In an in vitro interaction assay, the heme a transfer from purified heme a synthase, CtaA, to Surf1c was followed, and both Surf proteins were tested for their heme a binding pro-perties.
Trang 1Paracoccus denitrificans Surf1 proteins
Achim Hannappel1, Freya A Bundschuh1and Bernd Ludwig1,2
1 Molecular Genetics Group, Institute of Biochemistry, Goethe University Frankfurt, Frankfurt am Main, Germany
2 Cluster of Excellence Macromolecular Complexes, Frankfurt am Main, Germany
Introduction
Cytochrome c oxidase (COX; also kown as
cyto-chrome aa3 or complex IV) is a key player in cellular
respiration: as the terminal redox complex of the
elec-tron transport chain, it reduces molecular oxygen to
water and couples the free energy of this reaction to
the generation of a transmembrane proton gradient
The mitochondrial enzyme consists of up to 13
subun-its, of which only the key subunits I–III are encoded in
the organelle genome These very subunits are also
found in the corresponding bacterial oxidases and
share both structural and functional homologies
Sub-unit I, as the core of the enzyme, houses two heme a
moieties (heme a and a3) and a copper ion [1,2]
The biosynthetic pathway of heme a cofactor
syn-thesis starts with the conversion of heme b to heme o
by the addition of a farnesyl side chain This reaction
is catalysed by the enzyme heme o synthase, named Cox10 in eukaryotes and CtaB in bacteria [3] In a subsequent step, the C-8 methyl group of heme o is oxidized to a formyl group catalysed by heme a synthase, termed Cox15 in eukaryotes and CtaA in bacteria [3] The Bacillus subtilis CtaA homolog is the best-studied variant to date, but its exact cofactor-binding stoichiometries and enzymatic mechanism is still unresolved [4–6] With its eight transmembrane helices, heme a synthase is supposed to provide two different heme-binding sites, one for the heme b redox cofactor and one where the substrate heme o may bind and be oxidized to heme a [6]
The assembly factor Surf1 has long been known for its involvement in oxidase biogenesis Its functional loss leads to Leigh syndrome in humans, a severe
Keywords
CtaA; cytochrome c oxidase; heme a
synthase; Leigh syndrome; oxidase
assembly
Correspondence
B Ludwig, Institute of Biochemistry,
Goethe University Frankfurt,
Max-von-Laue-Strasse 9, D-60438 Frankfurt am Main,
Germany
Fax: +49 69 798 29244
Tel: +49 69 798 29237
E-mail: ludwig@em.uni-frankfurt.de
Website: http://www.biochem.
uni-frankfurt.de/
(Received 8 February 2011, revised 4 March
2011, accepted 14 March 2011)
doi:10.1111/j.1742-4658.2011.08101.x
Biogenesis of cytochrome c oxidase (COX) is a highly complex process involving >30 chaperones in eukaryotes; those required for the incorpora-tion of the copper and heme cofactors are also conserved in bacteria Surf1, associated with heme a insertion and with Leigh syndrome if defec-tive in humans, is present as two homologs in the soil bacterium Paracoc-cus denitrificans, Surf1c and Surf1q In an in vitro interaction assay, the heme a transfer from purified heme a synthase, CtaA, to Surf1c was followed, and both Surf proteins were tested for their heme a binding pro-perties Mutation of four strictly conserved amino acid residues within the transmembrane part of each Surf1 protein confirmed their requirement for heme binding Interestingly the mutation of a tryptophan residue in trans-membrane helix II (W200 in Surf1c and W209 in Surf1q) led to a drastic switch in the heme composition, with Surf1 now being populated mostly
by heme o, the intermediate in the heme a biosynthetic pathway This tryp-tophan residue discriminates between the two heme moieties, apparently coordinates the formyl group of heme a, and most likely presents the cofactor in a spatial orientation suitable for optimal transfer to its target site within subunit I of cytochrome c oxidase
Abbreviation
COX, cytochrome c oxidase.
