Tài liệu Báo cáo khoa học: Complete reconstitution of an ATP-binding cassette transporter LolCDE complex from separately isolated subunits docx

transporter LolCDE complex from separately isolatedsubunits Kyoko Kanamaru*,, Naohiro Taniguchi, Shigehiko Miyamoto, Shin-ichiro Narita and Hajime Tokuda Institute of Molecular and Cellu

transporter LolCDE complex from separately isolated

subunits

Kyoko Kanamaru*,, Naohiro Taniguchi, Shigehiko Miyamoto, Shin-ichiro Narita

and Hajime Tokuda

Institute of Molecular and Cellular Biosciences, University of Tokyo, Japan

Escherichia coli has at least 90 species of lipoproteins

[1], which have the N-terminal Cys modified with

thio-ether-linked diacylglycerol and an amino-linked acyl

chain [2] Most lipoproteins are present in the outer

membrane, but there are some in the inner membrane

Sorting of lipoproteins depends on the species of

the residue at position 2 [3–5], and is catalyzed by the

Lol system, composed of five Lol proteins [6] The

LolCDE complex in the inner membrane belongs to

the ATP-binding cassette (ABC) transporter

super-family, and mediates detachment of lipoproteins from the inner membrane [7] This results in the formation

of a complex between lipoprotein and LolA [8], a peri-plasmic molecular chaperone for lipoproteins LolB in the outer membrane then accepts lipoproteins from LolA and incorporates them into the outer membrane [9] Inner membrane-specific lipoproteins, which have Asp at position 2, avoid the action of LolCDE, thereby remaining in the inner membrane [10] Such

a LolCDE avoidance function of Asp depends on

Keywords

ABC transporter; lipoprotein; LolCDE;

reconstitution

Correspondence

H Tokuda, Institute of Molecular and

Cellular Biosciences, University of Tokyo,

1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-0032,

Japan

Fax: +81 3 5841 8464

Tel: +81 3 5841 7830

E-mail: htokuda@iam.u-tokyo.ac.jp

*Present address

Department of Biological Mechanisms and

Functions, Graduate School of

Bioagricultu-ral Sciences, Nagoya University, Nagoya,

Japan

†

These authors contributed equally to this

work

(Received 6 November 2006, revised

11 April 2007, accepted 17 April 2007)

doi:10.1111/j.1742-4658.2007.05832.x

The LolCDE complex of Escherichia coli belongs to the ATP-binding cas-sette transporter superfamily and mediates the detachment of lipoproteins from the inner membrane, thereby initiating lipoprotein sorting to the outer membrane The complex is composed of one copy each of membrane subunits LolC and LolE, and two copies of ATPase subunit LolD To establish the conditions for reconstituting the LolCDE complex from sepa-rately isolated subunits, the ATPase activities of LolD and LolCDE were examined under various conditions We found that both LolD and LolCDE were inactivated on incubation at 30C in a detergent solution ATP and phospholipids protected LolCDE, but not LolD Furthermore, phospholipids reactivated LolCDE even after its near complete inactiva-tion LolD was also protected from inactivation when membrane subunits and phospholipids were present together, suggesting the phospholipid-dependent reassembly of LolCDE subunits Indeed, the functional lipo-protein-releasing machinery was reconstituted into proteoliposomes with

E coli phospholipids and separately purified LolC, LolD and LolE Prein-cubation with phospholipids at 30C was essential for the reconstitution

of the functional machinery from subunits Strikingly, the lipoprotein-releasing activity was also reconstituted from LolE and LolD without LolC, suggesting the intriguing possibility that the minimum lipoprotein-releasing machinery can be formed from LolD and LolE We report here the complete reconstitution of a functional ATP-binding cassette transpor-ter from separately purified subunits

Abbreviations

ABC, ATP-binding cassette; BN, blue native; DDM, n-dodecyl-b- D -maltopyranoside; His-tag, hexahistidine tag.

phosphatidylethanolamine in the inner membrane [11].

