1. Trang chủ
  2. » Luận Văn - Báo Cáo

Tài liệu Báo cáo khoa học: N-terminal extension of the yeast IA3 aspartic proteinase inhibitor relaxes the strict intrinsic selectivity ppt

10 513 0
Tài liệu đã được kiểm tra trùng lặp

Đang tải... (xem toàn văn)

THÔNG TIN TÀI LIỆU

Thông tin cơ bản

Tiêu đề N-terminal extension of the yeast IA3 aspartic proteinase inhibitor relaxes the strict intrinsic selectivity
Tác giả Tim J. Winterburn, Lowri H. Phylip, Daniel Bur, David M. Wyatt, Colin Berry, John Kay
Trường học School of Biosciences, Cardiff University
Chuyên ngành Biochemistry
Thể loại Journal article
Năm xuất bản 2007
Thành phố Cardiff
Định dạng
Số trang 10
Dung lượng 418,13 KB

Các công cụ chuyển đổi và chỉnh sửa cho tài liệu này

Nội dung

Capture of the potentially posi-tively charged aromatic histidine residues of the extension by remote, negatively charged side-chains, which were identified in the Pichia enzyme by modell

Trang 1

inhibitor relaxes the strict intrinsic selectivity

Tim J Winterburn1, Lowri H Phylip1, Daniel Bur2, David M Wyatt1, Colin Berry1and John Kay1

1 School of Biosciences, Cardiff University, UK

2 Actelion Pharmaceuticals Ltd, Allschwil, Switzerland

Gene-encoded inhibitors of aspartic proteinases are

rather rare in nature Thus, there is a need to

under-stand the mechanisms of action of the few that are

known, in order to exploit their therapeutic potential

[1] We have described previously one such inhibitor:

the IA3 protein from Saccharomyces cerevisiae [1–4]

This remarkable polypeptide not only is a highly

potent inhibitor of its target enzyme, saccharopepsin,

but also appears to be completely specific for this sole

target proteinase [1,2] Crystal structures solved for

complexes of IA3 with saccharopepsin revealed an

unprecedented mechanism of action [2,3] IA3 from

S cerevisiaeconsists of 68 residues but all of the inhib-itory activity towards saccharopepsin resides within the N-terminal half or segment of the polypeptide [2,3] The free inhibitor is essentially unstructured [5,6] but, upon contacting its target enzyme, residues 2–32 become ordered and adopt an alpha helical conforma-tion occupying the active site cleft of the proteinase [2,3] This absolute selectivity for saccharopepsin was shown to be conferred by a combination of the K18 and D22 residues in the S cerevisiae IA3 sequence

Keywords

aspartic proteinase inhibition; IA3; inhibitor

engineering; Pichia aspartic proteinase;

specificity relaxation

Correspondence

J Kay, School of Biosciences, Cardiff

University, Museum Avenue, Cardiff CF10

3US, UK

Fax: +44 029 20 87 41 16

Tel: +44 029 20 87 41 24

E-mail: kayj@cardiff.ac.uk

(Received 30 March 2007, revised 23 May

2007, accepted 25 May 2007)

doi:10.1111/j.1742-4658.2007.05901.x

Yeast IA3 aspartic proteinase inhibitor operates through an unprecedented mechanism and exhibits a remarkable specificity for one target enzyme, sac-charopepsin Even aspartic proteinases that are very closely similar to saccharopepsin (e.g the vacuolar enzyme from Pichia pastoris) are not sus-ceptible to significant inhibition The Pichia proteinase was selected as the target for initial attempts to engineer IA3 to re-design the specificity The

IA3polypeptides from Saccharomyces cerevisiae and Saccharomyces castellii differ considerably in sequence Alterations made by deletion or exchange

of the residues in the C-terminal segment of these polypeptides had only minor effects By contrast, extension of each of these wild-type and

chimaer-ic polypeptides at its N-terminus by an MK(H)7MQ sequence generated inhibitors that displayed subnanomolar potency towards the Pichia enzyme This gain-in-function was completely reversed upon removal of the exten-sion sequence by exopeptidase trimming Capture of the potentially posi-tively charged aromatic histidine residues of the extension by remote, negatively charged side-chains, which were identified in the Pichia enzyme

by modelling, may increase the local IA3 concentration and create an anchor that enables the N-terminal segment residues to be harboured in clo-ser proximity to the enzyme active site, thus promoting their interaction In saccharopepsin, some of the counterpart residues are different and, consis-tent with this, the N-terminal extension of each IA3 polypeptide was with-out major effect on the potency of interaction with saccharopepsin In this way, it is possible to convert IA3 polypeptides that display little affinity for the Pichia enzyme into potent inhibitors of this proteinase and thus broaden the target selectivity of this remarkable small protein

Abbreviations

Nph, L -nitrophenylalanine; PpPr, vacuolar aspartic proteinase from Pichia pastoris; Z, L -norleucine.

