interactions, implicating only

minimally the C-terminal RING finger [27] Similarly,

in human, the RING finger type paralogs hBRE1A

and hBRE1B form a heterotetramer and are both

required for H2B ubiquitination, but the hBRE1B

RING finger is dispensable [28] Another interesting

example is provided by Pirh2, a p53-induced RING

finger E3 ligase promoting ubiquitination and

degrada-tion of p53; very recently, isoforms of Pirh2 with a

dis-rupted RING finger motif have been found capable of

promoting p53 ubiquitination, possibly through their

ability to interact directly with MDM2, the principal

E3 ligase for p53 [24,29] The RING finger protein

Unkempt may share similarities with these models We

have recently observed that UNK-C-ter is capable of

forming homomeric complexes in GST pull-down

experiments (unpublished results); however, it remains

to be demonstrated that an E3 ligase activity is

associ-ated with Unkempt homomers (or with heteromers involving an unidentified RING finger protein) and whether and how RacGTP regulates this putative E3 ligase To address these issues, in vitro studies aimed at analysing intrinsic E3 ligase activity of recombinant Unkempt will be required

Our results also raise the questions of the physiolog-ical relevance and significance of BAF60b ubiquitina-tion Unfortunately, using available antibodies to BAF60b, we were not able to detect ubiquitinated forms of endogenous BAF60b However, in HeLa cells expressing exogenous BAF60b, we found that BAF60b

is significantly ubiquitinated, even in the absence of exogenous Unkempt; in addition, the ubiquitinated forms of BAF60b strongly accumulated in the presence

of MG132, suggesting that the fate of ubiquitinated BAF60b is proteasomal degradation Thus, it may be that ubiquitination results in degradation of an excess

of BAF60b subunits, thereby allowing the stoichiome-try of SWI⁄ SNF complexes to be maintained Another interesting possibility would be that BAF60b, alone or

in complex with Unkempt, interacts with other

uniden-A

Unkempt proteins (A) Nuclear localization of BAF60 proteins HeLa cells were trans-fected with FLAG-BAF60a, b or c, and FLAG immunofluorescence was carried out on fixed cells the following day (B) Nucleocyto-plasmic shuttling of Unkempt HeLa cells were transfected with HA-UNK-fl expression vector, and left untreated or treated over-night with the nuclear export inhibitor lepto-mycin B (LMB) Unkempt accumulated in the cytoplasm of untreated cells (upper panels), but could also be detected in the nucleus of LMB-treated cells (lower panels).

tified substrates of Unkempt-dependent E3 ligase As

previously mentioned, BAF60 proteins are thought to

bridge interactions between transcription factors and

SWI⁄ SNF complexes [5–9]; therefore, candidate

sub-strates include other constituents of SWI⁄ SNF

com-plexes, some of which have been found to be regulated

by proteasomal degradation [10,11], and transcription

factors targeted by BAF60b that remain to be defined

Whatever the precise mechanisms are, Unkempt

may be importantly linked to the physiological control

of the SWI⁄ SNF complexes, thus opening up a direct

connection between Rac signalling and chromatin

remodelling

Experimental procedures

cDNA cloning

Two-hybrid cloning procedures using RacL61 as a bait to

screen a Jurkat cDNA library have been previously

described [30] Among others, we isolated a series of

overlap-ping clones homologous to drosophila Unkempt [17]

Several rounds of 5¢ RACE were performed (5¢RACE

System; Invitrogen, Carlsbad, CA, USA) to complete the

human and mouse cDNA sequences, using as templates

human and mouse polyA+-enriched fractions extracted from

peripheral blood leukocytes and kidney, respectively cDNA

sequences deduced from sequencing overlapping 5¢ RACE

fragments were confirmed by resequencing both strands of

the complete cDNAs amplified by PCR (Access

RT-PCR System; Promega, Madison, WI, USA) using 5¢- and

3¢-specific primers

In the search for Unkempt-interacting proteins, a human

placental cDNA library was screened with UNK-C-ter as

the bait (Hybrigenics S.A., Paris, France); this resulted in

the isolation of four ‘high confidence’-independent clones

encoding overlapping regions of hSMARCD2⁄ BAF60b

DNA plasmids and mutagenesis

Mouse and human Unkempt cDNA were inserted in

N-ter-HA pcDNA-3 (Invitrogen) and in pGEX-4T2 (Pharmacia,

Pfizer, New York, NY, USA) plasmid vectors

A RING finger deletion mutant was generated from the

full-length sequence in pCDNA3 by NcoI digestion,

Kle-now extremities fill-in and re-ligation Human cDNAs of

WTRac1 and WTCdc42, dominant negative mutant

Rac1N17 and constitutively activated forms Rac1L61,

Cdc42L61 and RhoAL63, cloned in pRK5-myc plasmids

were obtained from A Hall (Memorial Sloan-Kettering

Cancer Center, New York, NY, USA); the

pRBG4-6His-myc-Ub plasmid has been used previously [31,32]