It has been proposed that a steric and electrostatic

interaction between Asp at position 2 and

phosphatidyl-ethanolamine is responsible for the LolCDE avoidance

mechanism [11]

ABC transporters have four domains, two

mem-brane domains and two nucleotide-binding domains

These domains are frequently present in separate

sub-units in bacteria, whereas eukaryotic ABC transporters

generally have these domains in a single polypeptide

chain [12] The LolCDE complex of E coli is

com-posed of one copy each of membrane subunits LolC

and LolE, and two copies of ATPase subunit LolD [7]

Both LolC and LolE are assumed to span the

mem-brane four times and to have a periplasmic region

comprising  200 amino acids The two proteins are

similar to each other, the sequence identity being 26%

However, both LolC and LolE are required for the

growth of E coli [13] As lipoproteins are present on

the outer leaflet of the inner membrane, LolC and⁄ or

LolE, but not LolD, are responsible for the

recogni-tion of lipoproteins It is of great interest how the

membrane and ATP-binding subunits communicate

with each other, as this is essential for the transfer of

substrate-binding information from LolC⁄ LolE to

LolD, and that of ATP energy from LolD to LolC⁄

LolE

We recently reported the isolation of several LolC

and LolE mutants that suppress dominant negative

mutants of LolD [14] Interestingly, the suppressor

mutations of LolE were mostly located in the

cytoplas-mic and transmembrane regions, whereas those of

LolC were found in the periplasmic domain, suggesting

that LolC and LolE interact differently with LolD and

play different roles in the LolCDE complex To

under-stand the mechanism of LolCDE, the mode of

commu-nication between the respective membrane subunits

and LolD needs to be clarified It is therefore

import-ant to establish conditions for the complete

reconstitu-tion of the LolCDE complex from separately isolated

subunits However, this has been reported only for

OpuA of Lactococcus lactis [15] and Bacillus subtilis

[16], although the functional reassembly of an ABC

transporter from a membrane complex comprising two

subunits and an ATPase subunit has been reported

[17,18] L lactis OpuA is composed of two copies of a

translocator subunit with a substrate-binding domain

and two copies of an ATPase subunit The L lactis

OpuA complex disassembles and reassembles upon a

decrease and increase, respectively, in the glycerol

con-centration of the buffer [15] To investigate the role

of two substrate-binding domains, hetero-oligomeric

OpuA complexes were formed by decreasing and then

increasing the glycerol concentration of a solution con-taining OpuA mixtures The hetero-oligomeric OpuA thus formed was then reconstituted into proteolipo-somes [15] As this method was not adaptable to

B subtilis OpuA, all subunits of the B subtilis OpuA were separately isolated and then successfully reassoci-ated in detergent solution [16]

Here, we report that a functional LolCDE complex could be reconstituted from separately purified LolC, LolD and LolE Moreover, we found that the lipo-protein release activity could be reconstituted from LolD and LolE without LolC

Results

ATPase activities of LolCDE and LolD LolD possessing a hexahistidine tag (His-tag) at the C-terminus and the LolCDE complex containing LolC with a His-tag at the C-terminus were overproduced and purified using a TALON metal affinity resin LolD was purified from the cytosol as a soluble protein, and LolCDE was purified after solubilization of membranes with 1% n-dodecyl-b-d-maltopyranoside (DDM) The initial rates of ATP hydrolysis were then determined in a DDM solution containing various concentrations of ATP The Kmvalues thus determined were 0.11 ± 0.02 mm (n¼ 4) and 0.43 ± 0.02 mm (n¼ 3) for LolCDE and LolD, respectively, where n represents the number of determinations The Vmax values were 0.38 ± 0.03 (n¼ 4) and 0.43 ± 0.05 (n¼ 3) lmol ATP hydrolyzedÆmin)1Æmg)1 LolCDE and LolD, respectively The reported ATPase activities

of ABC transporters vary significantly between 0.01 and 20 lmolÆmin)1Æmg)1 protein [19] Turnover num-bers were 0.9 ± 0.08 and 0.19 ± 0.02 mol ATP hydrolyzedÆs)1Æmol)1 LolCDE and LolD, respectively The LolCDE complex contained two molecules of LolD However, the turnover numbers were still higher with LolCDE than with LolD, even after correction for LolD molecules The ATPase activity of the LolCDE complex was essentially the same whether or not a His-tag was attached to LolD [20] or LolC LolD was monomeric (see below) and did not exhibit cooperativity in the hydrolysis of ATP in a DDM solution (data not shown)

Inactivation and reactivation of the ATPase activity of LolCDE

It was previously found that the LolCDE complex

in n-octyl-b-d-glucopyranoside was quickly inacti-vated even when ATP or phospholipid was added We

therefore used sucrose monocaprate for purification

and reconstitution of LolCDE [7] However, ATP was

required for the stabilization of LolCDE in this

deter-gent We then found that the LolCDE complex could

be stably purified with 1% DDM not only in the

pres-ence but also in the abspres-ence of ATP, leading to the

isolation of a unique liganded LolCDE complex [20]

