Tài liệu Báo cáo khoa học: Complex transcriptional and translational regulation of iPLA2c resulting in multiple gene products containing dual competing sites for mitochondrial or peroxisomal localization docx

We now: a demonstrate the dramatic transcriptional repression of mRNA synthesis encoding iPLA2c by a nucleotide sequence nested in the coding sequence itself; b localize the site of tran

Complex transcriptional and translational regulation of iPLA2c

resulting in multiple gene products containing dual competing sites for mitochondrial or peroxisomal localization

David J Mancuso1,2, Christopher M Jenkins1,2, Harold F Sims1,2, Joshua M Cohen1,2, Jingyue Yang1,2 and Richard W Gross1,2,3,4

1

Division of Bioorganic Chemistry and Molecular Pharmacology, and Departments of2Medicine,3Chemistry and4Molecular Biology and Pharmacology, Washington University School of Medicine, St Louis, MO, USA

Membrane-associated calcium-independent phospholipase

A2c (iPLA2c) contains four potential in-frame methionine

start sites (Mancuso, D.J Jenkins, C.M & Gross, R.W

(2000) J Biol Chem 275, 9937–9945), but the mechanisms

regulating the types, amount and subcellular localization of

iPLA2c in cells are incompletely understood We now:

(a) demonstrate the dramatic transcriptional repression of

mRNA synthesis encoding iPLA2c by a nucleotide sequence

nested in the coding sequence itself; (b) localize the site of

transcriptional repression to the most 5¢ sequence encoding

the iPLA2c holoprotein; (c) identify the presence of nuclear

protein constituents which bind to the repressor region by gel

shift analysis; (d) demonstrate the translational regulation of

distinct iPLA2c isoforms; (e) identify multiple novel exons,

promoters, and alternative splice variants of human iPLA2c;

(f) document the presence of dual-competing subcellular

localization signals in discrete isoforms of iPLA2c; and

(g) demonstrate the functional integrity of an N-terminal

mitochondrial localization signal by fluorescence imaging

and the presence of iPLA2c in the mitochondrial compart-ment of rat myocardium The intricacy of the regulatory mechanisms of iPLA2c biosynthesis in rat myocardium is underscored by the identification of seven distinct protein products that utilize multiple mechanisms (transcription, translation and proteolysis) to produce discrete iPLA2c polypeptides containing either single or dual subcellular localization signals This unanticipated complex interplay between peroxisomes and mitochondria mediated by com-petition for uptake of the nascent iPLA2c polypeptide identifies a new level of phospholipase-mediated metabolic regulation Because uncoupling protein function is regulated

by free fatty acids in mitochondria, these results suggest that iPLA2c processing contributes to integrating respiration and thermogenesis in mitochondria

Keywords: phospholipase; mitochondria; peroxisomes; tran-scription; translation

Phospholipases A2 (PLA2s) play critical roles in cellular

growth, lipid homeostasis and lipid second messenger

generation by catalyzing the esterolytic cleavage of the

sn-2 fatty acid of glycerophospholipids [1–5] The resultant

fatty acids and lysolipids are potent lipid mediators of signal

transduction and alter the biophysical properties of the membrane bilayer, collectively contributing to the critical roles that phospholipases play in cellular adaptation, proliferation and signaling PLA2s constitute a diverse family of enzymes, which include the intracellular phos-pholipase families, cytosolic PLA2s (cPLA2) and calcium-independent PLA2s (iPLA2) as well as the secretory PLA2s (sPLA2)

More than a decade ago, we identified multiple types of kinetically distinguishable iPLA2activities in the cytosolic, microsomal and mitochondrial fractions from multiple species of mammalian myocardium [6–10] Utilizing the synergistic power of HPLC in conjunction with MS of intact phospholipids, initial insights into both the canine and human mitochondrial lipidomes were made [8,11] Both human and canine cardiac mitochondria possess a high plasmalogen content, and plasmalogens are readily hydo-lyzed by heart mitochondrial phospholipases [7,8] Both cytosolic and membrane-associated iPLA2 activities are inhibited by the nucleophilic serine-reactive mechanism-based inhibitor (E)-6-(bromomethylene)-3-(1-naphthale-nyl)-2H-tetrahydropyran-2-one (BEL) [12–14] Recent studies have shown that BEL has potent effects on mitochondrial bioenergetics [15] and that fatty acids are a

Correspondence to R W Gross, Washington University School of

Medicine, Division of Bioorganic Chemistry and Molecular

Phar-macology, 660 South Euclid Avenue, Campus Box 8020, St Louis,

MO 63110, USA Fax: +1 314 362 1402; Tel: +1 314 362 2690;

E-mail: rgross@wustl.edu

Abbreviations: BEL,

(E)-6-(bromomethylene)-3-(1-naphthalenyl)-2H-tetrahydropyran-2-one; cPLA 2 , cytosolic phospholipase A 2 ; ECL,

enhanced chemoluminescence; EMSA, electrophoretic mobility shift

analyses; EST, expressed sequence tag; GAPDH,

glyceraldehye-3-phosphate dehydrogenase; iPLA 2 , calcium-independent

phosphol-ipase A 2 ; iPLA 2 c, membrane associated calcium-independent

phos-pholipase A 2 (AF263613); MOI, multiplicity of infection; PLA 2 ,

phospholipase A 2 ; Sf9, Spodoptera frugiperda cells; sPLA 2 , secretory

phospholipase A 2 ; TAMRA, 6-carboxytetramethylrhodamine;

UCP, uncoupling protein.

(Received 25 August 2004, revised 10 October 2004,

accepted 13 October 2004)

rate-determining factor in uncoupling protein (UCP)

activ-ity [16] Thus, the role of mitochondrial iPLA2activities in

regulating mitochondrial function is just now beginning to

be understood Moreover, both fatty acids and lysolipids

alter the physical properties of cell membranes, interact with

specific receptors, and modulate the electrophysiologic

function of many transmembrane ion channels including

K+ and Ca2+ channels in many cells and subcellular

contexts [17–20]

In early studies, we purified canine myocardial cytosolic

iPLA2activity (iPLA2b) to homogeneity [21] identifying a

high specific activity, proteolytically activated form of the

gene whose identity was substantiated by its covalent

radiolabeling with (E)-6-(3

H)(bromomethylene)-3-(1-napht-halenyl)-2H-tetrahydropyran-2-one (radiolabeled BEL)

[12] However, despite our intense efforts at solubilization

and purification, the membrane-associated iPLA2activities

we identified in multiple membrane compartments were

resistant to our attempts at their purification In the

postgenome era it became apparent that multiple different

gene products contributed to the many kinetically diverse

activities of membrane-associated iPLA2s in myocardium

possessing distinct molecular masses and substrate

selecti-vities that resided in multiple discrete subcellular loci [22–27]