Expres-sion vectors encoding FLAG-BAF60a, b and c were

generated by inserting BAF60a, b and c cDNAs (a gift

from W Wang, National Institutes of Health, Baltimore,

MD, USA) into a p3XFLAG-myc-CMV-24 expression vector (Sigma, St Louis, MO, USA)

The point mutations were generated with primers 5¢CCGCTCCCGGCAGGCCACAGCCTGCCTGGCGCG GAGCTGG (for C639A mutation) and 5¢CCTTGCAG TAGGGGGCCTCAGGTGCGGTGGC (for C670A muta-tion) and their respective reverse complement primers, using the QuickChange-Site Directed Mutagenesis Kit (Strata-gene, La Jolla, CA, USA) following the manufacturer’s procedure In all cases, the absence of additional mutations was verified by sequencing the entire coding region

Unkempt mRNA silencing pSUPER.basic (Oligoengine, Seattle, WA, USA) was used

as a shRNA expression vector, to target the Unkempt mRNA sequence 5¢GCAGAACCACCTGGCCGTG The scrambled sequence 5¢CGGACCGGACTTCGACGCAC was used as a control The construction of pSUPER vectors was carried out following the manufacturer’s instructions In silencing experiments, HeLa cells were transfected twice with pSUPER plasmids (with a 24 h inter-val) and RNAs were extracted 24 h after the second trans-fection, using RNAxel (Eurobio, Les Ulis, France) Unkempt cellular mRNA levels were monitored by RT-PCR (Access RT-PCR system; Promega, Madison, WI, USA) using Unkempt-specific primers 5¢TCTTCGAGTG CAAGTCCAAA and 5¢AAGATCACCTGTGCCTCCAC, and normalized against endogenous glutamic acid decar-boxylase mRNA levels, detected by RT-PCR with specific primers 5¢GTCAGCCGCATCTTCTTTTG and 5¢GCAGA GATGATGACCCTTT

Cell culture, reagents and transfections HeLa (ATCC reference CCL-2), HEK 293 (ATCC reference CRL-1573) and CHO-K1 (ATCC reference CCL-61) cells were grown in Dulbecco’s modified Eagle’s medium (Gibco-BRL, Rockville, MD, USA) supplemented with 10% fetal bovine serum (Gibco-BRL), 100 lgÆmL)1 streptomycin,

100 lgÆmL)1 penicillin and 250 ngÆmL)1 fungizone (Gibco-BRL), in a humidified atmosphere of 5% CO2 at 37C Where indicated, cells were treated with proteasome inhibitor MG132 20 lm (Sigma) for 4 h Cells were transiently trans-fected using FuGENE 6 Transfection Reagent (Roche, Basel, Switzerland) following the manufacturer’s instructions

Antibodies The primary antibodies used were M2 mouse monoclonal antibody to FLAG epitope (Sigma), 9E10 mouse clonal antibody to myc-tag (Roche), 16B12 mouse mono-clonal antibody to HA-tag (Roche)

For western blotting, the secondary

peroxidase-conju-gated rabbit anti-mouse IgG (Dako, Glostrup, Denmark),

the secondary peroxidase-conjugated swine anti-rabbit IgG

(Dako) or the secondary peroxidase-conjugated rabbit

goat IgG (Dako) were used The secondary fluorescent

anti-body used in immunofluorescence studies was Alexa Fluor

488-labelled goat anti-mouse IgG (Molecular Probes,

Eugene, OR, USA)

Western blotting

Proteins were resolved in SDS⁄ PAGE mini-gels and

electro-transferred onto BA85 nitrocellulose membranes (Schleicher

& Schuell, Millipore, Billerica, MA, USA) Membranes

were probed using the indicated primary antibodies and

secondary peroxidase-conjugated antibodies followed by

chemiluminescence using the ECLwestern blotting

detec-tion reagent (Amersham Biosciences, Piscataway, NJ, USA)