Trang 2

coupled with the requirement for an alanine residue to

be present at position 213 in saccharopepsin [1]

A wide range of other aspartic proteinases of plant,

parasite, vertebrate and fungal origin has been shown

previously to be resistant to inhibition by IA3 [2]

Included among these enzymes are a number with

sequences that are very closely related to that of

sac-charopepsin (e.g the vacuolar aspartic proteinase from

P pastoris; PpPr) [1] This shares a sequence identity

of 77% with saccharopepsin and essentially all of the

active site residues of saccharopepsin that contact the

helical IA3 inhibitor are identical in PpPr PpPr also

has the crucial Ala residue present at position 213 in

its sequence Despite this close relatedness, the two

enzymes differ drastically in their susceptibility to

inhi-bition by IA3 Accordingly, it was of considerable

interest to examine whether IA3 could be adapted to

loosen its stringent specificity and, in this way, begin

the process of engineering it to target aspartic

protein-ase(s) other than saccharopepsin Since PpPr is not

inhibited effectively by IA3 yet is so closely related to

saccharopepsin, it was an obvious choice as the initial

new target enzyme In the present study, we show that,

inter alia, inhibitors with subnanomolar potency

against PpPr, can be generated by simply attaching a histidine-rich extension at the N-terminus of the IA3 polypeptide This dramatic alteration in behaviour may be explained by the positively ionisable histidine residues initiating additional contacts outside the active site that promote occupation of the active site of the target proteinase by the inhibitory segment

For ease of interpretation, residues in the inhibitors are denoted by single letter abbreviations while those from the proteinase are indicated in the three-letter code

Results and Discussion

Wild-type IA3and PpPr

We have reported previously that, at the standard pH

of 4.7 that we have justified and used consistently in all of our earlier studies [1–4], wild-type IA3 from

S cerevisiae has an inhibitory potency against saccha-ropepsin that is so tight that the Ki value lies at or beyond the limits of accurate determination using the assay methodology available It has thus been esti-mated as < 0.1 nm [1–4] and, in comparative terms,

S cerevisiae IA3 is ineffective against PpPr (1; Fig 1)

1

2

3

4

5

6

7

8

9

10

M

M

M

M

(H) ZQ

(H) ZQ

N K D E

34 24 22

K (n M )

55 ± 11

15 ± 3

100 ± 20 NI

3 ± 0.5

4 ± 0.5

15 ± 5

280 ± 30

2 ± 0.2

10 ± 1

E

N K D H

N K D

S

2

Fig 1 Inhibition at pH 4.7 of PpPr by wild-type and chimaeric forms of IA 3 from S cerevisiae and S castellii Sequences of IA 3 from S cere-visiae and S castellii (detailed in Fig 2) are depicted schematically by dark-shaded and open boxes respectively, with residues at positions

1, 2, 18, 22 and 68/81 identified individually Inhibitors 1-3 and 5 were recombinant proteins containing an additional LE(H)6 sequence attached to the C-terminal residue (E68 for 1 & 5; H81 for 2 & 3) Inhibitors 4 and 6-10 were synthetic peptides of the indicated length In these forms of IA3, L -norleucine (Z) was substituted for methionine NI = no inhibition at 2 l M

Trang 3

We have also reported previously that our constant

searching of the sequence databases for orthologues of

S cerevisiae IA3 enabled us to identify the

counter-part polypeptide from Saccharomyces castellii [1] To

determine whether the S castellii polypeptide might

be a more effective inhibitor of PpPr upon which

to base initial protein engineering studies, it was

produced in recombinant form in Escherichia coli

and purified to homogeneity as described in the

Experimental procedures The S castellii IA3 was,

however, only marginally more effective as an inhibitor

of PpPr than its S cerevisiae counterpart (cf 2 and 1;

Fig 1)

The effect of C-terminal segment residues on the

inhibitory activity of the N-terminal segment

The sequences of IA3 from S castellii and S cerevisiae

are aligned in Fig 2 These show only 45% identity in

the N-terminal ‘segment’ (residues 2–32) that has been

demonstrated previously to contain the inhibitory

activity towards saccharopepsin [1–4] Residues 33–35

are identical in both sequences and form a link

between the inhibitory N-terminal ‘segment’ and

resi-dues of the C-terminal ‘segment’ The C-terminal

seg-ment (residues 36–81; Fig 2) from S castellii IA3 is

considerably longer than its counterpart (residues

36–68) in the S cerevisiae polypeptide and differs

sub-stantially in sequence (Fig 2) To establish whether the

respective C-terminal segments might have an influence

(beneficial or detrimental) on any inhibitory activity

that might be intrinsic to the N-terminal segments,

chimaeric proteins were engineered in which residues

35–81 and 35–68 in the respective polypeptides were

replaced by their counterparts from the other

sequence The chimaera that consisted of residues 1–34

from S cerevisiae IA3fused to residues 35–81 from the

S castellii sequence remained as poor an inhibitor of

PpPr as the wild-type S cerevisiae IA3 (cf 3 and 1;

Fig 1) A shorter variant of the S cerevisiae

poly-peptide which terminated at residue 34 and so was

completely devoid of any residues whatsoever to

correspond to positions 35–68⁄ 81, did not inhibit PpPr

either (4; Fig 1) Thus, the N-terminal segment of

S cerevisiae IA3 does not have any significant effect

on PpPr, irrespective of the absence, presence or

nature of the residues contributing the C-terminal segment

Against saccharopepsin, S cerevisiae-based inhibi-tors 3 and 4 both had Ki values of < 0.1 nm at

pH 4.7, just as reported previously for the full-length, wild-type S cerevisiae polypeptide (inhibitor 1) [2–4] Entirely in keeping with these earlier findings, the nat-ure and indeed presence or absence of residues beyond position 34 in this sequence would appear to have no influence on inhibition of saccharopepsin

The reciprocal chimaera, which consisted of residues 1–34 from S castellii IA3 fused to residues 35–68 from the S cerevisiae polypeptide, was slightly more effect-ive as an inhibitor of PpPr than the wild-type

S castellii IA3 (cf 5 and 2; Fig 1), with the measured

Kifalling into the single digit nanomolar range Since these two polypeptides differ only in the nature of their C-terminal segments, it would appear that the C-terminal segment (residues 35–81) from S castellii

