1. Trang chủ
  2. » Luận Văn - Báo Cáo

Tài liệu Báo cáo khoa học: Role of K22 and R120 in the covalent binding of the antibiotic fosfomycin and the substrate-induced conformational change in UDP-N-acetylglucosamine enol pyruvyl transferase docx

9 712 0
Tài liệu đã được kiểm tra trùng lặp

Đang tải... (xem toàn văn)

THÔNG TIN TÀI LIỆU

Thông tin cơ bản

Tiêu đề Role of K22 and R120 in the covalent binding of the antibiotic fosfomycin and the substrate-induced conformational change in UDP-N-acetylglucosamine enol pyruvyl transferase
Tác giả Alison M. Thomas, Cristian Ginj, Ilian Jelesarov, Nikolaus Amrhein, Peter Macheroux
Trường học Eidgenössische Technische Hochschule Zürich
Chuyên ngành Biochemistry
Thể loại Scientific Report
Năm xuất bản 2004
Thành phố Zürich
Định dạng
Số trang 9
Dung lượng 450,36 KB

Các công cụ chuyển đổi và chỉnh sửa cho tài liệu này

Nội dung

We demonstrated that the K22R mutant protein behaves simi-larly to wild-type enzyme, whereas the K22E mutant protein failed to form the covalent adduct.. Using isothermal titration calor

Trang 1

Role of K22 and R120 in the covalent binding of the antibiotic

fosfomycin and the substrate-induced conformational change in

Alison M Thomas1,*, Cristian Ginj1,*, Ilian Jelesarov2, Nikolaus Amrhein1and Peter Macheroux1

1

Eidgeno¨ssische Technische Hochschule Zu¨rich, Institute of Plant Sciences, Department of Agricultural and Food Sciences and Department of Biology, Zu¨rich, Switzerland;2Universita¨t Zu¨rich, Institute of Biochemistry, Zu¨rich, Switzerland

UDP-N-acetylglucosamine enolpyruvyl transferase (MurA),

catalyzes the first step in the biosynthesis of peptidoglycan,

involving the transfer of the intact enolpyruvyl moiety from

phosphoenolpyruvate to the 3¢-hydroxyl group of

UDP-N-acetylglucosamine (UDPNAG) The enzyme is irreversibly

inhibited by the antibiotic fosfomycin The inactivation is

caused by alkylation of a highly conserved cysteine residue

(C115) that participates in the binding of

phos-phoenolpyruvate The three-dimensional structure of the

enzyme suggests that two residues may play a decisive role in

fosfomycin binding: K22 and R120 To investigate the role

of these residues, we have generated the K22V, K22E, K22R

and R120K single mutant proteins as well as the K22V/

R120K and K22V/R120V double mutant proteins We

demonstrated that the K22R mutant protein behaves

simi-larly to wild-type enzyme, whereas the K22E mutant protein failed to form the covalent adduct On the other hand, the K22V mutant protein requires the presence of UDPNAG for the formation of the adduct indicating that UDPNAG plays a crucial role in the organization of productive inter-actions in the active site This model receives strong support from heat capacity changes observed for the K22V/R120K and R120K mutant proteins: in both mutant proteins, the heat capacity changes are markedly reduced indicating that their ability to form a closed protein conformation is impeded due to the R120K exchange

Keywords: transferase; fosfomycin; antibiotic; mutagenesis; protein conformation

A rigid cell wall is essential for the survival of most bacteria

Compounds that interfere with cell wall biosynthesis or

function, such as b-lactams, are powerful antibiotics and the

bacterial enzymes involved in cell wall biosynthesis are

attractive targets for the development of new drugs [1] The

biosynthesis of the cell wall component peptidoglycan (or

murein) commences with the transfer of the intact

enolpyr-uvyl moiety of phosphoenolpyruvate to the 3¢-hydroxyl

group of UDP-N-acetylglucosamine (UDPNAG) [2] This

reaction, catalysed by UDP-N-acetylglucosamine

enol-pyruvyl transferase (MurA), leads to the generation of

UDP-N-acetylenolpyruvylglucosamine (Scheme 1A) The

naturally occurring antibiotic fosfomycin, produced by some

Streptomyces and Pseudomonas species [3–5], irreversibly

inhibits MurA activity by alkylating the thiol group of a catalytically important cysteine residue, C115 (Scheme 1B) [6]

The rate of MurA inactivation by fosfomycin is increased considerably in the presence of UDPNAG [7] This accel-erating effect is not due to a change in the reactivity of the thiol group, as the pKaof the thiol group is not affected by UDPNAG binding [8] Crystallographic studies have shown that MurA is subject to a large conformational change upon binding of UDPNAG and fosfomycin or UDPNAG and (Z)-3-fluorophosphoenolpyruvate, respectively, to the free, unliganded enzyme [9–11] (Fig 1) In the unliganded form, the active site of MurA is readily accessible (open confor-mation) whereas in the liganded form (closed conforma-tion) a loop in the upper domain forms a lid on the active site, thereby shielding the ligands from solvent and gener-ating a compact structure This loop movement places the reactive C115 closer to fosfomycin or (Z)-3-fluorophos-phoenolpyruvate in the active site (Fig 1) Hence it can be assumed that fosfomycin and the thiol group of C115 are optimally positioned in the closed conformation, so that the nucleophilic attack of the thiol group is facilitated

