Tài liệu Báo cáo khóa học: The lysozyme of the starfishAsterias rubens A paradigmatic typei lysozyme docx

We showed that, in addition to bivalve lysozymes, homologous sequences can be found in the genome of the nematode Caenorhab-ditis elegansand that of the fly Drosophila melanogaster, as we

The lysozyme of the starfish Asterias rubens

A paradigmatic type i lysozyme

Sana Bachali1, Xavier Bailly2, Jacqueline Jolle`s3, Pierre Jolle`s3,* and Jean S Deutsch1

1

E´quipe De´veloppement et E´volution, UMR 7622 ‘Biologie du de´veloppement’, CNRS et Universite´ P& M Curie, Paris, France;

2

Station Biologique, Roscoff, France;3Laboratoire des Prote´ines, Universite´ Paris V, France

On the basis of a partial N-terminal sequence, Jolle`s

and Jolle`s [Jolle`s, J., & Jolle`s, P (1975) Eur J Biochem 54,

19–23] previously proposed that the lysozyme from the

starfish Asterias rubens represents a new form of lysozyme,

called type i (invertebrate) lysozyme Indeed, it differed from

both the types c (chicken) and g (goose) known in other

animals, as well as from plant and phage lysozymes

Recently, several proteins belonging to the same family have

been isolated from protostomes Here we report the

com-plete mature protein sequence and cDNA sequence of the lysozyme from Asterias These sequences vindicate the previously proposed homology between the starfish, a deuterostome, and protostome lysozymes In addition, we present a structural analysis that allows us to postulate upon the function of several conserved residues

Keywords: cDNA; invertebrates; lysozyme; starfish; struc-ture

During recent years, interest in a new type of lysozyme, the

invertebrate-type (i-type), has been growing In 1996 Jolle`s

et al [1] published the N-terminal sequences of lysozymes

from two coastal bivalves belonging to the genus Mytilus

and of four deep-sea bivalves belonging to the genera

Bathymodiolusand Calyptogena This lysozyme represented

a model for the digestion of bacteria by the deep-sea

bivalves [2] A similar lysozyme was then described in other

bivalves, Tapes japonica [3], and Chlamys islandica [4,5]

These authors noticed the striking similarity between the

bivalve lysozyme and another protein, the so-called

desta-bilase identified in the medicinal leech Hirudo medicinalis

[6,7] It was then determined that the leech destabilase also

has lysozyme activity [8,9]

In a previous work [10], we reported the cDNA

sequence of several bivalve lysozymes We showed that,

in addition to bivalve lysozymes, homologous sequences

can be found in the genome of the nematode

Caenorhab-ditis elegansand that of the fly Drosophila melanogaster, as

well as expressed sequences tags from penaeid shrimps,

indicating that these species possess putative proteins akin

to the lysozyme i type We performed a phylogenetic analysis of all of these sequences together with those of the more conventional lysozyme c type; the results suggested that these two lysozymes originate from a common gene ancestor, at least in the central exon coding for the active lysozyme domain [10]

In fact, the existence of a new type of lysozyme, lysozyme

i, was proposed as early as 1975, on the basis of the N-terminal sequence of a lysozyme extracted from the starfish Asterias rubens[11] All recently described type-i lysozymes, including putative proteins derived from nucleic acid sequences, belong to protostome species Thus, it seems worthwhile to revisit the lysozyme i from the deuterostome invertebrate in which it has been described for the first time

In the present work, we present the protein sequence and the complete cDNA sequence of the lysozyme i from A rubens

In addition, we present putative models of its secondary and tertiary structure

Material and methods Biological material

The starfish A rubens was collected near Roscoff (Brittany, France) For RNA extraction, samples were preserved in RNAlaterTMsolution (Ambion) to inactivate RNAases Protein sequencing

The A rubens lysozyme was prepared according to Jolle`s and Jolle`s [11] The lysozyme was reduced according to Jolle`s et al [12], using iodoacetamide for alkylation Diges-tion by trypsin or carboxypeptidase (Worthington, Lake-wood, NJ, USA)

1 or by Staphylococcus aureus V8 proteinase (Miles) was performed for 18 h at 37
C in 0.1M ammo-nium bicarbonate with an enzyme/substrate ratio of 1 : 50 Cyanogen bromide (Merck) cleavage was performed in

Correspondence to J S Deutsch, E´quipe De´veloppement et E´volution,

UMR 7622 ‘Biologie du de´veloppement’, CNRS et Universite´ P & M

Curie, 9 quai St-Bernard, case 241, 75252 Paris cedex 05, France.