Recently, we characterized the genomic organization and

mRNA sequence of a novel iPLA2(now termed iPLA2c,

GenBank accession number AF263613) located on the long

arm of chromosome 7 at 118 cM[26] Like other members

of the iPLA2 family – iPLA2a (patatin, found in potato

tubers) [28] and iPLA2b [23] – iPLA2c contains a consensus

site for nucleotide binding and a lipase consensus motif in its

C-terminal half [26] Although the intracellular localization

and activity of iPLA2b is complex and dynamically

regulated by multiple different cellular perturbations

inclu-ding ATP concentration [7], calcium-activated calmodulin

[29,30], and proteolysis [31,32], the biochemical mechanisms

regulating iPLA2c in intact tissues are not known with

certainty For example, iPLA2c is not activated, stabilized

or bound to ATP under any conditions we have examined,

nor does it associate with calmodulin or possess a

discern-able calmodulin-binding consensus sequence [26] Like

iPLA2b, iPLA2c is completely inhibited by low micromolar

concentrations (1–5 lM) of the mechanism-based inhibitor

BEL [26]

Previously, we demonstrated that iPLA2c is synthesized

from a 3.5 kb mRNA containing a putative 2.4 kb coding

region which was most prominent in heart tissue The

5¢-region of the 2.4 kb coding sequence of iPLA2c contains

four in-frame ATG start sites which can potentially encode

88, 77, 74 and 63 kDa polypeptides [26] However, in initial

studies in baculoviral and in vitro rabbit reticulocyte lysate

systems, we unexpectedly observed that constructs

contain-ing the full-length 2.4 kb sequence encodcontain-ing the predicted

88 kDa polypeptide resulted instead in the expression of

only two protein bands of 77 and 63 kDa [26] Moreover,

the initial characterization of iPLA2c in nonrecombinant

cells demonstrated that hepatic iPLA2c was most highly

enriched in the peroxisomal compartment as a 63 kDa

polypeptide [27] These results raised the intriguing

possibility that iPLA2c biosynthesis was transcriptionally

and/or translationally regulated by as yet unidentified

mechanisms

To begin to identify the potential modes of the regulation

of iPLA2c synthesis at the transcriptional and post-transcriptional levels, and to identify specific mechanisms modulating iPLA2c expression and processing in different cell types, we examined multiple iPLA2c constructs in different cellular contexts and in intact rat myocardium Herein, we demonstrate that iPLA2c synthesis is transcrip-tionally regulated by a transcriptional repressor domain nested in the 5¢-coding region and translationally regulated through the differential usage of downstream AUG start sites Moreover, this study identifies an N-terminal mito-chondrial localization signal and demonstrates its functional integrity by fluorescence colocalization assays Importantly, the presence of multiple high molecular mass iPLA2c isoforms in mitochondria from wild-type rat myocardium was demonstrated This complex interplay of transcrip-tional and translatranscrip-tional, as well as proteolytic, sculpting of iPLA2c results in a diverse repertoire of biologic products, which likely provides the chemical foundations necessary for iPLA2c to fulfill its multiple distinct functional roles in mammalian tissues

Experimental procedures

Materials [32P]dCTP[aP] (6000 CiÆmmol)1) and enhanced chemolu-minescence (ECL) detection reagents were purchased from Amersham Pharmacia Biotech (Piscataway, NJ, USA) A human heart cDNA library was purchased from Stratagene (La Jolla, CA, USA) For PCR, a Perkin-Elmer Thermo-cycler was employed, and all PCR reagents were purchased from Applied Biosystems (Foster City, CA, USA) The Luciferase Assay system and TnT Quick coupled Tran-scription/Translation system were obtained from Promega (Madison, WI, USA) CV1 cells were generously provided

by D Kelly (Washington University Medical School) Vectors pcDNA1.1, pEF1/myc-His and pcDNA 3.1/myc-His/lacZ were purchased from Invitrogen (Carlsbad, CA, USA) Vectors pEGFP-N3 and pDsRed-mito were pur-chased from BD-Biosciences (Palo Alto, CA, USA) Culture media, CellFECTIN and LipofectAMINE reagents for transfection, baculovirus vectors and competent DH110Bac Escherichia coliwere purchased from Invitrogen and used according to the manufacturer’s protocol QIAfilter plasmid kits and QIAquick Gel Extraction kits were obtained from Qiagen (Valencia, CA, USA) Keyhole limpet hemocyanin was obtained from Pierce (Rockford, IL, USA) BEL was obtained from Calbiochem (San Diego, CA, USA) Most other reagents were obtained from Sigma (St Louis, MO, USA)

Expression of truncated iPLA2c Constructs encoding the 74- and 63 kDa polypeptides were prepared as previously described for construction of the full-length iPLA2c construct encoding the 88 kDa polypeptide used for baculoviral expression In brief, the 74 kDa sense primer M533 (5¢-TCAAGTCGACATGATTTCACGTTT AGC-3¢) and the 63 kDa sense primer M530 (5¢-GT AAGTCGACAATGTCTCAACAAAAGG-3¢) were each paired with reverse primer M458 (5¢-GCATAGCATGCT