Purified LolCDE could be stored frozen in 0.01%

DDM without generation of precipitates LolCDE

was reconstituted by incubation with phospholipids

in a solution containing 1.2% sucrose monocaprate,

followed by dialysis and dilution [20] Similarly, the

maltose transporter complex MalFGK2was solubilized

with 1% DDM, purified in 0.01% DDM, and then

reconstituted into proteoliposomes by the

octylgluco-side dilution method [21]

To construct the complete reconstitution system of

the LolCDE complex from isolated subunits, it seemed

important to examine in detail the stability of LolD

and LolCDE in a DDM solution The ATPase activity

of LolCDE in a DDM solution was stable on ice for

at least 2 h even in the absence of ATP However,

incubation at 30C was found to cause a rapid

decrease in the ATPase activity of LolCDE (Fig 1A)

In contrast, no inactivation occurred when ATP or

E coli phospholipids were present during incubation

Blue native (BN)-PAGE revealed that LolCDE, which

has a molecular mass of  140 kDa, migrated to a

position corresponding to a molecular mass of

 180 kDa (lane 1), whereas no material was detected

at this position when LolCDE was incubated at 30C

for 60 min (lane 2) It seems likely that the major

frac-tion of LolCDE did not enter the gel because of

disas-sembly and⁄ or denaturation induced by incubation

with detergent On the other hand, when ATP was

pre-sent during incubation, LolCDE migrated to a position

corresponding to a slightly lower molecular mass

( 170 kDa) (lane 3) than in the case of the

nonincu-bated sample (lane 1) ATP binding to LolD seemed to

cause differences in the migration position of LolCDE

When LolCDE was incubated in a DDM solution at

30C for 60 min, the rate of ATP hydrolysis decreased

to only about 15% of that determined before

incuba-tion (compare the open and closed circles in Fig 1C)

This decreased ATPase activity may represent the

acti-vity of LolD alone because of the disassembly of

LolCDE The inactivated LolCDE was then mixed with

E coli phospholipids and further incubated for the

specified times The incubation with phospholipids

caused recovery of the activity of LolCDE to about 50%

and 80% of the original level after 10 min (squares)

and 120 min (closed triangles), respectively, suggesting

that disassembled LolCDE was reassembled

A

C

B

Fig 1 Inactivation and reactivation of LolCDE The LolCDE com-plex was overproduced from plasmids pNASCH and pKM501 LolD was overproduced from pKM202 (A) LolCDE (3 lg) was incubated at 30 C for the specified times in 105 lL of 50 m M

Tris ⁄ HCl (pH 7.5) containing 10% glycerol and 0.3% DDM Where specified, 8 mg mL)1E coli phospholipids (PL) or 2 m M ATP were also present during the incubation ATP hydrolysis was examined

by the addition of 2 m M ATP and 2 m M MgSO4, as described under Experimental procedures (B) LolCDE (3 lg) was analyzed

by BN-PAGE as described under Experimental procedures Lane 1: LolCDE before incubation Lane 2: LolCDE after incubation with

no supplementation Lane 3: LolCDE after incubation with 2 m M

ATP The migration positions of molecular mass markers (M) are indicated in kDa (C) ATPase activity was examined with LolCDE incubated at 30 C for 60 min as in (A) (closed circles) or not incu-bated (open circles) After 60 min of incubation at 30 C, LolCDE was further incubated with E coli phospholipids (8 mgÆmL)1) for

10 min (open squares), 20 min (open reverse triangles), 30 min (closed reverse triangles), 40 min (open triangles), or 60 min (closed triangles), and then subjected to ATPase assay at the indi-cated times.