In a recently initiated site-directed mutagenesis program,

we have discovered that replacement of K22 leads to a more than 300-fold decrease in enzymatic activity [12] Using isothermal titration calorimetry (ITC), fosfomycin binding was detected for the conservative mutation K22R in the presence of UDPNAG while the K22V and K22E mutant proteins appeared to have lost this ability completely [12] According to the three-dimensional structure of MurA [11],

Correspondence to P Macheroux, Graz University of Technology,

Institute of Biochemistry, Petersgasse 12/II, A-8010 Graz, Austria.

Fax: + 43 316 873 6952, Tel.: + 43 316 873 6450,

E-mail: peter.macheroux@tugraz.at

Abbreviations: fosfomycin, (1R,2S)-1,2-epoxypropylphosphonic acid;

glyphosate, N-(phosphonomethyl)-glycine; ITC, isothermal titration

calorimetry; MurA, UDP-N-acetylglucosamine enolpyruvyl

trans-ferase; TPCK, L -(tosylamido-2-phenyl) ethyl chloromethyl ketone;

UDPNAG, UDP-N-acetylglucosamine; DC p , heat capacity change;

DG, free energy change; DH, enthalpy change; DS, entropy change.

*Note: The first two authors contributed equally to this work.

(Received 16 February 2004, revised 26 April 2004,

accepted 30 April 2004)

Trang 2

the positively charged side chain of K22 participates in

fosfomycin binding, thus providing a rationale for the loss of

fosfomycin binding to the K22V and K22E mutant proteins

However, two other positively charged amino acid side

chains, R397 and R120, are also involved in fosfomycin

binding, and in view of the multitude of interactions, it was

assumed that deletion of a single interaction would not lead

to a complete loss of fosfomycin binding Therefore it was

argued that K22 may play a role in the transition of the open

and closed conformations, i.e it is part of a molecular switch

mechanism

To shed more light on the energetics of the

conform-ational change, we have recently completed a

thermody-namic study of UDPNAG binding to MurA [13] Based on

the analysis of the measured heat capacity changes (DC),

and on surface accessibility calculations, we have proposed that binding of UDPNAG alone is accompanied by a significant structural shift toward the closed conformation,

in agreement with evidence from studies of small angle X-ray scattering [14] and the protective effect of UDPNAG

on proteolysis of MurA [15] Here we report the thermo-dynamic profile of UDPNAG binding to two MurA single mutants, K22V and R120K, and the double mutant K22V/ R120K The emphasis is put on analysis of the heat capacity decrement as this parameter is a sensitive indicator

of both the changes in hydration and the conformational changes involved in protein–ligand interactions [16,17], and thus may provide further information on the molecular mechanism of fosfomycin and UDPNAG binding to MurA

Fig 1 Structural representation of MurA in

the open (A, PDB entry 1NAW [9]), and closed

(B, PDB entry 1UAE [11]), conformation The

thiol group of C115 is highlighted in green and

the nitrogen atoms of R120 and K22 in blue.

The open form of MurA is unliganded (A) and

the closed conformation (B) contains

fosfo-mycin (orange) and UDPNAG (purple) in the

active site The loop that carries C115 and

R120 is highlighted in yellow (A) and red (B),

respectively The figure was prepared using the

program MOLMOL [24].

Scheme 1 Reaction catalyzed by MurA (pathway for biosynthesis of UDP-N-acetylmuramic acid) (A) and inactivation mechanism of MurA by fosfomycin as a result of the covalent linkage between Cys115 of MurA and fosfomycin (B).

Trang 3

In a previous study, we have combined proteolysis with

MALDI-TOF mass spectrometry analysis to demonstrate

that fosfomycin forms the covalent adduct with C115 of

wild-type MurA even in the absence of UDPNAG [13]