IA3 has a slight detrimental effect on the inhibitory activity against PpPr that is intrinsic to its own N-ter-minal segment This interpretation was examined by producing a shorter variant of the S castellii sequence that lacked any C-terminal segment and so consisted only of residues 2–34 This had a comparable inhibi-tory potency to that of the chimaera (cf 6 and 5; Fig 1) The detrimental effect of S castellii residues 35–81 may result from adverse interaction(s) occurring either within the full-length S castellii polypeptide (residues 1–81) itself or between the C-terminal seg-ment of the polypeptide and PpPr at a remote site far removed from the active site cleft where the N-terminal segment might be expected to bind Furthermore, because the chimaeric inhibitor 5 had a comparable potency to that of inhibitor 6 which was devoid of any C-terminal segment, the C-terminal segment (residues 35–68) from S cerevisiae IA3 would appear, once again, to be inert, this time being without influence on the inhibitory activity against PpPr that is intrinsic to the N-terminal segment of the S castellii polypeptide Against saccharopepsin, the S castellii N-terminal segment (inhibitor 6) is a potent inhibitor (Ki¼ 0.4 ± 0.1 nm at pH 4.7) and the interactions of this type of inhibitor variant within the active site cleft of the enzyme have been documented previously [4] The counterpart N-terminal segment (residues 2–34) from

Species Sequence

S cerevisiae

S castellii

Fig 2 Alignment of the sequences of IA3from S cerevisiae and S castellii Identical residues are boxed in black.

Trang 4

S cerevisiae IA3 (inhibitor 4) is even more effective

than inhibitor 6 against saccharopepsin (Ki< 0.1 nm)

[1–4] This behaviour stands in stark contrast to that

observed against PpPr where inhibitor 6 was >

500-fold more effective than inhibitor 4 (Fig 1)

Conse-quently, the effect of exchanging residues within the

inhibitory sequence of 6 was examined Replacement

of the S castellii residues 24–34 by the corresponding

residues from S cerevisiae IA3had only a small

(three-to four-fold) adverse effect on inhibi(three-tory potency

against PpPr (cf 7 and 6; Fig 1) However, when the

key residues K18 and D22 that have been shown to be

so important in restricting the activity of S cerevisiae

IA3to saccharopepsin as its sole target proteinase were

introduced into the S castellii sequence in place of the

intrinsic M18⁄ K22 pair, the inhibitory activity against

PpPr was essentially destroyed (cf 8 and 6; Fig 1)

Thus, it would appear that the residues at positions 18

and 22 again play a decisive role, allowing effective

inhibition of PpPr by the S castellii polypeptide

Changes in other locations, including the ‘remote’

attachment of residues 35–81 from its own C-terminal

segment, cause only minor perturbation of the

inhibi-tory potency intrinsic to the N-terminal segment

The effect of extending the N-terminal segment

Since the above-described adaptations in the

C-ter-minal segment were without major influence, the

effect of extending the inhibitory segment (residues

2–34) at its N-terminal end was investigated next

Careful consideration was given to the design of the

N-terminal extension sequence that was to be

intro-duced Insufficient amounts of PpPr were produced

for crystallization attempts to be a realistic possibility;

thus, the design process was informed by a 3D model

for PpPr that was generated based on the crystal

structures that have been reported previously for

saccharopepsin complexed with different variants of

S cerevisiae IA3 [2,3] The two proteinases share 77%

sequence identity, and they are likely to have closely

similar 3D structures Inspection of the PpPr model

identified a patch of negatively ionisable amino acids

on the surface of the enzyme, adjacent to the end of

the active site cleft where the N-terminal residues of

an inhibitory IA3 helix would be expected to bind

(Fig 3A) Extension of the inhibitory sequence of IA3

at its N-terminus by four amino acids (residues X8–

X11, Fig 3B) was estimated to generate a polypeptide

that would make few beneficial contacts, whereas a

seven amino acid extension (consisting of residues

X5–X11, Fig 3B) would be long enough to make

some of the predicted contacts with the side-chains of

residues such as Asp161, Asp164 and Glu17 on the surface of PpPr; and an extension of nine amino acids (residues X3–X11) would exploit the potential binding site offered by this patch to the full (Fig 3B) Consequently, IA3 variants with four (HHZQ) and seven (HHHHHZQ) residue extension sequences, respectively, were designed initially to introduce the appropriate number of potentially positively charged (at the experimental pH of 4.7) histidine residues (at positions X8–X9 or positions X5–X9, respectively) followed by a norleucine residue (indicated by Z, at position X10) and a glutamine (residue X11) in place

of the naturally occurring N-terminal (methionine)

A

B

Fig 3 Representation of PpPr and the extension residues of IA3 (A) Negatively ionisable surface residues (red) adjacent to the edge

of the active site of PpPr; the active site is occupied by a putative helical IA3inhibitor with the residue at its N-terminus serving as a potential attachment point for an extension; (B) potential interac-tions of the indicated negatively ionisable surface residues (red)

of PpPr with several positively ionisable amino acids of the MK(H) 7 MQ extension sequence (residues X1–X11, respectively) The C-alpha representation of the helical inhibitory segment occu-pying the active site of the proteinase is depicted in yellow.