Trang 2neurodegenerative disorder characterized by lesions in
the central nervous system [7–9] Patients suffer a 80–
90% loss of COX activity in all tissues and the
assem-bly process is stalled at intermediate levels [10] The
yeast homolog Shy1p is one of the best-characterized
Surf1 homologs and studies point at a stabilizing role
in early assembly intermediates containing both the
core subunits I and II [11–13]
Analysis of purified COX from surf1 deletion
mutants in a bacterial background showed that the
loss of oxidase activity is attributed to a disturbed
heme a incorporation into COX subunit I, particularly
affecting the level of heme a3 [14,15] The soil
bacte-rium Paracoccus denitrificans encodes two different
Surf1 homologs, with Surf1c specifically acting on the
aa3-type cytochrome c oxidase, and Surf1q exclusively
serving the ba3-type quinol oxidase [15] In addition,
we showed that both Paracoccus Surf proteins indeed
bind heme a, both in vivo and in vitro, with a 1 : 1
stoichiometry and affinities in the submicromolar
range A conserved periplasmically located histidine
residue near the second transmembrane helix is the
presumed ligand for the central iron atom, because a
histidine-to-alanine mutant showed strongly diminished
heme a affinities [16] A corresponding mutation in the
yeast homolog Shy1p resulted only in modest growth
impairment on nonfermentable carbon sources, in line
with diminished levels, but no complete loss of heme
affinities [17]
In early oxidase assembly events, a triple
contribu-tion of Surf1 may be imagined: (a) modulacontribu-tion of
heme a synthase activity by abstracting the enzymatic
end product, (b) supply of an readily available
protein-bound heme a pool, and (c) incorporation of heme a
into oxidase subunit I
In this study, we show that Surf1 specifically receives
heme a from heme a synthase under in vitro
condi-tions We further investigated highly conserved
resi-dues within the transmembrane part of the Surf1
protein and show that they all contribute to heme
binding in either bacterial version of the Surf1 protein,
with a strategic tryptophan residue possibly interacting
with the formyl group of heme a
Results
Lacking the machinery for the final step in heme a
bio-synthesis, Escherichia coli is well suited for heterologous
expression experiments of biogenesis factors involved in
heme a delivery to COX: E coli cells neither encode a
Surf1 homolog nor provide the heme a-synthesizing
machinery and therefore offer a genetic background
that allows well-defined analysis of interactions between these components In an earlier study, we showed that the Surf1 proteins from Paracoccus denitrificans can bind heme a under in vivo conditions when coexpressed
in E coli together with the heme a-biosynthesizing enzymes CtaB and CtaA [16] To further investigate whether CtaA is the interaction partner for Surf1 and thereby directly supplies the cofactor, we characterized the CtaA protein on a purified level
The P denitrificans CtaA protein was heterologously expressed in E coli to low levels under the control of the constitutive tet promoter As judged by SDS⁄ PAGE analysis, the protein is isolated to > 95% pur-ity via a TEV-cleavable C-terminal hexahistidine tag (Fig S1) Depending on the presence or absence of CtaB, as well as on the growth conditions (high aera-tion in baffled flasks vs limiting aeraaera-tion in standard flasks), the protein is obtained in one of three spec-trally distinct forms: b-form, bo-form and ba-form (Figs S2 and S3) The b-form is acquired when the protein is expressed in the absence of CtaB; the bo-form in the presence of CtaB under limiting oxygen conditions; the ba-form in the presence of CtaB and high aeration (Table S1)
Heme a is specifically transferred from CtaA to Surf1 in vitro
The ba-form of CtaA, carrying predominatly hemes b and a, but also traces of heme o, was further used in
an in vitro heme transfer assay For this, purified CtaA and apo-Surf1c were mixed in a 1 : 2 molar ratio and after 1 h of incubation at room temperature
reseparat-ed via immobilizreseparat-ed metal-affinity chromatography Both proteins are recovered efficiently with only minor cross-contaminations of CtaA in the Surf1c fraction (Fig 1A) Redox spectra (dithionite minus ferricya-nide) taken under native conditions clearly show that CtaA specifically loses heme a during incubation with apo-Surf1c (Fig 1B) The heme a peak maximum at 592.5 nm is decreased by 66%, whereas the heme b peak at 560 nm remains unchanged However, Surf1c specifically takes up heme a exhibiting an absorption maximum at 595 nm not present in its apo-form before incubation with CtaA (Fig 1C) The small shoulder at 560 nm in the Surf1c fraction after incuba-tion is caused by the minor cross-contaminaincuba-tion with CtaA visible in the polyacrylamide gel
This transfer assay clearly shows that both proteins transiently interact in vitro and that during this interac-tion heme a is specifically transferred from its site of synthesis in CtaA to Surf1c
Trang 3Heme binding of Surf1 mutants
Earlier expression studies of wild-type Surf1 proteins
in E coli, in the presence of CtaB and CtaA,
con-tained next to heme a also small amounts of heme o in Surf1, a fact interpreted as unspecific binding under the expression conditions chosen [16] Indeed the for-mation of heme a in the recombinant E coli cells
is highly sensitive to aeration levels as CtaA can be purified with different heme compositions (Figs S2 and S3)
In order to circumvent spectral impurities caused by nonoptimal expression conditions in E coli, we chan-ged to an autoinductive medium [18] Expression in autoinductive medium offers some advantages favour-ing heme a biosynthesis in the heterologous E coli sys-tem: expression of Surf1 is induced at higher cell densities and expression times are prolonged, allowing the heme a biosynthesis enzymes CtaB and CtaA to match the higher expression levels observed for Surf1 Indeed, the change to autoinductive medium avoids such spectral impurities for the Surf1 wild-type pro-teins and yields homogenous preparations containing heme a as sole heme species (see below) In native redox spectra, absorption maxima of 595 nm for wild-type Surf1c and 600 nm for wild-wild-type Surf1q are obtained, as described previously [16]
To determine the heme-binding properties of the Surf1 proteins, several conserved amino acid residues were mutated that locate within the transmembrane helices near the periplasmic side of the membrane The chosen residues (Table 1) are the only ones fully con-served in a comparison of 61 different Surf1 sequences found in the KEGG database (http://www.genome.jp/ kegg/) Their side chains may serve as ligands for func-tional groups such as propionates or the formyl side chain of heme a In the design of the mutations, care
Fig 1 In vitro heme a transfer from CtaA to Surf1c Purfied CtaA
and apo-Surf1c were mixed in a 1 : 2 molar ratio and separated
after 1 h of incubation at room temperature via immobilized
metal-affinity chromatography A Coomassie Brilliant Blue stained
SDS ⁄ polyacrylamide gel of 1 lg protein per lane (A) shows the
pro-teins before (b.t.) and after (a.t.) the transfer Native redox
differ-ence spectra of 20 l M CtaA (B) and Surf1c (C) are shown.