LolD purified as a soluble protein from the

cytoplas-mic fraction was also inactivated when incubated in

the DDM solution (compare the open and closed

cir-cles in Fig 2A,C,E) Unlike in the case of LolCDE,

the presence of phospholipids alone did not protect

LolD (compare the open and closed circles in

Fig 2B,D,F) Neither the addition of LolC or LolE,

nor the addition of both in the absence of

phospho-lipids, protected the ATPase activity of LolD (compare

the open and closed triangles in Fig 2A.,C,E) On the other hand, the addition of LolC (Fig 2B) or LolC⁄ LolE (Fig 2F) in the presence of phospholipids pre-vented inactivation of LolD to some extent (compare the open and closed triangles)

Taken together, these results suggest that the mem-brane subunits stabilize the ATPase subunit LolD in the presence of phospholipids It was also strongly sug-gested that the membrane subunits interact with LolD

in the presence of phospholipids even when they are added separately

Reconstitution of the functional lipoprotein-releasing machinery from subunits The four domains of bacterial ABC transporters are frequently located in different subunits Complete reconstitution of ABC transporters from separate sub-units has been reported only for OpuA [15,16], although reassembly of an ATPase homodimer with a heterodimer of the membrane subunit has been repor-ted [17,18] The results shown in Figs 1 and 2 sugges-ted a functional interaction between LolC⁄ LolE and LolD We therefore examined the reconstitution of lipoprotein-releasing activity from the three subunits (Fig 3) The efficiency of lipoprotein release from pro-teoliposomes is usually low even with the LolCDE complex, presumably because the orientation of the reconstituted proteins is random, thereby leaving

a major fraction of lipoproteins incompetent with regard to release [7,10] Nevertheless, reconstitution of LolCDE revealed important aspects of the lipoprotein release reaction [10,11,20] When the LolCDE complex was used, lipoprotein-releasing activity was reconstitu-ted whether incubation with phospholipids was per-formed on ice or at 30C (Fig 3A) In marked contrast, incubation at 30 C was absolutely essential for reconstituting the activity from separately purified LolC, LolD and LolE To our surprise, the lipo-protein-releasing activity was also reconstituted from LolD and LolE without LolC The reconstituted lipo-protein-releasing activity was dependent on LolA On the other hand, the activity was hardly reconstituted from LolC and LolD

The Alafi Pro mutation at position 40 of LolC causes the outer membrane localization of lipoproteins possessing the inner membrane retention signal [22] This may indicate the importance of LolC for lipopro-tein sorting The two Asp residues at positions 2 and 3

of lipoproteins function as typical inner membrane retention signals, and are found in native inner mem-brane lipoproteins [5] We examined whether or not the active machinery lacking LolC releases Pal with

Fig 2 Protection of LolD by membrane subunits His-tagged LolD,

LolC and LolE were overproduced from pKM202, pNASCH and

pNASEH, respectively The ATPase activity of LolD (4.5 lg) before

incubation (open circles) or after incubation at 30 C for 60 min

(closed circles) was determined in 50 m M Tris ⁄ HCl (pH 7.5)

contain-ing 10% glycerol and 0.3% DDM as described under Experimental

procedures Where specified (closed triangles), incubation was

car-ried out in the presence of LolC (A, B) or LolE (C, D), or both (E, F)

with (B, D, F) or without (A, C, E) 8 mgÆmL)1E coli phospholipids

(PL) The open triangles in each panel represent the activity

deter-mined before incubation in the presence of the specified

mem-brane subunits with or without phospholipids.

this signal (Fig 3B) The signal remained inner

mem-brane-specific, and Pal(DD) was not released from any

of the three machineries, i.e LolD⁄ E, LolC ⁄ D ⁄ E and

LolCDE The release of lipoproteins from these

machi-neries was sensitive to orthovanadate (Fig 3C), which

is a specific inhibitor of LolCDE [7] Taken together,

these results indicate that the minimum

lipoprotein-releasing machinery can be reconstituted with LolD

and LolE without LolC

Assembly of the LolCDE complex from separately

isolated subunits

To examine the formation of lipoprotein-releasing Lol

complexes, separately isolated Lol proteins were mixed

as indicated, incubated on ice or at 30C with or

with-out phospholipids, and then subjected to analysis by

gel filtration chromatography (Fig 4) When LolC,

LolE and LolD were separately examined, they were

eluted at positions corresponding to respective mono-mers even after incubation at 30C with phospholipids (Fig 4A,B,C) The LolCDE complex was eluted at a position corresponding to  160 kDa (Fig 4D) When LolC, LolD and LolE were mixed and incubated at

30C in the absence of phospholipids, the three Lol proteins remained at the respective monomer positions (Fig 4E) Incubation of LolC, LolD, LolE and phos-pholipids together on ice caused the formation of a small amount of the LolCDE complex, which was elu-ted at a position corresponding to the intact LolCDE complex (Fig 4F) In contrast, incubation of these three Lol proteins with phospholipids at 30C caused the formation of substantial amounts of the LolCDE complex (Fig 4G)