Trang 5

residue of IA3 which has been shown previously to

be unimportant for inhibitory activity [1,2] The logic

for introduction of the Q residue is explained below;

inspection of the PpPr model revealed an additional

pocket that might accommodate the side-chain of

straight-chained residues such as norleucine (in

syn-thetic peptides) or methionine (in recombinant

pro-teins) at position X10 (Fig 3B)

These two extension sequences were introduced at

the N-terminus of inhibitor 7 This inhibitor was

selec-ted initially because it consists only of residues 2–34

and was thus free of any potential ‘complications’ that

might have been contributed to binding by the

pres-ence of residues 35–68⁄ 81 Since it was also only a

weak inhibitor of PpPr, any improvement in inhibitory

potency should be readily quantifiable The

polypep-tide containing the short, four-residue (HHZQ)

exten-sion had a comparable potency to that of its parent

(i.e non-extended inhibitor 7) (cf 9 and 7; Fig 1)

However, the longer (H)5ZQ-extended variant showed

a seven-fold improvement in potency against PpPr

(cf 10 and 7; Fig 1)

Since this seven-residue extension was already

suffi-cient to engender an improvement of inhibitory

potency against PpPr, the extension sequence was

lengthened further to include all seven histidine

resi-dues indicated by the model The additional two

histi-dine residues (at positions X3 and X4; Fig 3B) were

introduced downstream from a methionine and a

lysine residue (at positions X1 and X2, respectively),

the logic for which will be substantiated below These

four MKHH residues were thus introduced upstream

from the (H)5-containing extension described above to

generate the sequence MK(H)7MQ (Fig 3B)

Coinci-dentally, this extension contains sufficient histidine

res-idues to enable it to be used as an affinity tag for

purification purposes In all of our previous studies

with IA3 [1–4], recombinant protein versions such as

inhibitors 1–3 and 5 (Fig 1) were purified to

homogen-eity from E coli lysates by nickel-chelate

chromatogra-phy, facilitated by a LE(H)6 tag that was positioned

at the C-terminus of each polypeptide This tag was

shown to have no effect on the potency of inhibition

of saccharopepsin [2,3] This C-terminal His-tag could

thus be deleted and introduced instead within the

extension sequence at the N-terminus of each desired

polypeptide

The 11 amino acid-containing sequence MK(H)7MQ

was thus introduced as the N-terminal extension

attached to residue 2 of S castellii IA3, as described in

the Methods section The resultant, recombinant

pro-tein (and the others to be described) were purified

from E coli cell lysates just as readily as their

C-ter-minally tagged predecessors using exactly the protocol described previously for the latter [1–4] The N-termin-ally extended S castellii protein showed a potency against PpPr that was improved by 150-fold compared

to its counterpart with the tag at the C-terminus of the polypeptide (cf 11; Fig 4; 2, Fig 1) With such a dra-matic benefit from extension of the inhibitory segment

at its N-terminus, it was clearly of importance to establish whether this enhanced potency was influenced

to any extent by the presence⁄ absence and nature of the amino acid residues contributing the C-terminal segment to this polypeptide Consequently, the residues (35–81; Fig 2) comprising the C-terminal segment were systematically deleted, in blocks of 12⁄ 13 residues

at a time Truncation of the N-terminally tagged

S castellii polypeptide (inhibitor 11) at residue Q68 generated inhibitor 12 which corresponded in overall length to S cerevisiae IA3 Although this resulted in a seven-fold weakening in potency against PpPr (cf 12 with 11; Fig 4), a subnanomolar Ki value was still recorded for inhibitor 12 Further truncation at resi-dues Y57 and K45, respectively (inhibitors 13 and 14; Fig 4) did not cause any further significant loss of inhibitory potency against PpPr Thus, in contrast to the detrimental effect that was described above when residues 35–81 were attached in the full-length, C-terminally tagged inhibitor 2, the presence of residues 69–81 at the C-terminus of the N-terminally tagged S castellii polypeptide appears to confer a benefit to the inhibition of PpPr (cf inhibitors 11 and 12; Fig 4) This was substantiated by the data obtained for the chimaeric inhibitor 15 (Fig 4) which was identical in length to inhibitor 12 but contained residues 35–68 from S cerevisiae IA3as the C-terminal segment in place of the counterpart S castellii residues

of inhibitor 12 Both inhibitors had comparable Ki values against PpPr (15 and 12; Fig 4) Consequently, the nature of residues 35–68 at the C-terminus of these N-terminally tagged polypeptides would appear to be unimportant for inhibition Quantitatively, the magni-tude of the beneficial effect conferred by residues 69–81 from the S castellii sequence is small compared

to that achieved by location of the full-length extension

at the N-terminal end of the polypeptide The benefit of these alterations at each extremity of the polypeptide chain, must of necessity arise from contacts that are made outwith the active site of the enzyme

The effect of removal of the N-terminal extension The full N-terminal extension sequence, MK(H)7MQ, was designed to consist of an even number of residues upstream from the Q residue This enables their

Trang 6

removal by the action of a diamino exopeptidase,

cath-epsin C, which cleaves off dipeptides sequentially from

the N-terminus of a polypeptide [7] The first

methion-ine (X1) in the extension sequence is necessary for

translation initiation and the lysine is located at

position X2 so that in the event of removal of the

N-terminal methionine residue by an E coli

amino-peptidase, the new N-terminal lysine residue would

prevent any digestion by cathepsin C [7]; such a

desM(X1)-extended IA3 would still contain its His-tag

and so could be removed by nickel-chelate

chromato-graphy Unlike an N-terminal lysine residue, glutamine

(at position X11; Fig 3) does not in itself constitute a

stop point for cleavage by cathepsin C However, if

dipeptide removal by cathepsin C is performed in the

presence of an excess of glutamine cyclotransferase,

once an N-terminal glutamine residue is newly exposed,

it is rapidly converted into pyroglutamic acid Further

digestion by cathepsin C is thus prevented, leaving the

cyclised Q as the N-terminal residue (replacing the

nat-urally occurring Met1) of each IA3 polypeptide

Appli-cation of this trimming treatment to the longest and

shortest variants with the wild-type S castellii sequence

(inhibitors 11 and 14) and to the chimaeric

inhib-itor 15, generated polypeptides 11T, 14T and 15T,

respectively, each with a pyrrolidone carboxylic acid

residue (cyclised Q) at its N-terminal end (Fig 4) Each trimmed polypeptide was purified as described in the Experimental Procedures section by passage through a nickel-chelate column to remove any residual parent