Fax: +33 14427 3253, Tel.: +33 14427 2576,

E-mail: jean.deutsch@snv.jussieu.fr

Note: The nucleotide sequence of the Asterias lysozyme i cDNA is

available in the GenBank database under accession number

AY390770.

*Present address: MNHN, Paris and Mine´ralogie Cristallographie

(LMCP) UMR 7590, Universite´ P & M Curie, Paris (France),

pl Jussieu, case 115, 75252 Paris cedex 05, France.

(Received 22 September 2003, revised 4 November 2003,

accepted 11 November 2003)

70% formic acid for 48 h at 20
C HPLC of the peptides

was performed with a Waters chromatograph (model ALC/

GPC-204) using a Brownlee RP 300 column (22· 4.6 cm)

and absorbance at 220 and 280 nm was followed Each

peptide (0.2 nmol) was submitted to automated Edman

degradation in an Applied Biosystems 470A protein

sequencer The phenylthiohydantoins of amino acids were

identified by an on-line Applied Biosystems 120A PTH

analyser

Synthesis of cDNA

Total RNA was extracted using the RNeasy Mini Kit

(Qiagen) according to the manufacturer’s instructions It

was treated with RNAase-free DNAase I (Pharmacia) for

30 min at 37
C cDNA was synthesized by reverse

transcription from DNAase-treated RNA using Moloney

murine leukaemia virus reverse transcriptase (Stratagene)

and an oligo-dT primer

RACE/PCR, cloning and sequencing

A 3¢ RACE/PCR was performed using this cDNA as a

template, an oligo-dT primer and a degenerate primer (AS1,

Table 1) designed from the N-terminal sequence of the

A rubens lysozyme determined by Jolle`s and Jolle`s [11]

This yielded too short a fragment to represent the complete

3¢ end of the lysozyme cDNA Yet, its sequence showed a

clear homology with other lysozyme i sequences [10] We

thought that this was due to inappropriate priming of the

oligo-dT primer The specific (nondegenerated) primer AS3

(Table 1) was determined from this first sequence fragment

Then a second PCR step was performed using AS3 and the

oligo-dT

PCR were performed on cDNA in 20-lL reaction mix

containing 5¢- and oligo-dT primers at 20 and 4 pmol,

respectively, dNTP 10 mMand 5 U Qbiotaq DNA

poly-merase (Q-Biogene) PCR cycles were as follows: 3 min at

94
C followed by 30–40 cycles of 1 min at 94
C, 1 min at

56–59
C (depending on the primers), 1 min at 72
C and

finally 10 min at 72
C

After amplification, the PCR products were analysed by

electrophoresis through 1% agarose gels and purified using

the Jetsorb Kit (Genomed) They were cloned in a

T-overhang vector derived from pBlueScript KS+

(Strata-gene), prepared according to Holton [13] Sequencing was

performed on both strands with the thermosequenase

fluorescent-labelled primer cycle sequencing kit and

7-deaza-dGTP (Amersham Pharmacia)

To expand the cDNA on its 5¢ side, the specific antisense

primers AS3R and AS4R (Table 1) were used for reverse

transcription The cDNA was extended by terminal trans-ferase A (Biolabs) Two amplification steps were performed using AS3R/oligo-dT and AS4/oligo-dT at the annealing temperature of 57
C and 58
C, respectively The 5¢ RACE fragment was purified, cloned and sequenced as described above

Computer structural analysis The signal peptide and cleavage site of the putative Asterias lysozyme i protein were determined using the following software:SIGNAL Phttp://www.cbs.dtu.dk/services/SignalP/ andPSORT IIhttp://psort.nibb.ac.jp/ Hydrophobic Cluster Analysis (HCA plots) [14] was performed using the DRAW-HCA software available online at http://smi.snv.jussieu.fr/ hca/ To get three-dimensional representations of catalytic centres of lysozyme i and compare it with that of lysozymes

c, the primary sequences of Asterias and of Mytilus lysozymes i were submitted to the automated Protein Fold Recognition server 3D-PSSMat http://www.sbg.bio.ic.ac.uk/