Unlike ITC, which relies on measurable heat changes, this

method is independent of the thermodynamic and kinetic

properties of the binding process and is solely based on the

detectability of the peptides of interest We have used this

method to show that binding of fosfomycin to the K22

mutant proteins strongly depends on the charge of the

amino acid side chain occupying this position Taken

together, our combined calorimetric and protein chemical

approach leads to a more detailed understanding of the role

of K22 and R120 with respect to fosfomycin binding as well

as the ligand-induced conformational switch

Experimental procedures

Chemicals and enzymes

Fosfomycin (disodium salt) and UDP-N-acetylglucosamine

(sodium salt) were from Sigma, Buchs, Switzerland

1,4-dithio-D,L-threitol, EDTA, isopropyl thio-b-D

-galactopyr-anoside and Hepes were from Fluka, Buchs, Switzerland

Tris was from BDH Laboratory Supplies, Poole, England

Trypsin (EC 3.4.21.4) from bovine pancreas

(12 200 UÆmg)1; TPCK-treated to inactivate any remaining

chymotryptic activity) was from Sigma, Buchs, Switzerland

Site-directed mutagenesis

Mutagenesis was carried out using the Quik-change

site-directed mutagenesis kit from Stratagene as previously

described [18] The following oligonucleotides were used to

change the R120 to a lysine and a valine, respectively (the

codon changes are underlined): 5¢-primer (R to K): 5¢-GGT

TGCGCCATTGGCGCGAAACCTGTTGACCTGC

ATATC-3¢; 3¢-primer (R to K): 5¢-GATATGCAGGTCA

ACAGGTTTCGCGCCAATGGCGCAACC-3¢; 5¢-primer

(R to V): 5¢-GGTTGCGCCATTGGCGCGGTTCCTGT

TGACCTGCATATC-3¢; 3¢-primer (R to V): 5¢-GATATG

CAGGTCAACAGGAACCGCGCCAATGGCGCA

ACC-3¢

The template used for amplification was the pKK233-2

plasmid containing Enterobacter cloacae MurA wild-type

(for generation of the R120K single mutant) or the plasmid

encoding the K22V mutant (for generation of the K22V/

R120K double mutant) [12] The whole gene was

resequ-enced after site-directed mutagenesis in order to confirm

the introduction of the desired mutation and to exclude

that unwanted mutations occurred elsewhere in the gene

(Microsynth, Balgach, Switzerland)

Expression and purification of proteins

Wild-type MurA (from Enterobacter cloacae) and the K22V,

K22E, K22R, R120K, K22V/R120V and K22V/R120K

mutant proteins were expressed and purified as previously

described [12,19] The yield of purified K22V/R120V protein

was very low (< 1% as compared to wild-type) shown by

the lack of binding to the Reactive Yellow material used

in affinity chromatography Therefore microcalorimetric

measurements (see below) could only be performed with the K22V, R120K and K22V/R120K mutant proteins The protein concentration was determined using an extinction coefficient of 24 020M )1Æcm)1at 280 nm or with Bradford reagent (Pierce) using bovine serum albumin (BSA) for calibration

MALDI-TOF-MS analysis of fosfomycin binding Wild-type MurA, the K22V, K22R and K22E single mutant proteins and the K22V/R120K and K22V/R120V double mutant proteins (100 lM) were incubated for 50 min

at 25C in 50 mM Tris/HCl, pH 7.4 under each of the following conditions: (a) no substrates; (b) 10 mM fosfo-mycin; (c) 10 mMfosfomycin and 1 mM UDPNAG; and (d) 1 mM fosfomycin and 10 mM UDPNAG Trypsin (0.5 mgÆmL)1) was added to the reaction and incubated for 16 h at 25C Removal of excess substrates was achieved by desalting the reactions using pre-equilibrated Sep-Pak C18 columns (Waters) as previously described [13,18] MALDI-TOF-MS spectra were recorded with a Voyager Elite mass spectrometer using the reflectron mode for increased mass accuracy; interpretation of the spectra was based on the analysis reported earlier [15]

Isothermal titration calorimetry All measurements were carried out in 50 mMHepes/NaOH,

pH 7.4, containing 2 mMdithiothreitol and 0.5 mMEDTA Sample preparation and titrations were performed as described previously [12] using a MCS isothermal titration microcalorimeter from Microcal Inc The K22V, R120K and K22V/R120K MurA variants (200–420 lM) were titrated with UDPNAG from a 5 mM stock solution at temperatures between 10 and 30C The double mutant proteins were not stable at 30C with stirring in the ITC cell; the data obtained at this temperature was not included

in the analysis The raw data were integrated and normal-ized for molar concentration The dissociation constants, Kd values, enthalpies of binding and stoichiometries were determined from the binding isotherm by fitting a 1 : 1 binding model to the data using the software provided by the manufacturer

Results

Reaction of fosfomycin with wild-type and the K22V, K22E and K22R mutant proteins

We have shown previously by ITC that fosfomycin binding

to wild-type MurA and the K22 mutant proteins in the presence of UDPNAG is accompanied by heat release in the case of wild-type enzyme and the K22R mutant protein, but

is calorimetrically silent with the K22V and K22E mutant proteins This was interpreted as a lack of fosfomycin binding to these mutant proteins [12] Binding of fosfomycin

to either wild-type MurA or the K22 mutant proteins in the absence of UDPNAG is not associated with a heat change

in any case

To gain further information on fosfomycin binding to MurA, we have developed a rapid and reliable method to detect the covalent adduct formed between the thiol group

Trang 4

of C115 and fosfomycin (Scheme 1B) Trypsinolysis of

wild-type MurA and the K22 mutant proteins (Fig 2A and B)

produces a peak at 1616 Da (m/z) comprising amino acids

104–120 [15] Incubation of wild-type MurA with

fosfo-mycin prior to trypsinolysis in the absence or presence

of UDPNAG results in the appearance of a new peak at

1754 Da (m/z) which is assigned to the Cys115–fosfomycin covalent adduct (observed mass difference¼ 138 Da, as expected) (Fig 2C, E and G) At the same time the peak of the unlabeled peptide fragment disappears or becomes