Incubation of LolD with either LolC (Fig 4I) or LolE (Fig 4J) at 30C in the presence of phospho-lipids also caused elution of a small amount of Lol proteins at fractions corresponding to  160 kDa, indicating that LolCD and LolDE complexes are formed These results suggest that both LolC and LolE can directly interact with LolD, although the formation of LolCD (Fig 4I) and LolDE (Fig 4J) complexes was significantly less efficient than that of the LolCDE complex (Fig 4G) The LolDE complex exhibited a low Pal-releasing activity, whereas the activity of the LolCD complex was not detected (Fig 3) These results suggest that the two membrane subunits play different roles in the lipoprotein release reaction

To determine the subunit stoichiometry of com-plexes formed in vitro, the amounts of Lol proteins were quantitated and corrected with regard to the respective molecular masses The LolCDE complex formed in vitro (Fig 4F,G) had essentially the same subunit stoichiometry as the intact LolCDE complex (Fig 4D) LolD contents in LolCD (Fig 4I) and LolDE (Fig 4J) complexes were slightly higher than expected It is not clear at present whether these com-plexes are composed of two copies of the membrane subunit and three copies of LolD (molecular mass¼ 164–168 kDa) or two copies each of the membrane subunit and LolD (molecular mass¼ 138–142 kDa), although an ABC transporter is generally composed of two membrane domains and two nucleotide-binding domains

Discussion

Bacterial ABC transporters frequently have four domains in separate subunits [12] It was previously suggested that LolC and LolE interact differently with LolD and play different roles in the LolCDE complex

A

B

C

Fig 3 Reconstitution of the lipoprotein-releasing machinery from

isolated subunits (A) LolD (177 pmol), LolC (88 pmol), and LolE

(88 pmol) were mixed in various combinations, and then incubated

with 2 lg of Pal and 0.8 mg of E coli phospholipids for 60 min

either on ice or at 30 C in 1.2% sucrose monocaprate solution To

reconstitute proteoliposomes, the mixtures were then subjected to

dilution and dialysis as described under Experimental procedures.

As a control, the LolCDE complex was also reconstituted

Reconsti-tuted proteoliposomes were collected and subjected to the release

reaction in the presence of LolA and ATP as described under

Experimental procedures (B) Pal(DD) was also reconstituted as in

(A), and the ability of proteoliposomes to release Pal(DD) was

examined (C) Proteoliposomes were reconstituted with the

indica-ted Lol proteins and Pal as in (A) The release of Pal was then

examined in the presence and absence of 1 m M orthovanadate.

[14] Moreover, several mutants have been isolated for

each subunit [7,10,14,20] We therefore wanted to

establish the conditions for reconstituting the

func-tional complex from separately isolated subunits

How-ever, so far, only OpuA has been reported to be

reconstituted from separate subunits Our previous

attempt to reconstitute the LolCDE complex from

sub-units was also unsuccessful Here, we found a rather

simple method; incubation of subunits at 30C in the

presence of phospholipids leads to the reconstitution

of the functional LolCDE complex (Figs 3 and 4)

On the other hand, various membrane apparatuses, including ABC transporters such as maltose permease [21,23], histidine permease [24] and the LolCDE complex [7], and a Sec protein translocase [25,26], have been reconstituted at low temperature This perature-dependent reconstitution is caused by tem-perature-dependent assembly of Lol subunits in the presence of phospholipids (Fig 4) It has been repor-ted that the components of maltose permease aggre-gate upon separate overproduction [27], whereas the three subunits of the LolCDE complex could be

A

B

C

D

E

F

G

H

I

J

Fig 4 In vitro assembly of Lol subunits.