IA3 with its intact histidine tag together with the two enzymes used in the trimming procedure which are also both C-terminally His-tagged The purity, identity and concentration of each trimmed polypeptide was deter-mined by MALDI-TOF mass spectrometry and amino acid analysis As a representative example, the spectra for one of these inhibitor pairs (14⁄ 14T) are depicted in Fig 5 The mass peak observed in the spectrum for the parent inhibitor 14 (Fig 5A) corresponds to the theor-etical value for the N-terminally extended S castellii

IA3variant terminating at K45 as its C-terminus After treatment with the cathepsin C⁄ glutamine cyclotrans-ferase enzyme combination, this peak was completely absent in the 14T sample Instead, a peak with a smal-ler mass (4983 Da; Fig 5B) was observed which corres-ponds to that expected (4983 Da) for the trimmed IA3 polypeptide devoid of the histidine-rich extension but with an N-terminal pyroglutamate residue The compo-sition of 14T determined by amino acid analysis was (residues⁄ mol) Asp 4.9 (5); Thr 1.0 (1); Ser 4.7 (5); Glu 6.7 (8); Gly 1.8 (2); Ala 5.6 (6); Val 1.3 (1); Met 2.3 (5); Leu 1.0 (1); Phe 1.2 (1); Lys 8.5 (8), with the theoretical

11

11T

12

13

14

14T

15

15T

16

16T

*Q

MK(H) MQ

0.1 ± 0.1

30 ± 4

0.7 ± 0.1

K

Saccharopepsin PpPr

MK(H) MQ

MK(H) MQ

0.3 ± 0.2

4 ± 0.3

S

Y MK(H) MQ

MK(H) MQ

MK(H) MQ

S

*Q S

1.1 ± 0.1 2 ± 0.3

0.9 ± 0.1 0.9 ± 0.4

30 ± 10 10 ± 2

0.4 ± 0.1 0.7 ± 0.2

15 ± 1 1.5 ± 0.2 0.6 ± 0.2 <0.1

100 ± 10 <0.1

E S

E S

E N

2

*Q

*Q

Fig 4 Inhibition at pH 4.7 of PpPr and S cerevisiae (saccharopepsin) by variant forms of IA 3 from S castellii and S cerevisiae Sequences

of IA3from S castellii and S cerevisiae are depicted by open and dark-shaded boxes respectively, with residue 2 and the C-terminal residue

of each length variant identified individually The MK(H) 7 MQ extension was positioned upstream from residue 2 at the N-terminus of inhibi-tors 11-16 Inhibiinhibi-tors 11T, 14T, 15T & 16T were generated by removal of this extension by cathepsin C trimming to leave a cyclised Q resi-due (= *Q) at the N-terminus of each polypeptide.

Trang 7

values given in parentheses Histidine was absent,

indi-cating the purity of the trimmed polypeptide that

resulted from the chromatographic procedures (see

Experimental procedures) and substantiating the

complete absence of His-tagged parent polypeptide or

any partially-processed intermediate Directly

compar-able results were obtained for all of the other inhibitor

pairs described in Fig 4 (data not shown for brevity)

For the chimaeric 15⁄ 15T pair and the shortest

14⁄ 14T pair, removal of the N-terminal extension in

this way resulted in an approximately 35-fold loss in

potency against PpPr (Fig 4) In the case of the

full-length S castellii protein, however, an even larger loss

in potency (approximately 300-fold) against PpPr resulted from trimming off the N-terminal extension (cf 11T and 11; Fig 4) Indeed, the trimmed polypep-tide showed a potency against PpPr that was compar-able to that measured for the original S castellii protein tagged at its C-terminus (cf 11T; Fig 4; 2, Fig 1) Inhibitors 11T and 2 differ only in having (1)

a cyclised Q in place of the Met1 residue at the N-ter-minus and (2) the C-terminal LE(H)6 tag It would thus appear that appending the His-tag at the C-termi-nus of the authentic S castellii polypeptide is without significant effect By contrast, introduction of the histi-dine-rich extension at the N-terminal end of the

S castellii polypeptide transforms it into an inhibitor with subnanomolar potency against PpPr

Since IA3from S cerevisiae had been shown above to

be an even poorer inhibitor of PpPr, the effect of extend-ing this polypeptide at its N-terminus was also exam-ined Introduction of the MK(H)7MQ extension at the N-terminal end of wild-type S cerevisiae IA3resulted in

an improvement of approximately 100-fold in inhibitory potency against PpPr relative to the C-terminally tagged polypeptide (cf 16; Fig 4; 1, Fig 1) This modification thus transformed the ineffective polypeptide 1 into a highly potent inhibitor with a subnanomolar Ki value against PpPr (16; Fig 4) Once again, however, this gain

in potency was completely lost upon removal of the N-terminal extension by treatment with cathepsin C The resultant, trimmed S cerevisiae IA3 reverted to being as mediocre an inhibitor of PpPr as the original construct with its C-terminal tag (cf 16T; Fig 4; 1, Fig 1)

Binding effects

An explanation for these effects may be advanced based on remote interactions that occur outwith the active site cleft of the target proteinase Free IA3 is predominantly unstructured [5,6] Neither S cerevisiae nor S castellii IA3 show any significant intrinsic affin-ity for PpPr (inhibitors 1 and 16T and 2 and 11T) and

so the E + I« EI equilibrium lies well to the left When the extension with its multiple, positively ionisa-ble histidine residues (at pH 4.7) is attached at the N-terminus of these polypeptides, the potential capture

by the residues of the largely negatively charged surface adjacent to the edge of the active site cleft (Fig 3A) may increase the local inhibitor concentra-tion and help to locate the residues of each N-terminal

IA3segment in closer juxtaposition to the active site of the enzyme This anchoring function of the extension residues may allow inhibitory sequences, which, by

A

B

Fig 5 MALDI-TOF mass spectrometry analysis of S castellii IA3

terminating at K45 before (A) and after (B) removal of the

N-ter-minal extension by cathepsin C ⁄ glutamine cyclotransferase (A) The

peak at 6327 Da corresponds to that expected theoretically

(6334 Da); the 3168 Da peak is most likely the doubly charged ion.