A comparison of the spectra taken before (b.t., dotted line) and
after (a.t., solid line) the transfer shows a diminished heme a
con-tent for CtaA, whereas heme b remains unaffected The transferred
heme a is found in the Surf1c fraction (a.t., solid line) that did not
contain any heme before transfer (b.t., dotted line).
Fig 2 Gel electrophoresis of purified Paracoccus denitrificans Surf1 mutant proteins Coomassie Brilliant Blue-stained 12% SDS ⁄ polyacrylamide gel of Surf1 mutant proteins after purification via immobilized metal affinity chromatography Approximately 2.5 lg of protein was loaded per lane.
Trang 4was taken to introduce conservative mutations to
avoid disturbing the overall structural determinants
and to merely tackle their potential electron-donor
functions involved in hydrogen bonding
The mutated proteins were heterologously expressed
in autoinductive medium in the presence of CtaA and
CtaB and purified via their N-terminal decahistidine
tag, as described previously [16] All proteins were
obtained without major impurities (Fig 2) In the
sam-ples of Surf1c Q25A and Surf1q Q26A, a potential
degradation product can be seen at low molecular
mass that does not stain in a Western blot against the
decahistidine tag (not shown)
Native redox spectra reveal that all mutants are
impaired in their heme a content compared to
wild-type The mutants W24F, Q25A, H193A and Y196F
(Surf1c nomenclature) completely lack any heme a, the
same being observed for the corresponding Surf1q
mutants By contrast, mutation of a tryptophan in the
second transmembrane helix (W200F for Surf1c,
W209F for Surf1q) resulted in a peak maximum
differ-ing from the wild-type proteins (558 nm for Surf1c
W200F with a small shoulder at 595 nm; 565 nm for Surf1q with a shoulder at 600 nm)
A conserved tryptophan in the second transmembrane helix of Surf1 may be responsible for heme a formyl group coordination
In order to clarify the nature of the heme species in Surf1c W200F and Surf1q W209F, pyridine hemo-chrome spectra were taken under denaturing condi-tions (Fig 4) Both mutant proteins show a peak at
552 nm and a small shoulder at 587 nm, pointing to heme types o and a
To unequivocally establish the nature of the heme species, HPLC analysis was performed For this, puri-fied Surf1c W200F and Surf1q W209F protein was extracted with acidified acetone and hemes were analy-sed on a reveranaly-sed-phase column using an acetonitrile gradient A comparison with samples of known heme content clearly shows that both mutant proteins con-tain heme o and heme a Assuming similar extinction coefficients in acetonitrile for the Soret for both heme o and heme a, we estimate 25% heme a and 75% heme o for Surf1c W200F, and 40% heme a and 60% heme o for Surf1q respectively
The cytochrome c oxidase defect in a D surf strain can not be rescued by Surf1c W200F Upon deletion of the surf1c gene in P denitrificans the resulting COX is compromised in its heme content to
50% compared with wild-type levels, and COX activity is reduced to 28% This phenotype can be res-cued by the expression of wild-type Surf1c in trans [15] In order to assess the effect of the Surf1c W200F mutant on oxidase, COX was purified from a P deni-trificans Dsurf1c strain expressing Surf1c W200F (con-firmed by immunescreen; not shown), and analysed enzymatically as well as spectroscopically Surf1c W200F cannot recover oxidase activity, and the
Table 1 Mutations introduced in Surf1c and Surf1q and their
resulting heme composition after heterologous expression in
Escherichia coli in the presence of Paracoccus denitrificans CtaB
and CtaA.
Heme type
a Mutant first described in Bundschuh et al [16].
Fig 3 Native redox difference spectra of purified Surf1 mutant proteins Native redox spectra of 50 l M purified Surf1 mutant pro-teins in the a-region for the Surf1c mutants (A) and the corresponding Surf1q mutants (B).