LolC (88 pmol), LolD (176 pmol) and LolE

(88 pmol) were incubated on ice or at 30 C

for 60 min in 100 lL of 20 m M Tris ⁄ HCl

(pH 7.5) containing 10% glycerol, 5 m M

MgCl2, 2 m M ATP, 0.8 mg E coli

phospholi-pids (PL) and 0.01% DDM as described

under Experimental procedures Where

spe-cified, phospholipids (D, E), ATP (H), LolC (J)

or LolE (I) were omitted The reaction

mix-ture was then subjected to gel filtration

chromatography (Superose 6, 10 ⁄ 300 GL),

on a column that had been equilibrated with

20 m M Tris ⁄ HCl (pH 7.5) containing 10%

glycerol and 0.01% DDM The column was

developed with the same buffer at a rate of

0.5 mLÆmin)1 Aliquots of fractions (0.5 mL)

were analyzed by SDS ⁄ PAGE and CBB

staining after precipitation with

trichloro-acetic acid The amounts of the respective

Lol proteins were densitometrically

deter-mined in the specified fractions and

correc-ted with regard to the respective molecular

masses The molecular amounts of LolD

and LolE are indicated, taking the amount of

LolC as 1 The elution positions of molecular

mass markers are indicated above the gel.

As controls, isolated LolC, LolE, LolD and

LolCDE were also analyzed (A–D), and their

elution positions are indicated by open

arrowheads.

separately overproduced and reassembled to form the

functional complex The temperature-dependent

assem-bly of subunits may be characteristic of the LolCDE

complex

The integrity of the LolCDE complex at 30C was

found to be strictly dependent on phospholipids The

complex rapidly lost its activity when incubated at

30C in a DDM solution (Fig 1) This inactivation

was completely prevented by the addition of

phospho-lipids or ATP BN-PAGE suggested that the LolCDE

complex disassembles and denatures in the absence of

protective agents upon incubation Phospholipids

reac-tivated LolCDE, presumably by mediating the

reas-sembly of the three subunits ATP did not reactivate

LolCDE, suggesting that phospholipids and ATP

protect LolCDE through different mechanisms ATP

binding to the nucleotide-binding domains of ABC

transporters has been proposed to yield the closed

dimer [28,29], which is likely to be more resistant to

inactivation Inactivation of LolD on incubation in the

DDM solution was also prevented when both

phos-pholipids and membrane subunits were present (Fig 2)

Overproduced LolD was isolated from the cytosol as a

soluble protein, and remained active unless it was

incu-bated in the DDM solution It seems possible that

DDM at 30C has a weak denaturing effect, which is

prevented by the phospholipid-dependent interaction

with membrane subunits

It has been proposed that LolCDE recognizes the

N-terminal Cys of lipoproteins together with attached

diacylglycerol and an N-linked acyl chain [11]

There-fore, the structure recognized by LolCDE resembles

that of phospholipid This may be related to the

strong phospholipid dependence of LolCDE, although

LolCDE does not export phospholipids

LolC was found to be dispensable for the

reconsti-tution of the minimum lipoprotein-releasing

machin-ery (Fig 3) This was unexpected, because both LolC

and LolE are required for the growth of E coli [13]

The isolation of defective mutants of various Lol

pro-teins revealed that efficient lipoprotein sorting to the

outer membrane is essential for the growth of E coli

[20,30,31], which possesses more than 80 species of

outer membrane-specific lipoproteins [1] On the other

hand, only Pal was reconstituted into

proteolipo-somes This may be the reason why the lack of LolC

caused a marginal defect in the release activity of

proteoliposomes It is likely that both LolC and LolE

are essential in vivo, because a large amount of

lipo-proteins should be rapidly sorted to the outer

mem-brane Our data suggest that the lack of LolC

decreases the affinity for lipoproteins (unpublished

results) These seem to be unfavorable for the efficient

outer membrane sorting of lipoproteins in vivo, whereas the defect was only marginal in the reconsti-tuted proteoliposomes

Both the membrane topology and amino acid sequence (26% identity) are similar between LolC and LolE, whereas the two proteins seem to play different roles [14] The results shown here suggest that the lipo-protein-binding site is present in LolE, which is cur-rently under investigation Lol proteins are highly conserved in various Gram-negative bacteria How-ever, some bacteria, such as Bordetella pertussis and Neisseria meningitidis, possess a single species of mem-brane subunit [32], suggesting that the lipoprotein-releasing apparatus is composed of a homodimer of the membrane subunit and a homodimer of LolD in these bacteria

Experimental procedures

Materials Escherichia coli phospholipids were obtained from Avanti Polar Lipids (Alabaster, AL) and washed with acetone as previously reported [33] b-d-Fructopyranosyl-a-d-glucopyr-anoside monodecanoate (sucrose monocaprate) and DDM were purchased from Dojindo Laboratories (Kumamoto, Japan)