CACAATTTTGAAAAGAATGGAAGTCC-3¢) for PCR

of
2.0 and 1.7 kb products, respectively, from the

full-length iPLA2c pFASTBac1 construct for cloning via SalI/

SphI sites into vector pFASTBac1 (Invitrogen) Subsequent

preparation of bacmids, CellFECTIN-mediated

transfec-tion of Spodoptera frugiperda (Sf9) cells to produce virus,

and the Neutral Red agar overlay method for viral plaque

titering were performed utilizing the Bac-to-Bac Baculovirus

Expression System (Invitrogen) according to the

manufac-turer’s instructions Sf9 cells were grown and infected for

preparation of recombinant protein extracts as previously

described [26] In brief, Sf9 cells were cultured in 100-mL

flasks equipped with a magnetic spinner containing

supple-mented Grace’s media [26] Sf9 cells at a concentration of

1· 106cellsÆmL)1were prepared in 50 mL of growth media

and incubated at 27C for 1 h prior to infection with either

wild-type virus or recombinant virus containing human

iPLA2c cDNA After 48 h, cells were pelleted by

centrifu-gation, resuspended in ice-cold NaCl/Piand repelleted The

supernatant was decanted and the cell pellet was

resus-pended in 5 mL of ice-cold homogenization buffer (25 mM

imidazole, pH 8.0, 1 mM EGTA, 1 mM dithiothreitol,

0.34M sucrose, 20 lM trans-epoxysuccinyl-L

-leucylamido-(4-guanidino) butane and 2 lgÆmL)1leupeptin) Cells were

lysed by sonication (20· 1 s bursts utilizing a Vibra-cell

sonicator at 30% output) and centrifuged at 100 000 g for

1 h at 4C The supernatant was saved (cytosol) and the

membrane pellet was washed by resuspending with a Teflon

homogenizer in 5 mL of homogenization buffer followed by

a brief sonication step (10· 1 s bursts) before

recentrifu-gation at 100 000 g for 1 h at 4C After removal of the

supernatant, the membrane pellet was resuspended in 1 mL

of homogenization buffer using a Teflon homogenizer and

then sonicated (5· 1 s bursts) to prepare a membrane

fraction

PLA2enzymatic assay and immunoblot analysis

Calcium-independent PLA2 activity was measured by

quantitating the release of radiolabeled fatty acid from

various radiolabeled phospholipid substrates in the presence

of membrane fractions from Sf9 cells infected with wild-type

or recombinant human iPLA2c baculovirus as previously

described [26] Protein from baculoviral or reticulocyte

lysate samples was separated by SDS/PAGE [33],

trans-ferred to Immobilon-P membranes by electroelution,

probed with anti-iPLA2c Ig and visualized using ECL as

described previously [26]

Northern blot analysis

Total RNA from Sf9 cells was isolated according to the

protocol for RNeasy (Qiagen) In brief, sample was placed

in tissue lysis buffer containing guanine isothiocarbonate

and disrupted by 20–40 s of pulse homogenation with a

rotor stator homogenizer Total RNA was then recovered

from a cleared lysate after several washes on an RNeasy

mini spin column and elution with RNase-free water

Recovery of RNA was determined spectrophotometrically

at 260 nm RNA (2 lg) was fractionated on a 1.25%

agarose Latitude RNA midi gel (BioWhittaker,

Walkers-ville, ME, USA), blotted onto a nylon membrane,

cross-linked by exposure to a UV light source for 1.5 min and then baked at 85C for 60 min After prehybridization

in ExpressHyb hybridization buffer (BD Biosciences) for

30 min, the blot was hybridized 1 h at 68C with radio-labeled iPLA2c probe prepared as previously described [26]

in hybridization buffer and then washed with 2· NaCl/Cit containing 0.1% (w/v) SDS twice for 30 min each, followed

by two washes with 0.1· NaCl/Cit containing 0.1% (w/v) SDS for 40 min each at 50C, as described in the manufacturer’s instructions Hybridized sequences were identified by autoradiography for 16 h

RNA stability assay Spinner flasks (100 mL) were infected with equivalent volumes of each truncated viral iPLA2c construct [multi-plicity of infection (MOI)¼ 1] and 48 h later, actino-mycin D was added to a concentration of 10 lgÆmL)1 At 0,

15, 30, 60, 120 and 240 min following actinomycin D addition, 2-mL aliquots were removed, centrifuged to collect pellets and quick-frozen in liquid N2 RNA was then prepared following the RNeasy (Qiagen) protocol RNA samples (2 lg) were fractionated on a latitude RNA midi-gel for northern analysis as described above

Quantitative PCR RNA was prepared from Sf9 cell pellets following the RNeasy protocol supplemented with on-column RNase-free DNase treatment to remove baculoviral DNA as described by the manufacturer Completeness of removal of baculoviral DNA was monitored by including control samples spiked with plasmid DNA (either cell pellets from uninfected Sf9 cells or water blanks) Quantitative PCR of DNase-treated control samples routinely did not generate detectable signal For analysis of actinomycin D-treated test samples,
0.2–1 lg of the total RNA was reverse tran-scribed using MultiScribe reverse transcriptase in a TaqMan Gold RT-PCR kit (Applied Biosystems) by incubation for

10 min at 25C followed by 30 min at 48 C and a final step of 5 min at 95C and 20 ng of cDNA was used per reaction in quantitative PCR Specific iPLA2c primer pairs and probe were designed using PRIMER EXPRESS software from PE Biosystems Forward and reverse primers, respect-ively (5¢-AGCTCTTTGATTACATTTGTGGTGTAA-3¢ and 5¢-CACATTCATCCAAGGGCATATG-3¢) were used for amplification of an
100 nucleotide product flanking the boundary between exons 5 and 6 of the iPLA2c gene A 30-mer hybridization probe (5¢-CCCAACATGAAAGC TAATATGGCACCTGTG-3¢) was designed to anneal between the PCR primers, at the exon 5/6 boundary, 5¢-labeled with reporter dye 6-FAM and 3¢-labeled with quenching dye, 6-carboxytetramethylrhodamine (TAMRA) PCRs were carried out using TaqMan PCR reagents (Applied Biosystems) as recommended by the manufacturer Each PCR amplification was performed in triplicate, using the following conditions: 2 min at 50C and 10 min at 95C, followed by a total of 40 two-temperature cycles (15 s at 95C and 1 min at 60 C) For the generation of standard curves, serial dilutions of a cDNA sample were used and mRNA levels were compared for various time points after correction using concurrent

glyceraldehye-3-phosphate dehydrogenase (GAPDH)

mes-sage amplification with GAPDH primers and probe as an

internal standard Results were plotted as relative mRNA

level vs time (hours) and the slopes of exponential

trendlines for each construct were compared

Luciferase assay

PCR primers in Table 1 were used to amplify segments

containing 124 nucleotides of sequence upstream of the

iPLA2c 63 kDa start site All 3¢ PCR primers in Table 1

were designed to generate identical Kozak (GCCACC)

sequences [34,35] upstream of the ATG start In each case,

the sequence around the ATG start is
GCCAX

CATG (where
X is a
C nucleotide in all constructs

except 83 which contains an
A nucleotide) In each case,

PCR products were cloned into HindIII/NcoI restriction

sites within the polylinker region of pGL3-Promoter vector

(pGL3P) Also, because of the presence of a naturally

occurring NcoI site within the 83 construct, an AflIII

restriction site was utilized at the 3¢-end of this construct

(instead of NcoI) to generate a compatible cohesive end for

cloning into the NcoI restriction site of pGL3-Promoter

vector (pGL3P) Transient transfection of CV1 cells with

each of the inhibitory constructs was performed using

LipofectAMINE Plus (Invitrogen) For each transfection,

1–2 lg of luciferase reporter plasmid was cotransfected with

100 ng of pcDNA 3.1/myc-His/lacZ vector and

b-galac-tosidase activity was measured utilizing the b-galacb-galac-tosidase

enzyme assay system (Promega) for normalization of

results Background measurements were uniformly low

and cell survival was indistinguishable in all transfections

performed The cells were harvested 24 h later and luciferase

activity was assayed using the luciferase assay system

(Promega) following the manufacturer’s protocol Relative

luminescence values were measured in a Beckman

Scintil-lation counter with a wide-open window

Subcellular fractionation of rat heart

Subcellular fractionation of rat heart by differential

centri-fugation was performed essentially as described previously

for rat liver [27] In brief, rat heart was minced on ice and

then homogenized in 3 vol (w/v) of ice-cold

homogeniza-tion buffer [0.25 M sucrose, 5 mM Mops, pH 7.4, 1 mM

EDTA and 0.1% (v/v) ethanol, 0.2 mM dithiothreitol containing protease inhibitors (0.2 mM phenylmethylsulfo-nyl fluoride, 1 lgÆmL)1leupeptin, 1 lgÆmL)1aprotinin and