Fig 2 Comparison of MALDI-TOF spectra between the masses of 1600 and 1800 for wild-type Enterobacter cloacae MurA (left) and the K22V mutant protein (right) (A and B) Tryptic digest of wild-type MurA and the K22V mutant protein (no additions) (C and D) Wild-type E cloacae MurA and the K22V mutant protein incubated with 10 m M fosfomycin prior to digestion (E and F) Wild-type MurA and the K22V mutant protein incubated with 1 m M UDPNAG and 10 m M fosfomycin prior to digestion (G and H) Wild-type MurA and the K22V mutant protein incubated with 10 m M UDPNAG and 1 m M fosfomycin prior to digestion The mass peak of 1616 (m/z) is due to the peptide of amino acids 104–

120 and on binding of fosfomycin this mass shifts to 1754 (m/z) The peak at 1657 (m/z) is attributed to the peptide fragment comprising amino acids 295–310 and is attributed to tryptic and chymotryptic cleavage.

Trang 5

much less intense When the same experiment is carried out

with the K22 mutant proteins, marked differences are

observed: in the case of the K22V mutant protein, covalent

binding of fosfomycin requires the presence of UDPNAG

(Fig 2D, F and H) while the K22E mutant protein lacks the

ability to form the covalent adduct completely (Table 1) On

the other hand, the K22R mutant protein behaves very

similar to wild-type enzyme (data not shown) While the

results obtained with the K22R and K22E mutant proteins

are in agreement with the ITC measurements, the K22V

mutant protein clearly binds fosfomycin covalently, albeit

only in the presence of UDPNAG This finding is in

contrast to the lack of a heat signal in ITC measurements

Hence it can be concluded that the absence of an ITC signal

with this mutant protein is not due to a lack of adduct

formation, but rather indicates that the binding process is

not associated with a measurable net heat change

The finding that binding of UDPNAG to the K22V

mutant protein restores the ability to form the covalent

adduct with fosfomycin raises a question about the

molecular mechanism of this salvage process The

three-dimensional structure of the ternary complex [11] indicates

that UDPNAG interacts with the phosphonate group of

fosfomycin and also with the guanidinium group of R120,

which in turn forms a salt-bridge to the phosphonate group

(see below) This amino acid residue is invariant in all

known MurA sequences and is part of the loop region that

forms a lid on the active site upon the formation of the

closed protein conformation (Fig 1) Hence, it is plausible

that UDPNAG plays a direct role and/or an indirect role to

engage residues in the loop for binding interactions with the

phosphonate group of fosfomycin (or with the phosphate

group of phosphoenolpyruvate during normal catalysis) In

order to investigate the importance of R120 for the

formation of the covalent fosfomycin adduct, we

construc-ted the K22V/R120V and K22V/R120K double mutants

(see Materials and methods) and repeated the analysis of

adduct formation in the absence and presence of

UDP-NAG As shown in Fig 3, the K22V/R120K mutant

Table 1 Covalent adduct formation with fosfomycin and enzymatic

activity of wild-type MurA and the protein mutants investigated in this

study Proteins were incubated with fosfomycin alone (10 m M final

concentration) or with fosfomycin and UDPNAG The latter

experi-ment was performed using either 10 m M fosfomycin and 1 m M

UDPNAG or 1 m M fosfomycin and 10 m M UDPNAG, respectively.

The results obtained under these two different conditions were

essen-tially the same +, indicates detection of the fosfomycin-labelled

tryptic fragment comprising amino acids 104–120; –, no detection The

effect of the mutation(s) on catalytic activity is also listed *, Residual

activities too small to be measured reliably.

Protein Fosfomycin

Fosfomycin + UDPNAG

Activity (%)

Fig 3 Incubation of the K22V/R120K double mutant protein with fosfomycin followed by MALDI-MS analysis The experimental con-ditions are as described in the legend to Fig 2 (A) The double mutant protein with no additions; (B) incub ation with 10 m M fosfomycin; (C) incubation with 10 m M fosfomycin and 1 m M UDPNAG and (D) incubation with 1 m M fosfomycin and 10 m M UDPNAG The peak of the unlabeled tryptic fragment (amino acids 295–310) is at 1588 (m/z) and when labelled with fosfomycin a peak at 1726 (m/z) is expected The position of the expected mass of the fosfomycin-labelled peak is marked by an arrow in each panel.