3dpssm/ [15,16] and successfully yielded putative three-dimensional structures The figures were drawn usingSWISS

-PDBVIEWER[17]

Results and discussion Determination of the primary structure of the protein The primary structure of the lysozyme from A rubens was determined by amino acid sequence analysis of the intact carboxy-methylated protein and of constituent peptides obtained through digests by trypsin, S aureus V8 protein-ase, carboxypeptidase and cyanogen bromide treatment (see Material and methods) The results are summarized by the sequence shown on Fig 1

cDNA cloning and sequencing cDNA was prepared from soft tissues of a single A rubens specimen As a starting point, we used degenerate primers designed from the N-terminal sequence determined by Jolle`s and Jolle`s [11] (Table 1) The complete cDNA sequence was determined on PCR products after several rounds of 3¢ and 5¢ RACE/PCR (see Material and methods and Table 1) Thus, the cDNA sequence was determined independently

of the biochemically determined protein sequence described

in the above paragraph

The cDNA sequence agreed with the protein sequence without ambiguity (Fig 2) and allowed confirmation of the data from the biochemical analysis in two cases when an overlapping peptide was missing The predicted ORF from the cDNA is slightly longer than the biochemically deter-mined protein sequence Computer analysis (see Material and methods) permitted us to postulate a signal peptide of

16 amino acids and its cleavage site Ten more amino acids are found in the predicted translated protein upstream of the serine that is found to be the N-terminal residue of the extracted protein This could be due to an artefactual cleavage at the fragile S–S peptide bound (Fig 2) during the purification of the protein Alternatively, this could be the physiological form of the protein, taking into account that the bivalve type i lysozymes have approximately the same

Table 1 Primer sequences.

Primer (5¢ fi 3¢)

Corresponding peptide AS1 GGTTGCCTGAGRTGYATHTG a GCLRCIC

AS3 GGGCTATTGGTCAGACGCTACACTC GYWSDATL

AS3R GAGTGTAGCGTCTGACCAATAGCC GYWSDATL

AS4R GATCTGATACGGTCCACACGACAG LSCGPYQI

a

H ¼ A or C or T; R ¼ A or G; Y ¼ C or T.

length at their N-terminal side [3,4,10] The coding sequence

is followed by a 3¢ noncoding tail of 172 nucleotides and is

preceded by a 5¢ noncoding leader of 101 nucleotides

Up to now, complete protein sequences of i-type

lysozymes were only available from protostome species

We aligned the Asterias lysozyme sequence with type i

proteins for which a lysozyme activity has been

demonstra-ted (Fig 3) This alignment supports the homology of the

starfish lysozyme with protostome proteins as proposed in

our previous work [10] Comparison between the lysozyme

of the starfish, a deuterostome species, with the previously

known lysozymes i provides the opportunity to reveal

conserved residues over about 600 million years Of about

120 amino acids, as many as 35 are identical, and 13 are

similar (Fig 3) The starfish lysozyme is less rich in cysteines

than the protostome lysozymes i (10 vs 13) Relative to the

other known i lysozymes, it presents a four-residue insertion (residues 55–58 on Fig 3) Comparison with the second exon of the human lysozyme c that comprises the active site reveals both similarities between the two types of lysozymes and residues specific to the i-type (Fig 3)

ABLASTsearch with the lysozyme sequence of A rubens

in the sequence database of the National Center for Biotechnology Information (NCBI) shows significant sequence similarities with the destabilase of the medicinal leech H medicinalis [7], with the bivalve lysozyme sequences determined in our previous work [10], with the lysozyme of the bivalve Tapes japonica [3], with the so-called chlamysin

of Chlamys islandica [4,5], and also with a hypothetical secreted protein of the nematode Caenorhabditis elegans and with putative gene products retrieved from the genomes

of the fly Drosophila melanogaster and of the mosquito

Fig 1 Chemically determined primary

struc-ture of the A rubens lysozyme Phenylalanine

112 is drawn in low case (f) because it was

ambiguous >, Amino acid determined by

automated Edman degradation; <, amino

acid determined by carboxypeptidase

degradation; +, trypsin cut; -+, trypsin

peptide sequenced by the Edman technique;

¼ ¼ ¼ ¼, S aureus V8 protease peptide,

sequenced by the Edman technique; ––––,

cyanogen bromide (BrCN) peptide, sequenced

by the Edman technique.