Trang 5enzyme is still impared in its heme content as is the
deletion strain FA3 (Table 2), clearly confirming that
this Surf1 mutant version is nonfunctional during
oxidase assembly under in vivo conditions
Discussion
Failures in cytochrome c oxidase biogenesis are a
com-mon cause of respiratory deficiencies that may lead to
severe diseases such as Leigh syndrome In eukaryotic
systems, an increasing number of protein factors has
been associated with COX biogenesis, because
power-ful genetic screening systems available for the yeast
model In bacteria, known biogenesis factors appear to
be limited to those possibly involved in metal cofactor
delivery to oxidase subunits [19] Recently we
estab-lished that the P denitrificans Surf1 proteins
stoichio-metrically bind heme a with submicromolar affinities
[16] In this study, we further analyse their
heme-binding properties using site-directed mutagenesis and
provide clear evidence for a specific interaction with
heme a synthase
To establish heme a biosynthesis in E coli,
endoge-nously modifying heme b only to the level of heme o,
two additional genes (ctaB and ctaA) were introduced and expressed under high aeration, as shown previously [20,21] Here, we demonstrate that this observation is also true for the Paracoccus heme a-syn-thesizing machinery The Paracoccus heme a synthase, CtaA, can be purified after heterologous expression in
E coli with three distinct heme cofactor compositions: b-form, bo-form and ba-form (Figs S1–S3) Only with CtaB present and under high aeration levels can CtaA
be enzymatically fully active when expressed in E coli
To our knowledge, this is the first study working with purified Paracoccus CtaA enzyme, confirmimg results obtained for the corresponding Bacillus subtilis and Rhodobacter sphaeroidesenzymes [6,20]
Because Surf1 binds heme a when coexpressed in
E coli together with the heme a-synthesizing enzymes,
we postulated an in vivo interaction between CtaA and Surf1 [16] To check whether CtaA is the actual heme a source for Surf1, we followed the heme trans-fer in vitro by mixing purified CtaA and apo-Surf1c Indeed, heme a is being taken up by Surf1 from its site
of synthesis, CtaA, requiring a specific interaction between both proteins to mediate heme transfer Stud-ies in yeast demonstrated that heme a synthase expres-sion and activity is strictly regulated [22] In this context, Surf1 is an attractive candidate for a regula-tion of CtaA activity because it abstracts the enzymatic end product, thereby initiating a new round of heme a synthesis In this function, Surf1 would prevent any undesirable release of heme a from CtaA, thus avoid-ing the accumulation of free heme a that would be det-rimental to the cell As we show expedet-rimentally here, both proteins transiently interact and readily separate once the transfer process is completed (Fig 1) Because our experimental approach does not offer any kinetic resolution we can only speculate on the nature of the transfer process It may be that the transfer process, as such, leads to structural rearrangements that cause a decrease in the reciprocal affinity, either triggered by
Fig 4 Heme analysis of Surf1c W200F and
Surf1q W209F Pyridine hemochromogen
redox spectra of 20 l M Surf1 mutant
pro-teins (A) and HPLC analysis of heme
extracts derived from Surf1c W200F and
Surf1q W209F in an 50–100% acetonitrile
gradient shown as dotted line in (B) Both
mutant proteins show an increased ratio of
heme o over heme a.
Table 2 Activity and heme a content of COX samples purified
from a Paracoccus surf1c deletion strain (FA3), Surf1c
complemen-tation (FA3.61) and a complemencomplemen-tation with Surf1c W200F
(FA3.61-W200F).
Turnover [s)1]
% wt activity
% Heme
a contenta
a As determined by pyridine hemochromogen redox spectra using
an extinction coefficient of De 587–620 = 21.7 m M )1Æcm)1; heme a
content relative to wild-type oxidase (16.1 nmolÆmg)1). bfirst
described in Bundschuh et al [15].
Trang 6the loss of heme a in CtaA or the gain of the cofactor
by Surf1 After separation from CtaA, Surf1 might
instantly donate the heme moiety to COX subunit I,
potentially in a cotranslational fashion
An interaction of heme a synthase and Surf1 was
also detected in yeast, where heme a synthase, Cox15,
copurifes with the yeast Surf1 homolog Shy1p, but the
authors of the study did not discuss this observation in
any further detail [23] Additional biochemical and
biophysical studies are needed to investigate the
inter-action between both proteins and clarify the nature of
the heme transfer process
Because the formation of heme a in E coli cells is
highly dependent on growth parameters, as discussed
above, reproducible expression conditions for Surf1
are needed, avoiding variations from one preparation
to another The switch to an autoinductive medium