Pull-down assay

HeLa cells seeded in 100 mm Petri dishes were transfected

with a total amount of 5 lg of the indicated GTPase and

BAF60 expression vectors The following day, the cells were

lysed in 500 lL lysis buffer [50 mm Hepes pH 7.5, 10 mm

MgCl2, 150 mm NaCl, 1% Triton X-100, 0.5% NP40 and a

protease inhibitor cocktail (Amersham)] In total, 500 lg

protein in 150 lL was incubated for 2 h at 4C with 15 lg

GST or GST-UNK-C-ter coupled to 20 lL

glutathione-sepharose beads (Amersham Biosciences) Pelleted beads

were washed twice with washing buffer (50 mm Tris⁄ HCl

pH 7.5, 150 mm NaCl, 10 mm MgCl2, 1 mm dithiothreitol,

0.1% Triton X-100, 0.2 mgÆmL)1 BSA and a protease

inhibitor cocktail) Bound proteins were recovered by

boiling beads in Laemmli sample buffer 2· (Sigma) and

analysed by western blotting

Ubiquitination assay

HeLa, HEK 293 and CHO-K1 cells seeded in 100 mm Petri

dishes were transfected with a plasmid mix containing

1–3 lg each plasmid encoding 6His-myc-Ub and the

indi-cated proteins; in silencing experiments, HeLa cells were

transfected twice (with a 24 h interval) with plasmid mix

including pSUPER Twenty hours after transfection, the

cells were washed in phosphate-buffered saline and lysed in

1 mL denaturating buffer (8 m urea, 20 mm Tris⁄ HCl pH

7.5, 200 mm NaCl, 10 mm imidazole, 0.1% Triton X-100,

5 mm N-ethylmaleimide, 10 mm iodoacetic acid); 50 lL

lysate was resuspended in Laemmli sample buffer 2X to

evaluate the total quantity of proteins

6His-myc-ubiquiti-nated proteins were recovered by incubating the remaining

lysate for 90 min with 30 lL cobalt-chelated resin (BD

TALON metal affinity resin; BD Bioscience, Lexington,

KY, USA), previously incubated in denaturating buffer

with 0.2 mgÆmL)1 BSA The beads were then washed four times in 1 mL denaturating buffer, and resuspended in

25 lL Laemmli sample buffer 2X Total lysates and ubiqui-tinated protein fractions were resolved by SDS⁄ PAGE and analysed by western blotting

Leptomycin treatment HeLa cells plated at low confluence on 18 mm diameter glass coverslips in 12-well plates were transfected with 0.5 lg HA-UNK-fl expression vector The cells were treated overnight with 10 ngÆmL)1 leptomycin B (Sigma) The fol-lowing day, HA immunofluorescence was performed on fixed cells, as described previously [32]

Acknowledgements

We thank Dr W Wang for BAF60 cDNAs We also thank Dr A Doye for help with ubiquitination assays, and F Letourneur for assistance in sequencing work This work was supported by funding from INSERM, CNRS, Universite´ Paris Descartes and the Agence Nationale pour la Recherche (ANR 05-MRAR-033-02) to G.G O.V is the recipient of a fellowship from the Association pour la recherche sur le cancer

References

1 Wang W, Cote J, Xue Y, Zhou S, Khavari PA, Biggar

SR, Muchardt C, Kalpana GV, Goff SP, Yaniv M

et al.(1996) Purification and biochemical heterogeneity

of the mammalian SWI-SNF complex EMBO J 15, 5370–5382

2 Olave IA, Reck-Peterson SL & Crabtree GR (2002) Nuclear actin and actin-related proteins in chromatin remodeling Annu Rev Biochem 71, 755–781

3 de la Serna IL, Ohkawa Y & Imbalzano AN (2006) Chromatin remodelling in mammalian differentiation: lessons from ATP-dependent remodellers Nat Rev Genet 7, 461–473

4 Reyes JC, Muchardt C & Yaniv M (1997) Components

of the human SWI⁄ SNF complex are enriched in active chromatin and are associated with the nuclear matrix

J Cell Biol 137, 263–274

5 Hsiao PW, Fryer CJ, Trotter KW, Wang W & Archer

TK (2003) BAF60a mediates critical interactions between nuclear receptors and the BRG1 chromatin-remodeling complex for transactivation Mol Cell Biol

23, 6210–6220

6 Debril MB, Gelman L, Fayard E, Annicotte JS, Rocchi

S & Auwerx J (2004) Transcription factors and nuclear receptors interact with the SWI⁄ SNF complex through the BAF60c subunit J Biol Chem 279, 16677–16686

7 Ito T, Yamauchi M, Nishina M, Yamamichi N, Mizutani T, Ui M, Murakami M & Iba H (2001)