Trang 6

protein did not form the covalent fosfomycin adduct, even

in the presence of UDPNAG (Fig 3C,D) Note that the

mass shift of the unlabeled fragment (amino acids 104–120)

from 1616 Da (MH+) to 1588 Da (MH+) is due to the

arginine to lysine exchange in position 120 (expected mass

shift¼ 28 Da)

The data collected for wild-type MurA, the three single

and two double mutant proteins are summarized in Table 1

From this analysis, it is clear that even a conservative amino

acid exchange from arginine to lysine at position 120

disables the UDPNAG-dependent rescue mechanism for

the formation of a covalent adduct This in turn suggests

that UDPNAG assists in the assembly of the proper

interactions in the active site by stabilizing the closed

conformation of the protein In the closed conformation,

R120 moves from an outside position into an inside

position close to the negatively charged phosphonate (in the

case of fosfomycin) or phosphate (in the case of

phos-phoenolpyruvate) group (Fig 1, compare panel A and B)

From this it would follow that R120 is an important residue

in the stabilization of the closed conformation of the

protein This hypothesis can be tested by assessing the extent

of the conformational change occurring upon addition of

UDPNAG to a mutant protein carrying a different amino

acid residue in position 120 The experimental strategy

chosen to test our hypothesis was recently established with

wild-type enzyme demonstrating that the conformational

changes occurring upon ligand binding are accompanied by

significant heat capacity changes

Determination of the heat capacity changes for the K22V,

R120K and K22V/R120K mutant proteins

In a recent study, we measured the thermodynamic

parameters for UDPNAG binding to wild-type enzyme as

a function of temperature [13] The heat capacity change

(DCp) was obtained from the slope of Kirchoff’s plots (DH

vs T) Analysis of the experimental DCp with DCp

calculated from the change of solvent accessible surface

upon transition from the open to the closed MurA

conformation, indicates that UDPNAG binding alone

induces the formation of the closed conformation to a large

extent [13] We have carried out the same analysis with the

K22V and R120K single and the K22V/R120K double

mutant proteins in order to obtain information on how the

replacement of these two important side chains affect the

protein conformational change

The binding of UDPNAG is only slightly weaker (threefold) for the single and double mutant proteins Therefore, the experiments were conducted under similar experimental conditions as for wild-type enzyme [12] All thermodynamic parameters derived from our experiments are summarized in Table 2 As shown in Fig 4B, binding of UDPNAG to the K22V mutant protein is exothermic, and

DH, DS and DCpare the same (within error) as the values reported previously for wild-type enzyme [13] On the other hand, UDPNAG binding to the K22V/R120K double mutant protein (Fig 4A) is less exothermic in the entire temperature interval and DCp¼ 1.38 kJÆmol)1ÆK)1is sig-nificantly smaller than DCpmeasured for both the wild-type MurA and the K22V variant ()1.9 kJÆmol)1ÆK)1 and )2.0 kJÆmol)1ÆK)1, respectively) The unfavorable entropic contribution is also reduced As the strength of UDPNAG binding is not much affected by either mutation, the thermodynamic profiles indicate that replacement of K22

by valine does not interfere with the conformational change induced by UDPNAG binding, whereas the additional replacement of R120 by lysine reduces the probability of forming the fully closed form of the protein

The results obtained with the K22V/R120K double mutant protein point toward a central role of arginine 120

in the conformational process occurring during catalysis Therefore, we have generated the R120K single mutant protein to define its importance in catalysis and the conformational change Similarly, the heat capacity change observed for UDPNAG binding is the same as for the K22V/R120K double mutant protein, supporting a model

in which R120 plays the crucial role in the open-closed transformation in MurA

Discussion

MurA undergoes a pronounced, conformational change upon ligand binding The loop region of the upper domain moves towards the active site of the enzyme, thus shielding the substrates (and ligands) from bulk solvent A detailed thermodynamic study of this process has indicated that the shift of the equilibrium towards the closed conformation is induced to a large extent by UDPNAG [13] Here we have shown that the thermodynamic characteristics of this process are identical in the K22V mutant protein, indicating that the mode and extent of the conformational change is very similar to wild-type MurA This finding is in clear contrast to an earlier hypothesis that K22 plays a key role in

Table 2 Thermodynamic parameters for the binding of UDPNAG to the K22V, R120K and K22V/R120K mutant proteins in comparison to wild-type MurA Values at 20 C were chosen as example All measurements were performed in 50 mm Hepes, pH 7.4 The calculated values for DH, DG, TDS and K d are from duplicate experiments DC p was calculated from the slope of the regression of DH vs T All values except K d and DC p are in kJÆmol)1 K d is in l M and DC p is in kJÆmol)1ÆK)1 DG was calculated from DG ¼ RT ln K d The errors are estimated to be ± 1% for DG, ± 3% for DH, ± 9% for DS and 15% for DC p The calculated and experimental DC p for wild-type MurA was taken from a previous report [13].

Trang 7

the conformational change, possibly as part of a molecular

switch mechanism [12] On the other hand, analysis of

tryptic fragments obtained after incubation with fosfomycin

alone and in combination with UDPNAG have provided

further insight into the molecular mechanism driving the

formation of the covalent C115–fosfomycin adduct A

conservative exchange of K22 to arginine maintains

fosfo-mycin binding, while a charge reversal in the K22E mutant

enzyme completely abolishes the ability to form the covalent adduct (Table 1)