15 lgÆmL)1 phosphoramidon)] using a Potter-Elvehjem homogenizer at 1000 r.p.m with 8–10 strokes The homo-genate was first centrifuged at 100 g for 10 min to remove cellular debris and then at 1000 g to obtain a nuclear pellet (nuclear fraction) and a supernatant fraction The 1000 g supernatant fraction was further centrifuged at 3000 g for

20 min to collect a heavy mitochondrial pellet (heavy mitochondrial fraction) The 3000 g supernatant was then centrifuged at 23 500 g for 20 min to collect the light mitochondrial fraction pellet 23 500 g (light mitochondrial fraction) The 23 500 g supernatant was then centrifuged at

70 000 g for 20 min to collect a second light mitochondrial pellet (70 000 g light mitochondrial fraction) Utilizing the above subcellular fractionation technique, the majority of mitochondria were present in the 3000 and 23 500 g pellets, whereas the large majority of peroxisomal marker PMP70 was present in the supernatant

Promoter analysis iPLA2c sequences were examined for the presence of putative promoter elements utilizing the internet-based program TFSEARCH (http://150.82.196.184/research/db/ TFSEARCH.html) Promoter activity of iPLA2c sequences was analyzed by cloning sequences upstream of the luciferase reporter gene in promoterless vector pGL3-Enhancer (Promega) The following primers were utilized

to amplify PCR products containing iPLA2c sequence: P1, 5¢-TCAAGGTACCATGATTTCCTGAAGG-3¢; P2, 5¢-CTGAAGATCTAGCCTTTACTTTCA-3¢; P3, 5¢-GC TAGGTACCAATACAGTAATATATG-3¢; P4, 5¢-TGC TAGATCTCCACCCACTCA-3¢; P5, 5¢-TTATGGTACC TGAAAGGGAATAGCGGC-3¢; P6, 5¢-GGCTGGTAC CCTTGCGCTCCGTC-3¢; P7, 5¢-GGAGAGATCTGCG GGAAGCCGCGACAGA-3¢; p8, 5¢-TTCCAGATCTG CAGAGATAAGCCTCCC-3¢; p9, 5¢-GCGTGAGATCT CTGGTTGGTTGC-3¢; P10, 5¢-ACCAGGTACCGCA CAGCACGCCCC-3¢; and P11, 5¢-GTCCGGTACCGG AAGGCAAAACGA-3¢ Primers P1 and P2 were utilized

to amplify a 584-nucleotide product containing sequence

Table 1 PCR primer pairs for localization of transcriptional regulatory elements in the 5¢-coding region of iPLA 2 c Underlined residues indicate the locations of HindIII (AAGCTT), NcoI (CCATGG), or Af l III (ACATGT) restriction sites utilized for cloning PCR products.

Construct PCR primer pairs 5¢- to 3¢-sequence

88R TAGACCATGGTGGCTTATCCTCCAGTAATGC

87R ACTGCCATGGTGGCCTTCACTTTTGGTCCATTTAC

85R TGCTCCATGGTGGCATCCCAATATGTAAACCA

83R CAAAACATGTTGGCTACGGGACATACAAATGTTCA

80R ATTCCATGGTGGCTGAAATCATTTCATTTTGATTGCC

74R CTTTCCATGGTGGCTGTCACTATATTTTTTCA

upstream from iPLA2c exon 1 For construct I, primers P3

and P4 were utilized to amplify a 584 nucleotide product

containing sequence upstream from iPLA2c exon 2 PCR

products for constructs II–IX were prepared as follows:

primers P5 and P4 were paired to amplify a 390-nucleotide

product for construct II; primers P6 and P4 were utilized to

amplify a 197-nucleotide product for construct III; primers

P5 and P8 were employed to amplify a 215-nucleotide

product for construct IV; primers P3 and P8 were utilized to

amplify a 216-nucleotide product for construct V; primers

P3 and P7 were paired to amplify a 409-nucleotide product

for construct VI; primers P5 and P9 were utilized to amplify

a 131-nucleotide product for construct VII; primers P10 and

P9 were paired to amplify a 106-nucleotide product for

construct VIII; and primers P11 and P7 were employed to

amplify a 155-nucleotide product for construct IX PCR

products were subsequently cloned via KpnI/BglII

restric-tion sites into the promoterless vector pGL3-Enhancer

(Promega) and then utilized for LipofectAMINE

Plus-mediated transient transfection of CV1 cells followed 24 h

later by analysis of luciferase activity utilizing the Luciferase

Assay System of Promega Empty pGL3-Enhancer vector

and the SV40-containing promoter vector pGL3-Promoter

were used as controls MyoD vector used for cotransfection

of CV1 cells with the pre-exon 1 iPLA2c construct was

obtained from M Chin (Harvard Medical School) [36]

Results were normalized to b-gal resulting from

cotransfec-tion with a LacZ vector

5¢-Rapid amplification of cDNA ends (RACE)