Fig 2 cDNA sequence of the A rubens lysozyme Noncoding nucleotides (nt.) are shown in small case letters and the coding sequence is shown in upper case letters Putative polyadenylation signals are boxed

3 The N-terminal amino acid of the mature protein is boxed The predicted signal peptide is in grey.

Anopheles gambiae On the other hand, no significant

similarity was found whenBLASTsearches were performed

on the complete or near-complete genome sequences of

deuterostome species, such as the mamalians Homo sapiens

and Mus musculus, the teleost fishes Takifugu rubripes and

Danio rerioand the urochordate Ciona intestinalis

The presence of type i genes in the three branches of the metazoan tree [18], the protostome Ecdysozoa (including arthropods and nematodes) and Lophotrochozoa (inclu-ding molluscs and annelids) and deuterostomes (starfish) brings evidence that a lysozyme i gene was present in the bilaterian ancestor Given the present genomic data, it must

Fig 3 Alignment of the A rubens lysozyme sequence with other lysozymes The complete mature starfish protein was aligned with all protostome i-type proteins for which a lysozyme activity has been demonstrated Aru, A rubens; Med, Mytilus edulis; Cis, Chlamys islandica; Tja, Tapes japonica; Hme, H medicinalis Numbering is that of the starfish lysozyme For comparison, the second exon of the human lysozyme-c (Has, Homo sapiens) is also aligned Below are noted secondary structure elements: h marks a residue involved in an a-helix, b a residue involved in a beta-turn Residues conserved in all c-type lysozymes [21] are underlined The two active acidic residues of the c-type lysozymes are boxed Conserved residues

in all i-type lysozymes are in grey Conserved cysteines are noted by s above the Asterias sequence.

Fig 4 Hydrophobic cluster analysis The primary sequence is represented on a roll mimicking a-helices The primary sequence is drawn twice A dashed line follows one of these primary sequences Prolines (P) and glycines (G) that break a-helices are represented as w and r, respectively The hydrophilic residues serines (S) and threonines (T) are represented by h Residues that are distant on the primary sequence may appear close to each other on this type of diagram, thus revealing hydrophobic clusters (boxed) (A) HCA plot of the Asterias lysozyme; hydrophobic residues conserved

in all lysozymes i are in grey (B) Second exon of the human lysozyme c Conserved hydrophobic residues between lysozymes i and c are in grey.

have been lost in several deuterostome lineages

Compar-ative genomics is developing rapidly Complete genomes of

a greater panel of species will be soon available This will

allow us to assess whether or not the lysozyme i gene has

been lost from the origin of the whole vertebrate or even the

whole chordate lineages If this is true it this would fully

justify the name given of ‘invertebrate’ lysozyme

Hydrophobic cluster analysis

Primary structure comparison between such distantly related

proteins as i-type and c-type lysozymes provides significant

yet insufficient data on functionally important residues To

understand this issue further, we performed a hydrophobic

cluster analysis [14] This analysis permits one to relate

residues that are not close to each other along the linear

sequence, but may come close under secondary structure,

forming hydrophobic clusters or pouches (Fig 4A) The

N-terminal half of i lysozymes is homologous to the second

exon of vertebrate c-type lysozymes (Fig 3 and [10]) Fig 4B

shows the HCA plot of this part of the human lysozyme A

number of hydrophobic residues overlap between this plot

and the corresponding part of the HCA plot of the Asterias

lysozyme The same overlap is obtained when comparing

the human lysozyme and/or the chicken lysozyme with

the protostome lysozymes i listed in Fig 3 (data not shown)

In the C-terminal half other hydrophobic residues are conserved among the i-type lysozymes (Fig 4A)