Inspection of the three-dimensional structure of MurA complexed with fosfomycin and UDPNAG provides a rationale for these findings: the side chain amino group of K22 engages in a salt-bridge interaction with the phospho-nate group of fosfomycin (Fig 5) Clearly, the guanidinium group of arginine can, at least in part, fulfil this function while the negatively charged glutamate side chain weakens

or even prohibits fosfomycin binding due to charge–charge repulsions Most interestingly, the uncharged valine side chain completely abolishes fosfomycin binding in the absence of UDPNAG Clearly, UDPNAG binding creates additional favorable interactions that promote fosfomycin binding to the enzyme As shown in Fig 5, UDPNAG may exhibit a direct and/or an indirect effect on the binding environment of fosfomycin The direct influence comes from two hydrogen bonds formed by the nitrogen of the N-acetyl group and the 3¢-oxygen to the phosphonate and hydroxyl group of fosfomycin, respectively (Fig 5) An indirect effect of UDPNAG may be exerted via a salt-bridge

of its diphosphate group to the distal guanidinium nitrogen atom of the invariant R120 (Fig 5) R120 is located in the flexible loop and hence does not interact with fosfomycin in the open form of the protein However, as the closed conformation of the protein is stabilized by UDPNAG, R120 is recruited as a binding partner for fosfomycin Thus the bidentate character of the H-bonding network involving R120 appears to be critical for formation of the fosfomycin– MurA covalent adduct The critical role of R120 in generating productive interactions in the active site, is emphasized by the 2000-fold decrease in catalytic activity (Table 1) that is greater than the loss of activity found with all other single mutant proteins characterized so far [12,18]

We envisage the following putative mechanism: K22 provides an essential binding site by positioning and/or stabilizing the fosfomycin phosphonate group via an

Fig 4 Temperature dependence of DH (circles, solid lines), DG

(squares, dotted line) and –TDS (triangles, dashed lines) for UDPNAG

binding to the K22VR120K (A), K22V (B) and R120K mutant proteins

(C) Thermodynamic data for wild-type MurA is included for

com-parison and is represented by filled symbols in (A)–(C) Open symbols

are parameters measured for the corresponding mutant In a typical

experiment 200–420 l M protein was titrated with 5 m M UDPNAG.

DC p was determined from the slope of the regression line describing the

temperature dependence of DH.

Fig 5 Schematic respresentation of the active site of MurA with UDPNAG and fosfomycin bound The dashed lines indicate hydrogen bond interactions and the numbers give the distances in A˚ (based on the structure reported in [11]).