(B) The observed mass peak coincides with that predicted

(4983 Da) for the trimmed polypeptide The 2496 Da peak is

prob-ably the doubly charged ion and no peak is present at 6327 Da

cor-responding to the parent, untrimmed peptide.

Trang 8

themselves are suboptimal, to reside long enough in

the vicinity of the enzyme matrix to consolidate the

helical arrangement that ensures a successful, tight

interaction with the enzyme Whereas two histidine

residues (X8 and X9; Fig 3B) were insufficient for this

purpose, five residues (X5–X9) resulted in an increase

in potency of almost an order of magnitude against

PpPr, with the X5 and X6 histidine residues potentially

establishing contacts with Asp164 and Glu17,

respect-ively, of the enzyme (Fig 3B) Addition of a further

two histidine residues (X3 and X4) and a lysine at X2

consolidated this effect even more, resulting in a

further, more substantial gain in potency

Since neither Glu17 nor Asp164 is conserved in the

sequence of saccharopepsin, the validity of this

inter-pretation was examined by determination of inhibition

constants for the interaction of the N-terminally

exten-ded inhibitors with saccharopepsin The potencies of

inhibitors 9 (containing two histidines) and 10 (five

his-tidines) against this enzyme were closely similar and

comparable to that of the parent inhibitor 7 (Ki¼

0.4 ± 0.1, 0.3 ± 0.1 and 0.8 ± 0.1 nm, respectively)

Further lengthening to include all seven histidine

resi-dues of the MK(H)7MQ sequence resulted in extended

inhibitors that were only two- to ten-fold more potent

against saccharopepsin than their respective, trimmed

counterparts (cf 15T and 15, 14T and 14 and 11T and

11; Fig 4) Indeed, the trimmed S castellii polypeptide

(inhibitor 11T; Fig 4) had a potency against

saccharo-pepsin that was identical to that reported previously

[1] for the C-terminally histidine-tagged counterpart

(inhibitor 2) of this sequence (Ki¼ 4 ± 0.1 nm)

Saccharomyces castellii IA3 is thus a weaker inhibitor

of saccharopepsin than S cerevisiae IA3 (K < 0.1 nm)

[1–4] From this evidence, it would appear that Glu17

and Asp164 may be responsible, at least in part, for

facilitating the substantially increased binding of

N-ter-minally extended inhibitors to PpPr because these two

are among the few amino acids in this region with a

number of negative-ionisable residues, that are not

conserved in saccharopepsin Site-directed mutagenesis

to introduce each of these residues, separately and

together, in place of their wild-type counterparts in

saccharopepsin would enable further substantiation of

this interpretation Consistent with this conclusion,

however, the N-terminally extended and trimmed

vari-ants of S cerevisiae IA3 were both potent inhibitors of

saccharopepsin, to the extent that each Ki value was

too tight for accurate quantitation (inhibitors 16⁄ 16T;

Fig 4) For this pair of proteins, the interactions made

by residues 2–34 of S cerevisiae IA3 upon

encounter-ing the active site of saccharopepsin, are already

opti-mized and so are sufficient by themselves to facilitate

tight, specific binding of this helical N-terminal seg-ment of IA3 The E + I« EI balance thus lies far to the right and the addition of further residues at the N-terminus or beyond residue 34 of the inhibitory segment is superfluous However, in the case of PpPr, the serendipitous positioning of negatively ionisable residues in a patch adjacent to but remote from the active site provides a capture site for positively ionisa-ble residues in the N-terminal extension By this device, it is thus possible to transform IA3 polypep-tides with little intrinsic affinity for PpPr into inhibi-tors with subnanomolar potency against this enzyme

as a target proteinase For aspartic proteinases that do not possess this fortuitous surface feature and which are more distantly-related to saccharopepsin, including those of clinical⁄ agricultural relevance, it would appear likely that changes will need to be made within the inhibitory sequence of the N-terminal segment itself in order to re-target the inhibitory activity of IA3

Experimental procedures

Saccharopepsin and the vacuolar aspartic proteinase from

P pastoris (PpPr) were produced in recombinant form and purified from each culture medium, as described previously [1] The N-terminal sequence determined for the purified PpPr was Ala-Ser-His-Asp-Ala-Pro-Leu-Thr-Asn-Tyr-Leu-Asn, which corresponds to that of the mature form of the proteinase predicted by the DNA sequence