5¢-RACE was performed as previously described employing

human heart Marathon-Ready cDNA (BD Biosciences)

and primers AP1 and M460 [26] PCR products were gel

purified with a QIAquick gel extraction kit, subcloned into

pGEM-T vector (Promega), sequenced and analyzed by

alignment with iPLA2c sequences

Electrophoretic mobility shift analyses

Electrophoretic mobility shift analyses (EMSA) were

per-formed with the Promega gel shift assay system according to

the manufacturer’s specifications by using 2 lg of nuclear

protein for each gel shift reaction For analysis of the

5¢-transcription inhibitory region of iPLA2c,

double-stran-ded oligonucleotides containing 5¢-iPLA2c, sequence were

end-labeled with [32P]ATP using T4polynucleotide kinase,

as instructed by the manufacturer (Promega) Competition

studies were performed by adding a 100-fold molar excess of

unlabeled oligonucleotide or nonspecific control

oligo-nucleotide to the reaction mixture prior to the addition of

radiolabeled probe Reaction mixtures were analyzed on

Novex 6% DNA retardation polyacrylamide gels in 0.5·

TBE (89 mM Tris/HCl, pH 8.0; 89 mM boric acid; 2 mM

EDTA) as the running buffer Electrophoresis was

per-formed at 298 V for 20 min, at 4C followed by drying of

the gel at 80C under vacuum and visualization of DNA–

protein complexes by autoradiography for 12–18 h Sense

and reverse complement oligonucleotide sequences

corres-ponding to the following sequences were synthesized and

annealed: g50 (5¢-TATTAATCTGACTGTAGATATAT

ATATATTACCTCCTTAGTAATGC-3¢) and

random-ized control g50c (5¢-TTGATAGTTATCTATTACAG TCTTCTTAGATTGAAACAA-3¢), g177 (5¢-CATACAA ACATAATAAGATGTAAATGG-3¢) and control g177c (5¢-TCATCTAAGTACAATAGATAGAAGAAA-3¢), g230 (5¢-TGTTACTCTCCAAGCAACCA-3¢) and control g230c (5¢-GACACTTGTCATCACACTCA-3¢) For ana-lysis of the pre-exon 1 region, myo2 double-stranded DNA having the sequence 5¢-GAAGTACAGGTGTGGCTGG-3¢ was utilized along with control myo2ctl (5¢-GATCG TTGTGAAGAGGGCG-3¢) For analysis of the pre-exon 2 promoter region, Inr double-stranded DNA having the sequence 5¢-GCGTCACTTCCGCTGGGGGCGG-3¢ was utilized along with randomized control Inrc (5¢-GTG GCCGGGTGGTCCACCTCGG-3¢)

Mitochondrial target prediction, iPLA2c–GFP constructs and confocal microscopy

The internet-based MITOPROT computer program (http:// www.mips.gsf.de/cgi-bin/proj/medgen/mitofilter) [37] was utilized for prediction of mitochondrial targeting sequences

in iPLA2c To prepare the 74-GFP construct, complement-ary 5¢-phosphorylated primers (5¢-TCGAGCCACCAT GATTTCACGTTTAGCTCAATTTAAGCCAAGTTCC CAAATTTTAAGAAAAGTAG-3¢ and 5¢-TCGACTACT TTTCTTAAAATTTGGGAACTTGGCTTAAATAAA CGTGAAATCATGGTGGC-3¢) were annealed by heat-ing a 4-lMmixture of primers to 95C for 3 min followed

by cooling to 22C prior to cloning into the Xho1/Sal1 sites of vector pEGFP-N3 Integrity and orientation of the N-terminal fusion products were verified by sequencing Vector pDsRed2-Mito (BD Biosciences), which encodes

a mitochondrial-targeting sequence of human cyto-chrome c oxidase fused to red fluorescent protein, was utilized as a mitochondrial marker HeLa cells were grown

on two-well Laboratory Tek chamber slides to 60–80% confluency prior to LipofectAMINE Plus (Invitrogen) mediated single or cotransfection according to the manu-facturer’s suggested protocol After 48 h, cells were washed in NaCl/Pi, fixed with 4% (v/v) paraformaldehyde, coverslipped and fluorescence was analyzed utilizing a Zeiss Axiovert 200 (Carl Zeiss Inc., Thornwood, NY, USA) equipped with Zeiss LSM-510 confocal system with

a 63· oil immersion objective and excitation wavelengths

of 488 and 633 nm Single transfections with either pDsRed2-Mito or 74-GFP construct were utilized to optimize immunofluorescence conditions and eliminate bleed-through Filters were optimized for double-label experiments to minimize bleed-through and fluorescence images were collected by utilizing ZeissLSMsoftware

Results

Identification of transcriptional regulatory elements nested in the 5¢-coding region of iPLA2c

In previous work, we demonstrated that expression of a baculoviral construct encoding the full-length 88 kDa coding sequence of iPLA2c in Sf9 cells resulted instead

in the production of downstream polypeptides of 77 and

63 kDa in nearly equal amounts [26] This was remarkable because translation initiation almost always occurs at the

AUG most proximal to the polyhedrin baculoviral

promo-ter [38,39] Accordingly, the virtual absence of the 88 kDa

protein product was unanticipated To begin identifying

the reasons underlying the differential expression of iPLA2c

polypeptides, we prepared pFASTBac1 vectors with the

baculovirus promotor proximal to each of the individual

AUG putative translation initiation codons Analysis of the

membrane fractions from Sf9 cells infected at identical

MOIs with vector harboring the construct containing the

polyhedrin promoter proximal to sequence encoding the

full-length iPLA2c 88 kDa polypeptide revealed two bands

of
77 and 63 kDa as previously reported [26] with the

63 kDa being the predominant product (Fig 1, lane 1) An

uncharacterized band of
50 kDa was also present in all

fractions, including the uninfected control (lanes 4 and 8),

which may represent either endogenous Sf9 cell iPLA2c

protein or alternatively nonspecific antibody binding

Ana-lysis of the membrane fraction from Sf9 cells infected with

vector harboring the truncation mutant encoding the

putative 74 kDa polypeptide revealed modest bands

cor-responding to the 74- and 63 kDa protein products (Fig 1,

lane 2) The chemical identity of the minor protein product

of molecular mass > 74 kDa (Fig 1, lane 2) is unclear and

may be due to secondary processing of the 74 kDa product

which could migrate anomalously Alternatively, we cannot

rule out the possibility that a minor amount of 3¢

read-through from the expression construct occurred

Remark-ably, expression of the construct containing the polyhedrin

promoter proximal to sequence encoding the predicted

63 kDa product was over 75-fold higher than constructs

encoding either the 74- or 88 kDa protein products (Fig 1,

lanes 3 and 7)

Lysates from viral infections of the construct producing

the recombinant 63 kDa product possessed robust PLA2

activity (as assessed by release of oleic acid from

plasmenyl-PC) that was markedly higher than that manifest in either

the 88- or 74 kDa transfected cells (data not shown) The

rate of hydrolysis using plasmenylcholine was similar to that

using phosphatidylcholine (each radiolabelled at the sn-2

position with 9,10-[3H]oleic acid) These results demonstrate that the iPLA2c enzyme can attack the sn-2 carbonyl and suggest that hydrolysis of these substrates by the 63 kDa iPLA2c occurs predominantly at the sn-2 position

Measurement of mRNA content and kinetics of mRNA species encoding individual iPLA2cisoforms