fulfils these requirements and compensates the rather
slow production of heme a in the heterologous host
system by induction of Surf1 expression at high cell
densities and extended induction times Such
experi-mental conditions allow the access to spectroscopically
pure Surf1 samples containing heme a as the sole heme species, enabling us to test the heme-binding properties
of the two Paracoccus homologs using site-directed mutagenesis All mutations introduced into conserved residues within the transmembrane part of the proteins led to impaired heme a binding compared with wild-type, further emphasizing that heme binding must be
an important physiological role of the protein, at least
in the bacterial system (Fig 3)
Missense mutations of human Surf1 tend to be responsible for mild clinical phenotypes of Leigh syn-drome, allowing prolonged survival of affected patients [24] Recently, a mutagenesis study on Shy1p tried to mimic clinically relevant missense mutations in yeast, also investigating the role of the conserved tyrosine resi-due in transmembrane helix II (Fig 5) The mutation to aspartate did not have major effects in the yeast back-ground [17] Here we show that both bacterial versions lose their heme-binding properties once the tyrosine is mutated The same is true also for W24F and Q25A (Surf1c nomenclature), as well as the corresponding Surf1q mutations All mutations tested here compro-mise any hydrogen-bonding properties of the side chains, presumably without affecting the overall struc-ture Those residues might, therefore, be involved in binding the propionate side chains of the heme moiety Interestingly, in the tryptophan to phenyalanine mutant in transmembrane helix II (W200F in Surf1c, W2009F in Surf1q), heme o is the predominant heme cofactor, indicating that this residue is the criti-cal determinant to bind the formyl group of heme a, thus discriminating against the heme o moiety (Fig 5) This tryptophan residue would orient the cofactor in a way that facilitates subsequent correct incorporation
of both hemes into COX subunit I Because the trypto-phan to phenylalanine mutant binds an unphysiologi-cal heme type we expected a negative effect on COX biogenesis in vivo Indeed, the Surf1c W200F mutant is not able to compensate the surf1 deletion phenotype in
P denitrificans(Table 2)
Nevertheless, an alternative heme incorporation pathway into COX subunit I must be operative inde-pendent of Surf1, because residual COX activity is reported for surf1 deletions in any organism studied so far A direct interaction between heme a synthase and subunit I could be envisaged As we now show a direct transfer of heme from heme a synthase to Surf1, it is tempting to speculate whether a ternary complex exists, comprised of heme a synthase, Surf1 and sub-unit I Surf1 could at least stabilize such a complex and facilitate the flow of heme a from its site of syn-thesis to its target site(s) within subunit I But as the Surf protein itself stably binds heme a, the mechanism
Fig 5 Schematic model of heme a binding to Surf1 Based on
sequence alignments highly conserved amino acid residues can be
identified that all locate in the predicted transmembrane helices
near the periplasmic side of the membrane The histidine residue is
most likely involved in iron (blue sphere) coordination [16], whereas
the tryptophan in the second helix may specify the binding of the
formyl group of heme a (red sphere) thus correctly orienting the
co-factor for later integration into COX subunit I Secondary structure
elements are based on predictions by the program Sable [31].
Trang 7of incorporation into subunit I may proceed in a
sequential mode as well
Although it is still not clear what exact physiological
function Surf1 exhibits in mitochondrial oxidase
bio-genesis and whether eukaryotic Surf1 proteins also
bind heme a, it becomes obvious from studying the
bacterial homologs that Surf1 is directly involved in
binding and incorporation of heme a into oxidase In
future, bacterial model systems may be particularly
helpful because they easily offer access to sufficient
amounts of protein needed for protein biochemical
and biophysical studies
Materials and methods
Cloning of CtaA
The ctaA gene was amplified via PCR using P denitrificans
genomic DNA (strain Pd1222) as template with the forward
primer (5¢-ATATACATATGGCTAGCATGACTGGTGG
ACAGCAAATGGGTCGCGGATCCATGTCGCGCCCG
ATCGAGAA-3¢) introducing an N-terminal t7 tag and a
NdeI site, and a reverse primer (5¢-TATATCTCGAGT
GGACCGGGACCTCGGACAGTTCCCCGGAC-3¢)
add-ing a TEV site, a C-terminal hexahistidine tag and an XhoI
site The product was digested with NdeI⁄ XhoI and cloned
into the plasmid pET24a, generating pHA01 For
constitu-tive expression under control of the tet-promoter, ctaA–
His6was subcloned into the plasmid pGR52 This plasmid
encodes the P denitrificans heme a synthesizing genes ctaB