Wild-type IA3polypeptides from S cerevisiae and S cas-tellii were produced in E coli with an additional LE(H)6 sequence attached at the C-terminus and purified to homo-geneity by nickel-chelate chromatography, as described pre-viously [1–4] Chimaeric and N-terminally extended IA3 variants were produced by engineering cassette versions of the DNA encoding S cerevisiae IA3in the pET-22b expres-sion plasmid (Novagen, Milton Keynes, UK) An unwanted SacI site near the 3¢-end of the IA3 coding sequence was removed and an NheI site was introduced as a silent muta-tion in the codons for Ala34–Ser35 (GCT AGTfi GCT AGC) by separate site-directed mutageneses using the Quikchange Kit (Stratagene, Amsterdam, the Netherlands),

as described previously [1] Digestion of the resultant plas-mid (J35-pET22b) with NdeI–NheI enabled removal of the bases encoding S cerevisiae residues 1–34 whereas digestion with NheI–XhoI permitted excision of the nucleotides enco-ding residues 35–68 The respective excised fragments were replaced with DNA encoding the corresponding residues 1–34 (inhibitor 5) or 35–81 (inhibitor 3) from S castellii

IA3 Each relevant segment was amplified by PCR using

S castellii IA3 DNA as template and oligonucleotide pairs containing the appropriate restriction enzyme sequence (Table 1) The authenticity of each construct was confirmed

by sequencing In this way, pET22b plasmids were

Trang 9

gener-ated encoding chimaeric polypeptides which consisted,

respectively, of residues 1–34 from S castellii followed by

residues 35–68 from S cerevisiae IA3 (inhibitor 5, Fig 1)

or residues 1–34 from S cerevisiae followed by residues

35–81 from S castellii (inhibitor 3, Fig 1)

To generate IA3polypeptides each extended at its

N-ter-minus and devoid of the LE(H)6 tag at the C-terminus, a

further cassette vector was engineered by making use of the

XbaI site that is located in the cloning region of pET-22b

upstream from both the NdeI and ribosome binding sites

pET-22b carrying S cerevisiae IA3 DNA as the insert was

digested with XbaI–NdeI and gel purified to remove the

excised 43 bp fragment It was replaced by a pair of

syn-thetic oligonucleotides (newpet TOP⁄ BOT; Table 1) which

reconstituted the sequence between the XbaI and NdeI sites

and introduced the additional bases required to encode

most [MK(H)6HM] of the desired N terminal extension in

the correct frame, restoring the NdeI site (CAT ATG)

which coincidentally encodes the HM residues (at positions

X9–X10) of the extension sequence Clone screening was

faci-litated by the introduction of a new HindIII site (AAG

CTT) between the ribosome-binding and NdeI sites and the

new expression vector engineered in this way was called

newpet-22b To introduce the final Q residue (at position

X11) of the desired extension and to remove the C-terminal

LE(H)6 tag from the required constructs, oligonucleotide

primers were designed to anneal to the 5¢- and 3¢-ends of

the target DNA encoding S cerevisiae, S castellii or

chimaeric IA3of each desired length Each forward primer

consisted of an NdeI consensus sequence followed by a Gln

codon before continuing inframe at the codon for residue 2

of the relevant IA3sequence Each reverse primer encoded

stop codons in all three frames after the final desired IA3

codon to ensure the appropriate target polypeptide length PCRs were performed with the high-fidelity PfuUltraTM polymerase (Stratagene) Following gel purification, each amplicon was treated with NdeI and XhoI, prior to ligation into the newpet-22b vector that had been similarly digested Sequencing confirmed the authenticity of each construct In this way, pET-22b plasmids encoding inhibitors 11–16, each with an N-terminal MK(H)6HMQ extension (Fig 4) were generated The oligonucleotides used for each PCR employed in this series are listed in Table 1

Treatment to remove the N-terminal extension from each extended IA3 polypeptide was carried out using the TAG-ZymeTMsystem, first described by Pedersen et al [7], accord-ing to the manufacturer’s instructions (Qiagen, Crawley, UK) Briefly, this involved pretreatment of the DAPaseTM (cathepsin C; 100 mU) with an equal volume of 20 mm cyste-amine-HCl for 5 min at room temperature, prior to mixing with 6 U (120 lL) of Q cyclaseTMand samples of 1–1.5 mg

of each purified, N-terminally tagged recombinant IA3 This mixture was incubated at pH 7.0 in the presence of 5 mm EDTA to chelate any free Ni2+ ions After 2 h at 37C, DAPaseTM and Q cyclaseTM, which are both C-terminally His-tagged, were removed, together with any residual IA3 protein with intact tag by absorption onto a nickel-nitrilotri-acaetic acid agarose column, equilibrated in 20 mm sodium phosphate buffer, pH 7.0⁄ 150 mm NaCl Flow through fractions (usually 8· 0.9 mL) were pooled, concentrated by centrifugation in a Vivaspin-2 spin concentrator fitted with

a 3000 Da molecular mass cut-off membrane (Vivascience, Sartorius, Epsom, UK) and the released dipeptide fragments were removed by gel filtration on a Sephadex G-25 column, equilibrated in 25 mm sodium phosphate buffer, pH 6.5 containing 50 mm NaCl Fractions containing trimmed IA3

Table 1 Construction of mutant forms of IA 3 from S cerevisiae and S castellii The indicated pairs of forward (F) and reverse (R) oligonucle-otide primers were used to introduce the desired changes in S castellii or S cerevisiae IA 3 , thus generating each of the identified variants.