Trang 8

H-bond If the Neatom of K22 is missing (as in the K22V

mutant), the fosfomycin binding/reaction with C115 occurs

only in the presence of UDPNAG as the substrate promotes

the interaction of R120 and fosfomycin in order to form a

complex optimal for the nucleophilic attack of the thiol

group This complex greatly resembles the closed

confor-mation The observed lack of fosfomycin binding and

covalent attachment to the K22V/R120K double mutant

protein supports this scenario Lysine in position 120 cannot

form simultaneously the H-bonds depicted in Fig 5 If

fosfomycin is not initially oriented/bound by K22, a lysine

in position 120 possibly makes (if at all) only a single

H-bond to the N-acetyl group of UDPNAG As the lysine

side chain is somewhat shorter than the arginine side chain,

it is no longer positioned in an optimal way to form

potential H-bonds with fosfomycin As a consequence, the

required H-bonding partners of fosfomycin are not present

in the K22V/R120K MurA variant and the covalent adduct

is no longer formed At the same time, formation of the

intricate H-bond pattern involving two H-bond donors for

bidentate interaction (Fig 5) may be a stringent prerequisite

for the complete closure of the lid

The thermodynamic profile of UDPNAG binding to the

MurA variants studied here supports this model UDPNAG

binds with very similar affinities to wild-type MurA and its

K22V, R120K and K22V/R120K variants The free energy

difference, DDG¼ DGmut– DGwt, is only 2–3 kJÆmol)1, and

DGR120K and DGK22V equal DGK22V/R120K within error

Moreover, we have demonstrated that the presence of

fosfomycin is also not critical to UDPNAG binding [13] It

follows that UDPNAG binds in a preformed pocket and

does not require significant interactions with either K22 or

with fosfomycin, nor with the guanidinium group of R120

Also, the heat capacity decrement associated with

UDP-NAG binding is not related to interactions involving K22

However, the heat capacity decrement is dependent on the

presence of a short H-bond with R120, as it is significantly

lower in the K22V/R120K and R120K mutant proteins

Replacement of R120 by lysine causes a 25% reduction of

DCp for both the single R120K and the K22V/R120K

double mutant protein indicating that the lysine plays a

pivotal role in formation of the closed conformation, i.e the

closure of the lid This is supported by the decrease in

enthalpy and the reduction of unfavorable entropy in the

double mutant protein that is compatible with a less ordered

structure of the lid making fewer contacts with the body of

the protein Alternatively, the observed changes in the

thermodynamic parameters for the K22V/R120K and

R120K mutant proteins might be caused by differences in

the thermal/vibrational content of the complex As the

structure of the binary complex of MurA with bound

UDPNAG is not available, it is not possible to calculate

how much of the heat capacity change is due to hydration

effects Also, the lack of a binary structure does not allow us

to evaluate the extent to which the conformational change is

impeded by the mutations However, our results clearly

demonstrate that (a) the interaction between UDPNAG

and R120 is the critical driving force triggering the

conformational transition from the open to the closed state,

and (b) the lid closes completely only if all interactions

between properly positioned UDPNAG, fosfomycin, K22

and R120 take place

The structurally and functionally related enzyme 5-enolpyruvylshikimate 3-phosphate synthase has an invari-ant arginine residue in a corresponding position (R124) The three-dimensional structure of this enzyme in complex with the reversible inhibitor glyphosate also demonstrates that R124 forms a salt-bridge to the phosphonate group of glyphosate [20] In contrast to MurA, however, 5-enolpyr-uvylshikimate 3-phosphate synthase lacks the flexible loop including the cysteine residue and, moreover, the enolpyr-uvyl-accepting substrate, shikimate-3-phosphate, does not interact with R124 in the ternary complex [20] Hence, the mechanism of binding of fosfomycin by reinforcement of an initial binding site (mainly K22 and R397) through recruit-ment of secondary binding partners located in a flexible loop (R120) cannot be envisaged for 5-enolpyruvylshiki-mate 3-phosphate synthase Despite phylogenetic, structural and mechanistic similarities between 5-enolpyruvylshiki-mate 3-phosphate synthase and MurA, it appears that these two enzymes have developed different strategies to bind the substrate and to shield the active site against bulk solvent during the catalytic process

As UDPNAG binding to the K22V mutant protein overcomes the constraints on fosfomycin adduct formation, then why is this mutant protein catalytically inactive [12]? Although phosphoenolpyruvate was shown to be capable of reacting with the thiol group of C115 in a fashion similar

to fosfomycin [19,21], this adduct appears to be an off-pathway species that releases phosphoenolpyruvate in the active site of MurA, which then reacts with the 3¢-hydroxyl group of bound UDPNAG to form a O-phosphothioketal [22,23] This species then eliminates phosphate to yield the product UDP-N-acetylenolpyruvylglucosamine The stereo-chemical course of the reaction (anti-addition, syn-elimin-ation [10]) also dictates that the reacting molecules are properly positioned by neighboring amino acid residues Hence, productive catalysis is subject to various chemical and steric constraints in contrast to the comparably simple adduct formation with fosfomycin It follows that the role

of K22 in catalysis is to provide a binding partner for the phosphate group of phosphoenolpyruvate as well as to achieve proper alignment of the reactants during the critical addition–elimination steps

Acknowledgements

This work was supported by the ETH through an internal research grant to P M and N A (0-20-515-98) We would also like to thank

A K Samland for many stimulating discussions and for providing the K22V, K22E and K22R mutant plasmids We are also grateful to

T Etezady-Esfarjani for his help in preparing Fig 1.

References

1 El Zoeiby, A., Sanschagrin, F & Levesque, R.C (2003) Structure and function of the Mur enzymes: development of novel inhibitors Mol Microbiol 47, 1–12.

2 Bugg, T.D.H & Walsh, C.T (1992) Intracellular steps of bacterial cell wall peptidoglycan biosynthesis: Enzymology, antibiotics, and antibiotic resistance Natural Product Reports 9, 199–215.

3 Hendlin, D., Stapley, E.O., Jackson, M., Wallick, H., Miller, A.K., Wolf, F.J., Miller, T.W., Chaiet, L., Kahan, F.M., Foltz, E.L., Woodruff, H.B., Mata, J.M., Hernandez, S & Mochales, S.

Trang 9

(1969) Phosphonomycin, a new antibiotic produced by strains of

streptomyces Science 166, 122–123.

4 Katayama, N., Tsubotani, S., Nozaki, Y., Harada, S & Ono, H.

(1990) Fosfadecin and fosfocytocin, new nucleotide antibiotics

produced by bacteria J Antibiotics 43, 238–246.

5 Shoji, J., Kato, T., Hinoo, H., Hattori, T., Hirooka, K.,

Matsu-moto, K., TaniMatsu-moto, T & Kondo, E (1986) Production

of fosfomycin (phosphonomycin) by Pseudomonas syringae.

J Antibiotics 39, 1011–1012.

6 Kahan, F.M., Kahan, J.S., Cassidy, P.J & Kropp, H (1974) The

mechanism of action of fosfomycin (phosphonomycin) Ann NY

Acad Sci 235, 364–385.

7 Marquardt, J.L., Brown, E.D., Lane, W.S., Haley, T.M.,

Ich-ikawa, Y., Wong, C.-H & Walsh, C.T (1994) Kinetics,

stoichio-metry, and identification of the reactive thiolate in the inactivation

of UDP-GlcNAc enolpyruvoyl transferase by the antibiotic

fosfomycin Biochemistry 33, 10646–10651.

8 Krekel, F., Samland, A.K., Macheroux, P., Amrhein, N & Evans,

J.N.S (2000) Determination of the pK a value of C115 in

MurA (UDP-N-acetylglucosamine enolpyruvyltransferase) from

Enterobacter cloacae Biochemistry 39, 12671–12677.