and ctaA in their wild-type versions [16] To this end,
ctaA–His6 was excised from pHA01 using an endogenous
AatII site and an XhoI site and subcloned into AatII⁄
XhoI-digested pGR52, resulting in plasmid pHA02 For
constitu-tive expression of CtaA–His6without CtaB, the ctaA gene
was amplified via PCR using pHA02 as template with the
forward primer (5¢-TCAAGGTGTACAAAGGAGATACT
Acc65I site, a ribosomal-binding site and the reverse primer
mentioned above The PCR product was digested with
Acc65I⁄ XhoI and cloned into the vector pGR50 [16]
restricted by BsrGI⁄ XhoI, resulting in pHA23 The
gener-ated plasmids were verified by sequencing and can be used
for constitutive expression of CtaA with a TEV-cleavable
C-terminal hexahistidine tag in the presence (pHA02) or
the absence (pHA23) of CtaB
Mutagenesis of Surf1
Templates for site-directed mutagenesis of His10–surf1 genes
were pET22b derivative plasmids housing surf1c (pFA48)
or surf1q (pFA49) as described previously [16] Mutagenesis
reactions were either performed using a QuikChange
muta-genesis protocol (Stratagene, La Jolla, CA, USA) or via inverse PCR Mutants derived from a QuikChange protocol (Surf1c: Q25A, Y196F, W200F; Surf1q: Q26A) were obtained using a single primer harbouring the desired muta-tion and introducing a restricmuta-tion site for screening pur-poses Mutants derived from inverse PCR reactions (Surf1c: W24F; Surf1q: W25F, Y205F, W209F) were obtained using a mutagenic forward primer also introduc-ing a restriction site for screenintroduc-ing purposes and a reverse primer allowing the amplification of the expression plasmid
by PCR All introduced mutations were confirmed by sequencing and mutant plasmids were subsequently trans-formed into the E coli expression strain C41(DE3) that already contained the plasmid pGR52
For cloning of a P denitrificans complementation plas-mid, the gene encoding Surf1c W200F was subcloned from pFA48–W200F into the broad host range vector pFA61 that expresses wild-type Surf1c under the control of the cta-promoter [15] For this, both plasmids were digested with NdeI⁄ SacI and the resulting fragments were ligated, result-ing in plasmid pFA61–W200F After sequence confirmation the plasmid was finally conjugated via triparental mating into the Paracoccus surf1c-deletion strain FA3 [15], resulting in FA3.61–W200F
Expression and purification of CtaA
E coli DH5-a strains constitutively expressing CtaA were grown in 15–30 L of Luria–Bertani medium supplemented with 10 lm iron (III) chloride For high aeration, baffled flasks were used, whereas oxygen-limited growth was per-formed in normal flasks The main culture was inoculated
to 1% with an overnight culture and grown for 18 h at
32C Cells were harvested at 5000 g for 15 min, resus-pended in 20 mm sodium phosphate, pH 8.0, 10 mm sodium chloride, 1 mm EDTA and membranes were prepared by established methods
Membranes were solubilized in the presence of 5% (w⁄ v) Triton X-100 in buffer A (50 mm sodium phosphate,
pH 8.0, 300 mm sodium chloride, 10 mm imidazole) at a final protein concentration of 10 mgÆmL)1 The solubilized material was diluted with buffer A to reduce the Triton con-centration to 2.5% prior to loading on a nickel–nitriloacetic acid column (column volume CV = 20 mL; Qiagen, Hilden, Germany) Bound material was washed with 7.5 CV of buffer B (50 mm sodium phosphate, pH 8.0, 300 mm sodium chloride, 0.02% n-dodecyl-b-d-maltoside) contain-ing 20 mm imidazole After washcontain-ing with 40 mm imidazole
in buffer B (7.5 CV), His-tagged CtaA was eluted from the column by 100 mm imidazole (7.5 CV) This fraction was concentrated to 1 mL and imidazole was removed by a 30-mL Sephadex G-25 desalting column (Pharmacia, Frei-burg, Germany) The His-tag was cleaved off by TEV prote-ase (Tobacco Etch Virus proteprote-ase, final concentration of 0.02 mgÆmL)1) under gentle shaking for 18 h at 4C
Trang 8The TEV-digested material was again loaded on a nickel–
nitriloacetic acid column (CV = 5 mL) and washed with
buffer B CtaA is found in the flow-through, whereas
con-taminating proteins, TEV protease and uncleaved CtaA
bind to the column material The flow-through is
concen-trated and the protein concentration is determined by a
modified Lowry protocol [25,26]
Expression and purification of Surf1
Heterologous expression of apo-Surf1 in E coli was
per-formed in the absence of the Paracoccus heme
a-synthesiz-ing machinery as described previously [16] Expression of
Surf1 proteins in the presence of CtaB and CtaA (encoded
on pGR52) was performed in autoinductive ZYM-5052
medium supplemented with 10 lm iron (III) chloride,
according to Studier [18] Nine litres of culture were
inocu-lated to 1% in baffled flasks and grown for 24 h at 32C
Cells were harvested at 5000 g for 15 min and resuspended in
20 mm sodium phosphate, pH 8.0, 10 mm sodium chloride,