(R) CCGCTCGAGATGATCCATCAATTCATCTTTATCTTG

(R) CTAGCTAGCCATGTTTTTCATTCCTTCACTAGC

(R) CCGCTCGAGCGGCTATCTATCTAATGATCCATCAATTCATCTTTATC

(R) CCGCTCGAGCGGCTATCTATCTATTGTTCTTGCTTCCCAGCACC

(R) CCGCTCGAGCGGCTATCTATCTAATACGAATCTTGAGCTTTCTTTTC

(R) CCGCTCGAGCGGCTATCTATCTATTTTGTCTTCATTTTTTCCTTACTTTC

(R) CCGCTCGAGCGGCTATCTATCTACTCCTTCTTATGCCCCGCC

(R) CCGCTCGAGCGGCTATCTATCTACTCCTTCTTATGCCCCGCC

Trang 10

were identified by SDS⁄ PAGE, pooled and concentrated, if

necessary, in a Vivaspin concentrator as above In this way,

inhibitors 11T, 14T, 15T and 16T were generated from their

respective parents 11, 14, 15 and 16

Synthetic peptide forms of IA3 (inhibitors 4, 6–10) were

obtained from Alta Biosciences (Birmingham, UK) and

contained l-norleucine residues in place of methionine,

where appropriate, as described previously [1–4] Inhibition

assays were performed at pH 4.7 as described previously

[1–3] The chromogenic peptide substrate used was

Lys-Pro-Ile-Glu-Phe*Nph-Arg-Leu (where the scissile peptide

bond is indicated by the asterisk and Nph represents

l-nitrophenylalanine) and was purchased from Alta

Bio-sciences N-terminal sequencing was performed by

automa-ted Edman degradation (Alta Biosciences) Samples for

amino acid analysis were hydrolysed in vacuo for 24 h at

110C in 6 m HCl No attempt was made to correct the

values obtained for methionine to include the products of

oxidation, methionine sulfoxide and methionine sulfone

MALDI-TOF mass spectrometry was performed at the

University of Dundee ‘Fingerprints’ Proteomics Facility,

UK MALDI mass spectra were generated using a Voyager

DE-STR MALDI-TOF MS system (Applied Biosystems,

Foster City, CA, USA) with delayed extraction in positive

ion reflectron mode Samples (diluted to a final

concentra-tion of 2 pmolÆlL)1) were applied to a MALDI sample

plate and supplemented with 1.0 lL of a 5 mgÆmL)1

solu-tion of a-cyano-4-hydroxy-trans-cinnamic acid matrix

(Sig-ma, Poole, UK) plus 10 mm ammonium di-hydrogen

phosphate in 50% (v⁄ v) acetonitrile in 0.1% (v ⁄ v)

trifluoro-acetic acid, mixed and allowed to air dry prior to analysis

The mass spectrometer was internally calibrated using a

matrix ion at 568.13 Da and mass measurement accuracy

was typically ± 0.01% The resultant data were analysed

using the massXpert computer program [8] Modelling

calculations were carried out on an SGI Octane

work-station (Silicon Graphics, Geneva, Switzerland) with

dual R12000 processors, using the moloc program (Gerber

Molecular Design, Amden, Switzerland), as reported

pre-viously [1,4]

Acknowledgements

Supported by awards (to J.K.) from the UK

Biotech-nology and Biological Sciences Research Council

(grant numbers 72⁄ C13544 and 72 ⁄ 0014846) We are

very grateful to our colleagues Jakob Winther and

Anette Bruun (formerly of the Carlsberg Laboratory,

Copenhagen, Denmark) for help with production of recombinant PpPr; to John Fox, Alta Biosciences, Bir-mingham, for provision and analysis of synthetic pep-tide variants of IA3; and to Doug Lamont and Kenny Beattie, University of Dundee, for carrying out mul-tiple mass spectrometry analyses of the IA3 variants The endless patience, tolerance and skill of Marian Williams in the production and revision of the manu-script is hugely appreciated

References

1 Winterburn TJ, Wyatt DM, Phylip LH, Bur D, Harrison

RJ, Berry C & Kay J (2007) Key features determining the specificity of aspartic proteinase inhibition by the helix-forming IA3 polypeptide J Biol Chem 282, 6508– 6516

2 Phylip LH, Lees WE, Brownsey BG, Bur D, Dunn BM, Winther JR, Gustchina A, Li M, Copeland T, Wlodawer

A & Kay J (2001) The potency and specificity of the interaction between the IA3inhibitor and its target aspar-tic proteinase from Saccharomyces cerevisiae J Biol Chem 276, 2023–2030

3 Li M, Phylip LH, Lees WE, Winther JR, Dunn BM, Wlodawer A, Kay J & Gustchina A (2000) The aspar-tic proteinase from Saccharomyces cerevisiae folds its own inhibitor into a helix Nat Struct Biol 7, 113–117

4 Winterburn TJ, Wyatt DM, Phylip LH, Berry C, Bur D & Kay J (2006) Adaptation of the behaviour of

an aspartic proteinase inhibitor by relocation of a lysine residue by one helical turn Biol Chem 387, 1139–1142

5 Ganesh OK, Green TB, Edison AS & Hagen SJ (2006) Characterizing the residue level folding of the intrinsically unstructured IA3 Biochemistry 45, 13585–13596

6 Green T, Ganesh O, Perry K, Smith L, Phylip LH, Logan TM, Hagen SJ, Dunn BM & Edison AS (2004)

IA3, an aspartic proteinase inhibitor from Saccharomyces cerevisiae, is intrinsically unstructured in solution Bio-chemistry 43, 4071–4081

7 Pedersen J, Lauritzen C, Madsen MT & Dahl SW (1999) Removal of N-terminal polyhistidine tags from recombi-nant proteins using engineered aminopeptidases Protein Expr Purif 15, 389–400

8 Rusconi F & Belghazi M (2002) Desktop prediction⁄ analysis of mass spectrometric data in proteomic projects

by using massXpert Bioinformatics 18, 644–645

Ngày đăng: 19/02/2014, 00:20

TỪ KHÓA LIÊN QUAN

TÀI LIỆU CÙNG NGƯỜI DÙNG

TÀI LIỆU LIÊN QUAN

🧩 Sản phẩm bạn có thể quan tâm