Overproduction of Lol proteins Lol proteins were overproduced in E coli JC7752 (supE hsdS met gal lacY fhuaDtolB-pal) [34] harboring the specified plasmids listed in Table 1 When the culture absorbance at 660 nm reached 0.5, the expression of Lol proteins from Ptac and the araBAD operon promoter (PBAD) was induced at 30C for 2 h by the addition of

1 mm isopropyl-b-d-thiogalactopyranoside and 0.2% arabi-nose, respectively Unless otherwise specified, the LolCDE complex was purified from cells harboring pNASCH and pKM501

Table 1 Plasmids used in this study ‘-his’ represents a hexahisti-dine tag attached to the C-terminus of the respective Lol protein.

Construction of plasmids

To construct pKM501 carrying lolD and lolE under the

control of tacPO and lacIq, the corresponding region of

pJY310 [7] was amplified by PCR using a pair of

oligonu-cleotides, 5¢-GAGCTCGAAGGAGATATAAATATGAAT

AAGATCCTGTTGCAATGC-3¢ and 5¢-AAGCCTGCAG

TTTTTGTTCCACCAATATCAAACCC-3¢ The amplified

DNA was digested with SacI and PstI, and then inserted

into the same restriction site of pTTQ18 [35]

To construct pNASC carrying lolC under PBAD, a

1.2 kbp EcoRI–PstI fragment of pKM101 [10] was cloned

into the same site of pMAN885EH [36]

To construct pNASCH carrying a gene that encodes

LolC with a His-tag at its C-terminus, PCR was performed

with pJY310 as a template and a pair of oligonucleotides,

5¢-GATGAATTCGGAGGTTTAAATTTATGTACCAAC

CTGTCGCTCTATTTA-3¢ and 5¢-CAATTCAAGCTTAA

TGATGATGATGATGATGCTCCAGTTCATAACGTAA

AGCCTCAGCGG-3¢ The amplified DNA was digested

with EcoRI and HindIII, and then cloned into the same site

of pMAN885EH

To construct pNASE carrying lolE under PBAD, a

1.3 kbp EcoRI–PstI fragment of pKM301 [10] was cloned

into the same site of pMAN885EH

To construct pNASEH carrying a gene that encodes

LolE with a His-tag at its C-terminus, PCR was performed

with pJY310 as a template and a pair of oligonucleotides,

5¢-GATGAATTCGGAGGTTTAAATTTATGGCGATGC

CTTTATCGTTATTAA-3¢ and 5¢-CAATTCAAGCTTAA

TGATGATGATGATGATGCTCCAGCTGGCCGCTAAG

GACTCGCGCAG-3¢ The amplified DNA was digested

with EcoRI and HindIII, and then cloned into the same site

of pMAN885EH

Isolation of Lol proteins

JC7752 cells overproducing Lol proteins were converted

into spheroplasts, and then disrupted by passage through

a French pressure cell (10 000 lbÆin)1) Lysates were

fract-ionated into total membrane fractions and supernatants

by centrifugation at 100 000 g for 60 min using a rotor

type 50.2 Ti in Optima L-60 ultracentrifuge (Beckman

Coulter, Fulleston, CA) To purify Lol proteins and Lol

protein complexes, total membranes at 5 mgÆmL)1 were

solubilized on ice for 30 min with 50 mm Tris⁄ HCl

(pH 7.5) containing 10% glycerol, 5 mm MgCl2 and 1%

DDM A solubilized supernatant was obtained by

centrif-ugation at 100 000 g for 30 min using rotor type 50.2 Ti

in Optima L-60, and then applied to a 1 mL TALON

col-umn (Clontech Laboratories, Mountain View, CA) that

had been equilibrated with 50 mm Tris⁄ HCl (pH 7.5)

con-taining 10% glycerol, 100 mm NaCl, and 0.01% DDM

Lol proteins and their complexes were eluted with a linear

gradient of imidazole (0–250 mm) His-tagged LolD was

purified from supernatants of cell lysates and then purified

on a TALON column as described above, except for the absence of DDM

ATPase activity ATP hydrolysis by LolCDE (3 lg) or LolD (4.5 lg) was determined in 105 lL of 50 mm Tris⁄ HCl (pH 7 5) con-taining 10% glycerol and 0.3% DDM The assay was started at 30C by the addition of 2 mm ATP and 2 mm MgCl2 Aliquots (15 lL) of the reaction mixture were withdrawn at the indicated time points, and then mixed with the same volume of 12% SDS to stop the hydrolysis The amounts of inorganic phosphate were determined according to a previously reported method [37] In some experiments, ATP hydrolysis by LolCDE and LolDE was examined after their reconstitution into proteoliposomes with or without Pal