9 Scho¨nbrunn, E., Sack, S., Eschenburg, S., Perrakis, A., Krekel, F.,

Amrhein, N & Mandelkow, E (1996) Crystal structure of

UDP-N-acetylglucosamine enolpyruvyltransferase, the target of the

antibiotic fosfomycin Structure 4, 1065–1075.

10 Skarzynski, T., Kim, D.H., Lees, W.J., Walsh, C.T & Duncan, K.

(1998) Stereochemical course of enzymatic enolpyruvyl transfer

and catalytic conformation of the active site revealed by the crystal

structure of the fluorinated analogue of the reaction tetrahedral

intermediate bound to the active site of the C115A mutant of

MurA Biochemistry 37, 2572–2577.

11 Skarzynski, T., Mistry, A., Wonacott, A., Hutchinson, S.E., Kelly,

V.A & Duncan, K (1996) Structure of

UDP-N-acetylgluco-samine enolpyruvyl transferase, an enzyme essential for the

synthesis of bacterial peptidoglycan, complexed with substrate

UDP-N-acetylgucosamine and the drug fosfomycin Structure 4,

1465–1474.

12 Samland, A.K., Amrhein, N & Macheroux, P (1999) Lysine 22 in

UDP-N-acetylglucosamine enolpyruvyl transferase from

Enterobacter cloacae is crucial for enzymatic activity and the

formation of covalent adducts with the substrate

phosphoenol-pyruvate and the antibiotic fosfomycin Biochemistry 38,

13162–13169.

13 Samland, A.K., Jelesarov, I., Kuhn, R., Amrhein, N &

Macher-oux, P (2001) Thermodynamic characterization of

ligand-induced conformational changes in UDP-N-acetylglucosamine

enolpyruvyl transferase Biochemistry 40, 9950–9956.

14 Scho¨nbrunn, E., Svergun, D.I., Amrhein, N & Koch, M.H.J (1998) Studies on the conformational changes in the bacter-ial cell wall b iosynthetic enzyme UDP-N-acetylglucosamine enolpyruvyltransferase (MurA) Eur J Biochem 253, 406–412.

15 Krekel, F., Oecking, C., Amrhein, N & Macheroux, P (1999) Substrate and inhibitor-induced conformational changes in the structurally related enzymes UDP-N-acetylglucosamine enolpyruvyl transferase (MurA) and 5-enolpyruvylshikimate 3-phosphate synthase (EPSPS) Biochemistry 38, 8864–8878.

16 Spolar, R.S & Record, M.T Jr (1994) Coupling of local folding

to site-specific binding of proteins to DNA Science 263, 777– 784.

17 Baker, B.M & Murphy, K.P (1998) Prediction of binding energetics from structure using empirical parameterization Methods Enzymol 295, 294–315.

18 Samland, A.K., Etezady-Esfarjani, T., Amrhein, N & Macher-oux, P (2001) Asparagine 23 and aspartate 305 are essential residues in the active site of UDP-N-acetylglucosamine enolpyruvyl transferase from Enterobacter cloacae Biochemistry

40, 1550–1559.

19 Wanke, C & Amrhein, N (1993) Evidence that the reaction of the UDP-N-acetylglucosamine 1-carboxyvinyltransferase proceeds through the O-phosphothioketal of pyruvic acid bound to Cys115

of the enzyme Eur J Biochem 218, 861–870.

20 Scho¨nbrunn, E., Eschenburg, S., Shuttleworth, W.A., Schloss, J.V., Amrhein, N., Evans, J.N.S & Kabsch, W (2001) Interaction

of the herbicide glyphosate with its target enzyme 5-en-olpyruvylshikimate 3-phosphate synthase in atomic detail Proc Natl Acad Sci USA 98, 1376–1380.

21 Brown, E.D., Marquardt, J.L., Lee, J.P., Walsh, C.T & Anderson, K.S (1994) Detection and characterization of a phospholactoyl-enzyme adduct in the reaction catalyzed by UDP-N-acetylglucosamine enolpyruvoyl transferase, MurZ Biochem-istry 33, 10638–10645.

22 Marquardt, J.L., Brown, E.D., Walsh, C.T & Anderson, K.S (1993) Isolation and structural elucidation of a tetrahedral intermediate in the UDP-N-acetylglucosamine enolpyruvoyl transferase enzymatic pathway J Am Chem Soc 115, 10398– 10399.

23 Ramilo, C., Appleyard, R.J., Wanke, C., Krekel, F., Amrhein, N.

& Evans, J.N.S (1994) Detection of the covalent intermediate of UDP-N-acetylglucosamine enolpyruvyl transferase by solution-state and time-resolved solid-solution-state NMR spectroscopy Biochem-istry 33, 15071–15079.

24 Koradi, R., Billeter, M & Wu¨thrich, K (1996) MOLMOL: a program for display and analysis of macromolecular structures.

J Mol Graph 14, 29–32.

Ngày đăng: 19/02/2014, 13:20

TỪ KHÓA LIÊN QUAN

TÀI LIỆU CÙNG NGƯỜI DÙNG

TÀI LIỆU LIÊN QUAN

🧩 Sản phẩm bạn có thể quan tâm