1 mm EDTA Membranes were prepared using established
methods and the protein concentration was determined using
the Lowry assay The Surf1 proteins (apo-form, heme a
containing and site-directed mutants) were solubilized
from membranes and purified by a nickel–nitriloacetic acid
column as described previously [16]
Heme a transfer from CtaA to Surf1
CtaA (ba-form) and apo-Surf1c were mixed in buffer 1
(20 mm sodium phosphate, pH 8.0, 150 mm sodium chloride,
0.02% n-dodecyl-b-d-maltoside) to a final concentration of
0.75 mgÆmL)1 CtaA and 0.895 mgÆmL)1 apo-Surf1c,
corre-sponding to a molar ratio of CtaA⁄ apo-Surf1c of 1 : 2 The
mixture was incubated for 1 h at 25C and the two proteins
were separated again on a nickel–nitriloacetic acid column
(CV = 5 mL; Qiagen) After loading the sample, the column
was washed with 5 CV of buffer 2 (50 mm sodium
phos-phate, pH 8.0, 300 mm sodium chloride, 0.02%
n-dodecyl-b-d-maltoside) and the CtaA containing flow through was
col-lected A washing step with 5 CV of buffer 2 containing
50 mm imidazole followed, before Surf1c was eluted from the
column with 5 CV of buffer 2 containing 250 mm imidazole
All fractions were collected, concentrated and washed with
buffer 1 to remove imidazole After final concentration of
the samples, the protein concentration was determined by
the Lowry assay and samples were further analysed by
SDS⁄ PAGE and UV ⁄ Vis spectroscopy
Purification of cytochrome c oxidase and COX
activity measurement
COX purification from Paracoccus membranes was carried
out as described previously [27] COX activity measurements
were performed at room temperature in buffer (20 mm potassium phosphate, pH 8, 20 mm potassium chloride, 0.05% n-dodecyl-b-d-maltoside) with 20 lm reduced horse heart cytochrome c as substrate on a Hitachi U-3000 spec-trophotometer (De550(cyt c) = 19.4 mm)1Æcm)1)
PAGE
For SDS⁄ PAGE, samples were denatured in SDS-containing buffer for 20 min at 37C Electrophoresis was performed
on 12% polyacrylamide gels according to Laemmli [28]
Spectral analysis
Redox difference spectra were recorded in the visible range using potassium ferricyanide for oxidation and sodium dithionite for reduction For denaturing redox difference spectra samples were taken up in 20% (v⁄ v) pyridine, 0.1 m NaOH, and heme a concentration was determined using the extinction coefficient De587–620= 21.7 mm)1Æcm)1[29]
Heme extraction and HPLC analysis
For analysis of the Surf1c W200F and Surf1q W209F mutant proteins, 10 mg were subjected to acidic acetone⁄ ether extraction [30] After evaporation of the ether, the precipitate was resolved in 50 lL dimethylsulfoxide The resulting heme extract was diluted to 50% acetonitrile⁄ TFA and filtered through a 0.2 lm nanosep MF filter (Pall, Dreieich, Germany) The hemes were separated on a lRPC-C2⁄ C18 column (GE Healthcare, Mu¨nchen, Germany) using
a linear 50–100% acetonitrile gradient over 5 CV at 4C Reference samples of different heme types were prepared from E coli (hemes b and o) and from purified P denitrif-icans COX (heme a)
Acknowledgements
We thank Andrea Herrmann for excellent technical assistance and Thuy Van-Tran and Sina Weidenweber for performing initial experiments in the mutagenesis project We acknowledge financial support from DFG (SFB 472 ‘Molecular Bioenergetics’, and Cluster of Excellence ‘Macromolecular Complexes’ EXC 115)
References
1 Hosler JP, Ferguson-Miller S & Mills DA (2006) Energy transduction: proton transfer through the respi-ratory complexes Annu Rev Biochem 75, 165–187
2 Kaila VR, Verkhovsky MI & Wikstrom M (2010) Pro-ton-coupled electron transfer in cytochrome oxidase Chem Rev 110, 7062–7081
Trang 93 Mogi T, Saiki K & Anraku Y (1994) Biosynthesis and
functional role of haem O and haem A Mol Microbiol
14, 391–398
4 Hederstedt L, Lewin A & Throne-Holst M (2005)
Heme A synthase enzyme functions dissected by
muta-genesis of Bacillus subtilis CtaA J Bacteriol 187, 8361–
8369
5 Mogi T (2009) Probing structure of heme A synthase
from Bacillus subtilis by site-directed mutagenesis
J Biochem 145, 625–633
6 Svensson B, Andersson KK & Hederstedt L (1996)
Low-spin heme A in the heme A biosynthetic protein
CtaA from Bacillus subtilis Eur J Biochem 238,
287–295
7 Leigh D (1951) Subacute necrotizing
encephalomyelopa-thy in an infant J Neurol Neurosurg Psychiatry 14,
216–221
8 Zhu Z, Yao J, Johns T, Fu K, De Bie I, Macmillan C,
Cuthbert AP, Newbold RF, Wang J, Chevrette M et al
(1998) SURF1, encoding a factor involved in the
bio-genesis of cytochrome c oxidase, is mutated in Leigh
syndrome Nat Genet 20, 337–343
9 Tiranti V, Hoertnagel K, Carrozzo R, Galimberti C,
Munaro M, Granatiero M, Zelante L, Gasparini P,
Marzella R, Rocchi M et al (1998) Mutations of
SURF-1 in Leigh disease associated with cytochrome c
oxidase deficiency Am J Hum Genet 63, 1609–1621
10 Van Coster R, Lombres A, De Vivo DC, Chi TL,