Alterations in the amount of iPLA2c isoform expression could be due to changes in mRNA synthesis, differences in mRNA half-lives, or translational mechanisms for each of the sequentially truncated coding constructs Accordingly,

we first examined the amount and stability of mRNA resulting from each of the constructs in the baculoviral expression system Northern analysis revealed only modest amounts of mRNA mass corresponding to the constructs encoding the 88 kDa protein and virtually none encoding the message for the 74 kDa protein (Fig 2A) Remarkably,

a dramatic increase in the mRNA content in cells transfected with vector encoding the 63 kDa protein product was present (Fig 2A) These experiments were all performed at identical MOIs and reproduced on multiple occasions After actinomycin D treatment, the half-life of each mRNA species was compared by two independent techniques First, comparisons of iPLA2c mRNA mass expressed from each of the constructs over a 4 h interval following actinomycin D treatment did not reveal any discernable differences in mRNA stability by northern analysis (t1/2
1–2 h; Fig 2B) Second, quantitative PCR analysis after actinomycin D treatment indicated that mRNA levels expressed following viral infection with the

63 kDa construct were substantially higher than those of either the 88- or 74 kDa constructs (t1/2
2–4 h; Fig 2C) Collectively, these results demonstrated that transcriptional regulation was a major mechanism underlying the experi-mentally observed dramatic increase in the 63 kDa protein mass but did not rule out contributions from translational mechanisms as well (vide infra)

Localization of the regulatory domain mediating transcriptional repression of the iPLA2cconstructs The observed differences in baculoviral expression patterns

of the sequentially truncated iPLA2c message suggested that

a transcriptional inhibitory element was present comprised

of nucleic acid sequence encoding the N-terminus of iPLA2c located between the 88- and 63 kDa potential translational initiation sites To localize the regulatory domain upstream

of the 63 kDa start site of iPLA2c responsible for the observed transcriptional repression, PCR products contain-ing 124-nucleotide blocks of sequence upstream of the

63 kDa start site were amplified from iPLA2c template and inserted between the SV40 promoter and a luciferase reporter gene in a pGL3-promoter vector for transient expression in monkey kidney (CV1) cells Through this approach, we sought to determine which elements in the 5¢-coding sequence acted as transcriptional repressors in a mammalian cell line Constructs corresponding to each of the first four 124-nucleotide sequences encoding truncated sequences from the 5¢ of nucleotide 315 greatly inhibited luciferase expession (on average 80%), whereas segments further 3¢ were not inhibitory in comparison with control

Fig 1 Baculoviral expression of truncated iPLA 2 c polypeptides

initi-ating translation at downstream in-frame initiator methionine residues.

Sf9 cells were infected with iPLA 2 c constructs initiating at the 88, 74 or

63 kDa start sites At 48 h postinfection, cells were collected and

membrane (lanes 1–4) and cytosolic (lanes 5–8) fractions were

pre-pared as described in Experimental procedures Fractions (100 lg

protein per lane) were loaded onto a 10% polyacrylamide gel, resolved

by SDS/PAGE, transferred to a poly(vinylidene difluoride) membrane,

incubated with immunoaffinity-purified antibody directed against

iPLA 2 c and visualization of immunoreactive bands by ECL.

Expressed recombinant polypeptides are designated according to their

expected masses Lanes 1 and 5, 88 kDa iPLA 2 c; lanes 2 and 6, 74 kDa

iPLA 2 c; lanes 3 and 7, 63 kDa iPLA 2 c; lanes 4 and 8, wild-type control

baculovirus Molecular mass standards are indicated on the left.

vector (P < 0.001) (Fig 3A) Moreover, EMSA of the

5¢-coding region utilized for the above study (nucleotides

1–230 of iPLA2c) revealed three separate regions producing

gel shifts, all localized within the identified region of

tran-scriptional repression Oligonucleotide g50 was predicted to

contain sites with a high match to chicken homeobox CdxA

binding sites Oligonucleotide g177 shares homology with

the Oct1 binding site, whereas oligonucleotide g230 did not

contain a predicted site for binding of nuclear proteins

Utilizing radiolabeled oligonucleotide dimer g50

(corres-ponding to residues 6–50 starting from the 88 kDa AUG

codon) a single shifted protein-radiolabeled DNA complex

utilizing HeLa nuclear extract was identified which was

competed out with a 100-fold molar excess of unlabeled

oligonucleotide dimer g50 but not with nonspecific control

g50c oligonucelotide dimer (Fig 3B, column 1, arrow)

Similarly, oligonucleotide dimers g177 and g230 also

produced shifted bands that were specifically competed

out with 100-fold molar excess unlabeled oligonucleotide

dimer but not with nonspecific control oligonucleotide

dimer (Fig 3B, columns 2 and 3)

Translational regulation of iPLA2cin myocardium

Owing to the obvious complexity of the regulation of

iPLA2c resulting from the combined presence of

transcrip-tional and translatranscrip-tional regulation, we recognized that

current hypotheses relegating the role of iPLA2c exclusively

to peroxisomal lipid metabolism were likely limited in

appropriate scope In prior work, we identified robust amounts of iPLA2 activity in the mitochondrial compart-ment of both canine and human hearts [7,8] Moreover, we recognized early on that the iPLA2family of proteins had the potential for providing substrate for mitochondrial fatty acid oxidation by lipid hydrolysis [7], for generating lipid second messengers (eicosanoids and lysolipids), for modu-lating ion channel kinetics [19,40] and for providing fatty acids for univalent transmembrane ion transport [41] Accordingly, we considered the possibility that myocardial iPLA2c may be present in mitochondria Western analysis demonstrated that iPLA2c cosedimented with mitochondria (in the light mitochondrial fraction) (Fig 4) Remarkably, multiple high molecular mass (63–88 kDa) immunoreactive proteins were detected in rat mitochondria after differential centrifugation of rat heart homogenates, consistent with the utilization of translation initiation sites producing 88, 77, 74 and 63 kDa protein products Products corresponding to the 77 and 74 kDa products were the major reactive bands Additional lower molecular mass immuno-reactive bands were also detected (< 60 kDa) Collectively, these results identified the presence of multiple iPLA2c protein products in mitochondria resulting from usage of different translation initiation codons in rat myocardium Alternative splicing of iPLA2cin mammalian tissues

In the years since our first report of the genomic organiza-tion of the iPLAc gene, increasing evidence of extensive