The natural substrate of lysozymes is a polymer of N-acetyl-glucosamine and of N-acetyl-muramic acid Up to six sugar rings get into the cleft of the lysozyme c at subsites called A–F The D subsite is the active site where the sugar chain is cleaved In the chicken and human lysozymes c the hydrophobic cluster IYW (IWW in chicken) (Fig 4B) is involved in interactions with sugar rings [19] This hydro-phobic cluster is very well conserved in lysozymes i (Fig 3 and Fig 4A,B) We postulate that this function is conserved

in i-type lysozymes It is likely that the other conserved hydrophobic clusters are involved in similar interactions Three-dimensional modelling

A partial three-dimensional structure of the starfish lyso-zyme i model was successfully generated by the 3D-PSSM

software program (see Material and methods) In this model, some links remain uncertain They correspond to variable parts of the proteins among the various i-type lysozymes They probably represent loosely structured loops between more structured helices and/or sheets Despite these missing parts, this computer-based three-dimensional model is recognized as a lysozyme with a high probability score (PSSME-value: 4.67 e-5)

Fig 5 Putative three-dimensional model of the Asterias lysozyme i These figures were generated with the help of the SWISS - PDBVIEWER software (A)

A part of the putative structure of the Asterias lysozyme, from residues L9 to L50 (according to numbering in Fig 3) The side chains of E16 and S34 that we postulate to be the active enzymatic residues (see text) are shown (B) Homologous part of the human lysozyme from the model deposited in the SwissProt data bank under the accession number 1IY3 (residues W28–K69, according to the sequence of the human lysozyme) The side chains of E35 and D53 that are the known active residues in c-type lysozymes are shown.

part of the three-dimensional structure of the Asterias

lysozyme (Fig 5A) is very similar to the known structure of

the active site of the human c lysozyme (Fig 5B) The

putative structure of the Mytilus lysozyme i is almost

identical (data not shown)

The critical glutamate (E) of lysozyme c active site is

conserved in lysozymes i In contrast, the active aspartate

(D52 according to chicken numbering) is not conserved

(Fig 3) In a previous paper we postulated that its role

could be played by another D residue [10] The present

putative three-dimensional structure does not support this

hypothesis On the other hand, the tertiary structure

supports the homology between the active D of lysozymes

cand a conserved serine (S), as proposed on the basis of

primary structure (Fig 3) We determined the atomic

distances between the oxygen atom of this S and those of

the active E They fall (8.1–8.5 A˚) within the range of the

distances between active atoms in the lysozyme c active site

(5.9–8.2 A˚) We thus propose that the S34 (according to

numbering in Fig 3) is the active residue for sugar chain

cleavage in lysozymes i A similar situation is found in

g-type lysozymes, where E73 is an analogue of the active

glutamate of lysozymes c, but no aspartate analogue is

found [20]

Acknowledgements

We are grateful to Prof A Toulmond for providing us with the

facilities of the Station Biologique de Roscoff and constant support.

S Bachali is recipient of a PhD fellowship of the Tunisian government.

We thank three anonymous referees for their comments that helped

improve the manuscript.

References

1 Jolle`s, J., Fiala-Medioni, A & Jolle`s, P (1996) The ruminant

digestion model using bacteria already employed early in

evolu-tion by symbiotic molluscs J Mol Evol 43, 523–527.

2 Fiala-Medioni, A & Felbeck, H (1990) Autotrophic processes in

invertebrate nutrition: bacterial symbiosis in bivalve molluscs.

Comp Physiol 5, 49–69.

3 Ito, Y., Yoshikawa, A., Hotani, T., Fukuda, S., Sugimura, K &

Imoto, T (1999) Amino acid sequences of lysozymes newly

puri-fied from invertebrates imply wide distribution of a novel class in

the lysozyme family Eur J Biochem 259, 456–461.

4 Nilsen, I.W., Overbo, K., Sandsdalen, E., Sandaker, E., Sletten, K.

& Myrnes, B (1999) Protein purification and gene isolation of

chlamysin, a cold-active lysozyme-like enzyme with antibacterial

activity FEBS Lett 464, 153–158.

5 Nilsen, I.W & Myrnes, B (2001) The gene of chlamysin, a marine

invertebrate-type lysozyme, is organized similar to vertebrate but

different from invertebrate chicken-type lysozyme genes Gene 269,

27–32.