Dodson WE, Rothman S, Orrechio EJ, Grover W,
Berry GT, Schwartz JF et al (1991) Cytochrome c
oxidase-associated Leigh syndrome: phenotypic features
and pathogenetic speculations J Neurol Sci 104, 97–
111
11 Nijtmans LG, Taanman JW, Muijsers AO, Speijer D &
Van den Bogert C (1998) Assembly of cytochrome-c
oxidase in cultured human cells Eur J Biochem 254,
389–394
12 Nijtmans LG, Artal Sanz M, Bucko M, Farhoud MH,
Feenstra M, Hakkaart GA, Zeviani M & Grivell LA
(2001) Shy1p occurs in a high molecular weight
com-plex and is required for efficient assembly of
cyto-chrome c oxidase in yeast FEBS Lett 498, 46–51
13 Barrientos A, Korr D & Tzagoloff A (2002) Shy1p is
necessary for full expression of mitochondrial COX1 in
the yeast model of Leigh’s syndrome EMBO J 21, 43–
52
14 Smith D, Gray J, Mitchell L, Antholine WE &
Hosler JP (2005) Assembly of cytochrome-c oxidase
in the absence of assembly protein Surf1p leads to loss
of the active site heme J Biol Chem 280, 17652–
17656
15 Bundschuh FA, Hoffmeier K & Ludwig B (2008) Two
variants of the assembly factor Surf1 target specific
ter-minal oxidases in Paracoccus denitrificans Biochim
Bio-phys Acta 1777, 1336–1343
16 Bundschuh FA, Hannappel A, Anderka O & Ludwig B (2009) Surf1, associated with Leigh syndrome in humans, is a heme-binding protein in bacterial oxidase biogenesis J Biol Chem 284, 25735–25741
17 Bestwick M, Jeong MY, Khalimonchuk O, Kim H & Winge DR (2010) Analysis of Leigh syndrome muta-tions in the yeast SURF1 homolog reveals a new mem-ber of the cytochrome oxidase assembly factor family Mol Cell Biol 30, 4480–4491
18 Studier FW (2005) Protein production by auto-induc-tion in high density shaking cultures Protein Expr Purif
41, 207–234
19 Greiner P, Hannappel A, Werner C & Ludwig B (2008) Biogenesis of cytochrome c oxidase – in vitro
approaches to study cofactor insertion into a bacterial subunit I Biochim Biophys Acta 1777, 904–911
20 Brown BM, Wang Z, Brown KR, Cricco JA & Hegg
EL (2004) Heme O synthase and heme A synthase from Bacillus subtilis and Rhodobacter sphaeroides interact in Escherichia coli Biochemistry 43, 13541– 13548
21 Brown KR, Brown BM, Hoagland E, Mayne CL & Hegg EL (2004) Heme A synthase does not incorporate molecular oxygen into the formyl group of heme A Biochemistry 43, 8616–8624
22 Wang Z, Wang Y & Hegg EL (2009) Regulation of the heme A biosynthetic pathway: differential regulation of heme A synthase and heme O synthase in Saccharomy-ces cerevisiae J Biol Chem 284, 839–847
23 Mick DU, Wagner K, van der Laan M, Frazier AE, Perschil I, Pawlas M, Meyer HE, Warscheid B & Reh-ling P (2007) Shy1 couples Cox1 translational regulation
to cytochrome c oxidase assembly EMBO J 26, 4347– 4358
24 Piekutowska-Abramczuk D, Magner M, Popowska E, Pronicki M, Karczmarewicz E, Sykut-Cegielska J, Kmiec T, Jurkiewicz E, Szymanska-Debinska T, Bielecka L et al (2009) SURF1 missense mutations promote a mild Leigh phenotype Clin Genet 76, 195– 204
25 Lowry OH, Rosebrough NJ, Farr AL & Randall RJ (1951) Protein measurement with the Folin phenol reagent J Biol Chem 193, 265–275
26 Markwell MA, Haas SM, Bieber LL & Tolbert NE (1978) A modification of the Lowry procedure to sim-plify protein determination in membrane and lipopro-tein samples Anal Biochem 87, 206–210
27 Hendler RW, Pardhasaradhi K, Reynafarje B & Lud-wig B (1991) Comparison of energy-transducing capa-bilities of the two- and three-subunit cytochromes aa3 from Paracoccus denitrificans and the 13-subunit beef heart enzyme Biophys J 60, 415–423
28 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature 227, 680–685
Trang 1029 Williams JN Jr (1964) A Method for the simultaneous
quantitative estimation of cytochromes a, b, c1, and c in
mitochondria Arch Biochem Biophys 107, 537–543
30 Weinstein JD & Beale SI (1983) Separate physiological
roles and subcellular compartments for two tetrapyrrole
biosynthetic pathways in Euglena gracilis J Biol Chem
258, 6799–6807
31 Adamczak R, Porollo A & Meller J (2005) Combining
prediction of secondary structure and solvent
accessibil-ity in proteins Proteins 59, 467–475
Supporting information
The following supplementary material is available:
Fig S1 Gel electrophoresis of purified Paracoccus
den-itrificansCtaA proteins
Fig S2 Native redox difference spectra of purified CtaA proteins
Fig S3 Pyridine hemochromogen redox spectra of purified CtaA proteins
Table S1 Strains used for the heterologous expression
of CtaA from Escherichia coli
This supplementary material can be found in the online version of this article
Please note: As a service to our authors and readers, this journal provides supporting information supplied
by the authors Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset Technical support issues arising from supporting information (other than missing files) should be addressed to the authors