Fig 2 Analysis of iPLA 2 c mRNA in the baculoviral system (A) Sf9 cells were infected with iPLA 2 c constructs encoding full-length (88 kDa) or truncated 74 and 63 kDa products At 48 h postinfection, cells were recovered and total RNA was extracted, fractionated on a latitude RNA gel, transferred to nylon membrane and hybridized with [32P]iPLA 2 c probe followed by autoradiography as described in Experimental procedures Lane 88 kDa, RNA from 88 kDa full-length expression; lane 74 kDa, RNA from 74 kDa expression; lane 63 kDa, RNA from 63 kDa expression The relative positions of RNA size markers in kb are indicated on the left (B) Northern analysis of total RNA extracted from Sf9 cells infected for

48 h with recombinant full-length or truncated iPLA 2 c baculoviral constructs and then treated with actinomycin D for 0, 0.25, 0.5, 1, 2 or 4 h prior

to RNA extraction Lane 88 kDa, RNA from 88 kDa full-length expression; lane 74 kDa, RNA from 74 kDa expression; lane 63 kDa, RNA from

63 kDa expression The relative positions of RNA size markers are shown in kb on the left (C) Quantitative PCR analysis of iPLA 2 c mRNA levels RNA isolated and DNase treated from 48 h infected Sf9 cells was reverse transcribed using MultiScribe reverse transcriptase and the resultant cDNA (20 ngÆreaction)1) utilized in quantitative PCR as described in
Experimental procedures. Log of the relative mRNA level is plotted vs time (in hours) after actinomycin D addition for RNase-free DNase-treated RNA extracts of baculoviral extracts expressing the 63 kDa (m), 74 kDa (j) and 88 kDa (r) iPLA 2 c polypeptides.

alternative splicing in the 5¢-region of the iPLA2c gene has

accumulated along with evidence for the existence of two

previously undescribed exonic sequences within some of the

alternatively spliced iPLA2c variants in GenBankTM

data-bases Although previously only present as raw sequence in

the EST database, we now specifically identify two novel

sequences as iPLA2c exons The first exon comprised of 296

nucleotides was located at the 5¢-end of EST sequences

containing iPLA2c sequence and is the 5¢-most exonic

sequence located thus far for the iPLA2c gene For this

reason, this exon has been designated exon 1 (Fig 5) Based

on its location relative to other iPLA2c exons, we have

designated the second new exon as exon 4 Exon 4 is

comprised of 112 nucleotides and, remarkably, has a high

degree of homology with the human mammalian

transpo-son-like element MaLR repeat sequence The significance of

this sequence homology in the context of exons within the

iPLA2c gene remains unknown Thus, the second draft of

the iPLAc genomic map contains 13 exons, the first four of

which contain noncoding sequence (Fig 5) The first potential in-frame AUG start site occurs in exon 5, while the nucleotide binding and lipase consensus sites occur in exons 7 and 8, respectively, and the peroxisomal localiza-tion signal occurs in exon 13 (Fig 5)

Fig 4 Immunoblot analysis of iPLA 2 c in subcellular fractionations of rat heart Equivalent subcellular fractions (100 lg protein) of rat heart prepared as described in Experimental procedures were loaded on a 10% gel, resolved by SDS/PAGE, transferred to a poly(vinylidine difluoride) membrane, incubated with immunoaffinity-purified anti-iPLA 2 c, and immunoreactive bands were visualized by ECL Lane 1, rat heart homogenate; lane 2, crude pellet; lane 3, heavy mitochondrial fraction; lane 4, 23 500 g light mitochondrial fraction; lane 5, 70 000 g light mitochondrial fraction; lane 6, nuclear fraction Molecular mass markers are indicated on the right.

Fig 3 Identification of a regulatory domain within the coding region of iPLA 2 c using a luciferase reporter assay system The inhibitory effect of iPLA 2 c sequences on luciferase expression were examined by prepar-ing a series iPLA 2 c-pGL3-Promoter constructs consisting of 124-nucleotide segments of iPLA 2 c sequence (from the region upstream from the 63 kDa iPLA 2 c start site) cloned immediately upstream from the luciferase reporter gene in vector pGL3-Promoter CV1 cells were transiently transfected with the iPLA 2 c-pGL3-Pro-moter constructs (100 ng) and harvested 24 h later to assay luciferase activity as described in Experimental procedures (A) The regions of the iPLA 2 c coding sequence included in iPLA 2 c-pGL3-Promoter constructs 88, 87, 85, 83 and 80 as well as regions corresponding to oligonucleotide g50, g177 and g230 used for EMSA are schematically represented A portion of the 5¢ iPLA 2 c coding sequence (iPLA 2 ) is represented in the center of the diagram as a heavy solid bar with the scale in nucleotides (nt) shown below (B) The bar graph indicates the relative luminescent value of iPLA 2 c-pGL3-Promoter constructs 88,

87, 85, 83, 80 and 74 compared with unmodified pGL3-Promoter control vector used in the luciferase assay system Results represent the average of three sets of data (± SE) Comparison of the RFV of the 80 construct with 88, 87, 85 and 83 constructs (P < 0.001) is indicated (*) (C) EMSA of the iPLA 2 c regulatory domain EMSA was per-formed utilizing double-stranded radiolabeled oligonucleotides g50 (1), g177 (2), and g230 (3) as described in Experimental procedures Lane a, negative control minus HeLa nuclear extract; lane b, positive control containing HeLa nuclear extract; lane c, competitive assay containing 100-fold molar excess of unlabeled oligonucleotide; lane d, noncom-petitive assay containing 100-fold molar excess unlabeled nonspecific control oligonucleotide Results are representative of three separate EMSA Arrows: specific DNA–nuclear protein complex.

In addition to transcriptional regulation of mRNA levels,

alternative splicing represents an additional mechanism for

the regulation of iPLA2c biosynthesis Examination of the

EST database and 5¢-RACE analyses revealed a total of ten

different splice variants from eight different tissues which

begin with either the exon 1 or exon 2 sequence (but do not

contain both) (Fig 6) Multiple iPLA2c splice variants were

identified in a wide range of tissues, including human heart,

smooth muscle, endothelial cell, hippocampus, testis,

pitu-itary, placenta and pancreas The predominant splice

variant isolated by 5¢-RACE, and the one most often

present in the EST database, was splice variant VI followed

by splice variants V and IV Multiple splice variants from

different tissues that differ with regard to their 5¢-terminus

were present Seven begin with exon 2, whereas three begin

with the exon 1 sequence Splice variants I and II do not

contain the exon 5 sequence and thus do not contain sequence for the four alternative AUG start sites initiating biosynthesis of the 88, 77, 74 and 63 kDa iPLA2c isoforms Instead, based on current information about iPLA2c and its splicing, the first in-frame AUG site is downstream of the nucleotide binding and lipase consensus domains and thus encodes a putative potential 33 kDa polypeptide which does not contain the serine active site The reasons underlying the presence of this product are unknown, but it could be involved in regulatory events similar to splice variants of iPLA2b previously identified that do not contain the active site serine [42–44] Splice variants III, IV, VIII and IX have

an alternative AG/GT splice site within exon 5 resulting in a truncated exon 5 that is missing the 88 kDa iPLA2c start site Interestingly, the alternative splicing that generates variant IV results in a new 5¢ in-frame AUG start site, which