6 Fradkov, A., Berezhnoy, S., Barsova, E., Zavalova, L., Lukyanov,

S., Baskova, I & Sverdlov, E.D (1996) Enzyme from the

medicinal leech (Hirudo medicinalis) that specifically splits endo-epsilon (-gamma-Glu)-Lys isopeptide bonds: cDNA cloning and protein primary structure FEBS Lett 390, 145–148.

7 Zavalova, L., Lukyanov, S., Baskova, I., Snezhkov, E., Akopov, S., Berezhnoy, S., Bogdanova, E., Barsova, E & Sverdlov, E.D (1996) Genes from the medicinal leech (Hirudo medicinalis) coding for unusual enzymes that specifically cleave endo-epsilon (gamma-Glu)-Lys isopeptide bonds and help to dissolve blood clots Mol Gen Genet 253, 20–25.

8 Zavalova, L.L., Baskova, I.P., Lukyanov, S.A., Sass, A.V., Snezhkov, E.V., Akopov, S.B., Artamonova, I.I., Archipova, V.S., Nesmeyanov, V.A., Kozlov, D.G., Benevolensky, S.V., Kiseleva, V.I., Poverenny, A.M & Sverdlov, E.D (2000) Desta-bilase from the medicinal leech is a representative of a novel family

of lysozymes Biochim Biophys Acta 1478, 69–77.

9 Zavalova, L.L., Artamonova, I.I., Berezhnoy, S.N., Tagaev, A.A., Baskova, I.P., Andersen, J., Roepstorff, P & Egorov Ts, A (2003) Multiple forms of medicinal leech destabilase-lysozyme Biochem Biophys Res Commun 306, 318–323.

10 Bachali, S., Jager, M., Hassanin, A., Schoentgen, F., Jolle`s, P., Fiala-Medioni, A & Deutsch, J.S (2002) Phylogenetic analysis of invertebrate lysozymes and the evolution of lysozyme function.

J Mol Evol 54, 652–664.

11 Jolle`s, J & Jolle`s, P (1975) The lysozyme from Asterias rbens Eur J Biochem 54, 19–23.

12 Jolle`s, J., Van Leemputten, E., Mouton, A & Jolle`s, P (1972) Amino acid sequence of guinea-hen egg-white lysozyme Biochim Biophys Acta 257, 497–510.

13 Holton, T.A (1991) A simple and efficient method for direct cloning of PCR products using ddT-tailed vectors Nucleic Acids Res 19, 1156.

14 Callebaut, I., Labesse, G., Durand, P., Poupon, A., Chomilier, J., Henrissat, B & Mornon, J (1997) Deciphering protein sequence information through hydrophobic cluster analysis (HCA): Cur-rent status and perspectives Cell Mol Life Sci 53, 621–645.

15 Kelley, L.A., MacCallum, R.M & Sternberg, M.J (2000) Enhanced genome annotation using structural profiles in the program 3D-PSSM J Mol Biol 299, 499–520.

16 MacCallum, R.M., Kelley, L.A & Sternberg, M.J (2000) SAW-TED: structure assignment with text description – enhanced detection of remote homologues with automated SWISS-PROT annotation comparisons Bioinformatics 16, 125–129.

17 Guex, N & Peitsch, M.C (1997) SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling Electrophoresis 18, 2714–2723.

18 Adoutte, A., Balavoine, G., Lartillot, N & de Rosa, R (1999) Animal evolution The end of the intermediate taxa? Trends Genet.

15, 104–108.

19 Imoto, T (1996) Lysozymes: Model Enzymes in Biochemistry and Biology (Jolle`s, P., ed.), pp 163–181 Birkha¨uer, Basel.

20 Weaver, L.H., Grutter, M.G & Matthews, B.W (1995) The refined structures of goose lysozyme and its complex with a bound trisaccharide show that the ‘goose-type’ lysozymes lack a catalytic aspartate residue J Mol Biol 245, 54–68.

21 Prager, E.M & Jolle`s, P (1996) Lysozymes: Model Enzymes in Biochemistry and Biology (Jolle`s, P., ed.), pp 9–31 Birkha¨user, Basel.