Fig 6 Splice variants of iPLA 2 c beginning with either exon 1 or exon 2 A diagrammatic representation of iPLA 2 c exons is indicated at the top with the relative locations of the 88, 77, 74 and 63 kDa ATG start sites indicated by triangles Vertical arrows indicate the locations of the nucleotide (ATP) and lipase consensus sites Representations of ten splice variants are shown below with lines indicating splicing across exons Open boxes represent 5¢-untranslated sequence while shaded boxes represent the open reading frame In addition to the four upstream ATG start sites encoding

88, 77, 74 and 63 kDa products, all potential in-frame downstream ATG start sites are also indicated with triangles Slashes indicate the extent of known sequence for each EST Asterisks designate splice variants identified by 5¢-RACE in this study.

Fig 5 Genomic map of iPLA 2 c The intron–exon boundaries of the iPLA 2 c gene are shown in scale (kb) The 13 exons of the iPLA 2 c gene are indicated as boxes Spaces between the exons represent the relative sizes of the 12 introns contained within the iPLA 2 c gene Regions of the gene that correspond to the nucleotide binding, lipase, and peroxisomal localization consensus sequences are indicated in exons 7, 8 and 13, respectively Open boxes at the bottom indicate the nucleotide numbers (corresponding to the original BAC genomic clone report, GenBank accession number AC005058) with the sizes of each exon in nucleotides (nt) and in amino acids (aa) shown within The asterisk is inserted to note that different 5¢ extents of exon 2 have been reported in GenBank [26, 45] as well as in the EST database.

can potentially encode a polypeptide of 91.6 kDa

Trans-lation from this upstream AUG site thus results in an

additional potential N-terminal 43 amino acids from

sequence previously regarded as 5¢-untranslated sequence

Because of the truncation of exon 5, there is also a loss of 15

amino acids including the 88 kDa start site The complete

sequence of two splice variants (V and VI) has been

published [26,45] 5¢-RACE was utilized to clone sequence

corresponding to splice variants III, IV, V, VI, VII, IX and

X in this study Sequence for splice sequence IX, isolated in

this study by 5¢-RACE of human myocardial cDNA, has

not been previously reported in the EST database

Collec-tively, these results underscore the complexity in the genetic

and molecular biologic mechanisms regulating the

tran-scriptional processing of iPLA2c into moieties suitable for

translation of specific polypeptides potentially tailored to

fulfill specific biologic roles in different tissues

Identification of alternative promotors present in iPLA2c

and demonstration of three MyoD regulatory elements

Alternative promoter usage represents yet another potential

mechanism for the regulation of the biosynthesis of iPLA2c

Because iPLA2c splice variants began with either exon 1

or exon 2, sequences upstream of these exons were next

examined for promoter activity Accordingly, we prepared

constructs in which 584 nucleotides of upstream iPLA2c

sequence from each exon were utilized to drive luciferase

reporter gene expression in CV1 cells Sequences upstream

of exon 2 had high promoter activity, whereas the

pre-exon 1 sequence had negligible promoter activity in CV1

cells (Fig 7A) Truncation of the 5¢ 200 nucleotides of the

pre-exon 2 sequence (Fig 7B, construct II) resulted in an

15-fold increase in promoter activity suggesting the

presence of repressor elements in the region 400–600

nucleotides upstream of exon 2 Removal of an additional

200 nucleotides from construct II resulted in the loss of the

majority of activity (construct III) indicating that the region

200–400 nucleotides upstream of exon 2 contains a

signifi-cant proportion of pre-exon 2 promoter activity This

conclusion was supported by use of a construct containing

sequence 200–400 nucleotides upstream of exon 2

(con-struct IV) which resulted in a fivefold increase in promoter

activity compared with the original construct (I), whereas a

construct containing sequence 400–584 nucleotides

up-stream of exon 2 (V) had only slight promoter activity

Construct VI, including sequence 200–584 nucleotides

upstream of exon 2, had promoter activity similar to that

of construct IV Construct VII (sequence 300–400

nucleo-tides upstream of exon 2) had no detectable promoter

activity, whereas constructs VIII (sequence 200–300

nucleo-tides upstream of exon 2) and IX (200–350 nucleonucleo-tides

upstream of exon 2) had similar promoter activity

com-pared with the original construct Promoter activity of genes

are typically regulated by a complex interplay of multiple

promoter elements and this is reflected in the data presented

in Fig 7B These results suggested that a region 200–400

nucleotides upstream of exon 2 contains a major proportion

of the promoter activity of the pre-exon 2 sequence

However, this activity is clearly modulated by sequences

upstream and downstream of this region The region 200–

400 nucleotides upstream of exon 2 includes predicted

A

B

C

Fig 7 Promoter analysis of the 5¢ flanking region of iPLA 2 c exon 2 (A) An iPLA 2 c promoter construct containing 584-nucleotide iPLA 2 c sequence upstream of exons 1 or 2 inserted upstream via HindIII/NcoI sites into the promoterless vector pGL3-Enhancer from Promega Empty pGL3-Enhancer vector and the SV40 containing promoter vector pGL3-Promoter were used as controls Luciferase activity measured as relative luminescence value is shown for vector pGL3-Enhancer constructs utilizing 584 nucleotide of iPLA 2 c sequence as an upstream promoter Lanes indicate constructs containing as promoters pre-exon 1 sequence (pre-exon 1), pre-exon 2 sequence (pre-exon 2), and the promoterless vector pGL3-Enhancer (pGL3E) (B) Constructs I–IX containing sequence upstream from exon 2 were prepared by PCR amplification of intronic sequence upstream from iPLA 2 c exon 2, cloning the PCR products into promoterless vector pGLE, followed by transfection of CV1 cells as described in Experimental procedures Relative sizes and nucleotide regions included in each construct are indicated as blocks to the left Luciferase activity, expressed as relative luminescence value, for each construct is indicated on the right (C) Competitive gel retardation analysis of the pre-exon 2 iPLA 2 c region utilizing Inr dimer Lane 1, negative control minus HeLa nuc-lear extract; lane 2, positive control containing HeLa nucnuc-lear extract; lane 3, competitive assay containing 100-fold molar excess Inr dimer; lane 4, noncompetitive assay containing 100-fold molar excess non-specific control dimer Results are representative of three separate EMSA Arrow: specific DNA–nuclear protein complex.