Page SDS⁄ PAGE was performed according to Laemmli [38] Immunoblotting [39] was performed as described BN-PAGE was carried out according to a previously reported method [40] The cathode buffer contained 0.002% Coomassie Bril-liant Blue G-250 and 0.01% DDM was included in the sample buffer

Reconstitution of the LolCDE complex from its subunits

Reconstitution of the LolCDE complex into proteolipo-somes was performed as described previously [20] To form the complex from isolated subunits, specified Lol proteins were incubated for 1 h on ice or at 30C with 0.8 mg of E coli phospholipids and 2 lg of Pal in 100 lL

of 50 mm Tris⁄ HCl (pH 7.5) containing 2 mm MgSO4,

100 mm NaCl and 1.2% sucrose monocaprate The mix-ture was diluted with 900 lL of 50 mm Tris⁄ HCl (pH 7.5) containing 2 mm MgSO4and 100 mm NaCl, and then dia-lyzed against 1000 mL of the same buffer at 4C over-night Reconstituted proteoliposomes were collected by centrifugation at 100 000 g for 2 h using a TLA55 rotor

in a Beckman ultracentrifuge Optima MAX, and then sub-jected to the Pal release assay at 30C for 15 min in the presence of 4 lg of LolA and 2 mm ATP as previously reported [7] The reaction mixtures were fractionated into proteoliposomes and supernatants by centrifugation at

100 000 g for 2 h using a TLA55 rotor in a Beckman ultracentrifuge Optima MAX Pal in the pellets and sup-ernatants was analyzed by SDS⁄ PAGE and immunoblot-ting with antibodies to Pal Unless otherwise specified,

1⁄ 50 of the pellet material and 1 ⁄ 3 of the supernatant material were applied to the gel

In vitro assembly of Lol subunits

The complete reaction mixture contained 88 pmol of LolC,

176 pmol of LolD and 88 pmol of LolE in 100 lL of

20 mm Tris⁄ HCl (pH 7.5) containing 10% glycerol, 5 mm

MgCl2, 2 mm ATP, 0.8 mg of E coli phospholipids,

and 0.01% DDM Where specified, LolC or LolE was

omitted or incubation was carried out in the absence of

phospholipids or ATP The reaction mixture was incubated

on ice or at 30C for 60 min, and then subjected to gel

fil-tration chromatography (Superose 6, 10⁄ 300GL, GE

Healthcare, Chalfont St Giles, UK) on a column that had

been equilibrated with 20 mm Tris⁄ HCl (pH 7.5) containing

10% glycerol and 0.01% DDM The column was developed

with the same buffer at a rate of 0.5 mLÆmin)1 Fractions

of 0.5 mL were collected, and aliquots [1⁄ 3] was analyzed

by SDS⁄ PAGE and Coomassie Brilliant Blue staining after

precipitation with trichloroacetic acid The amounts of Lol

proteins were densitometrically determined in specified gel

filtration chromatography fractions and corrected with

regard to the respective molecular masses

Acknowledgements

We wish to thank Rika Ishihara for technical support

This work was supported by grants to H Tokuda

from the Ministry of Education, Science, Sports and

Culture of Japan

References

1 Miyadai H, Tanaka-Masuda K, Matsuyama S &

Tokuda H (2004) Effects of lipoprotein overproduction

on the induction of DegP (HtrA) involved in quality

control in the Escherichia coli periplasm J Biol Chem

279, 39807–39813

2 Sankaran K & Wu HC (1994) Lipid modification of

bacterial prolipoprotein Transfer of diacylglyceryl

moiety from phosphatidylglycerol J Biol Chem 269,

19701–19706

3 Yamaguchi K, Yu F & Inouye M (1988) A single amino

acid determinant of the membrane localization of

lipo-proteins in E coli Cell 53, 423–432

4 Seydel A, Gounon P & Pugsley AP (1999) Testing the

‘2 rule’ for lipoprotein sorting in the Escherichia coli cell

envelope with a new genetic selection Mol Microbiol

34, 810–821

5 Terada M, Kuroda T, Matsuyama S & Tokuda H

(2001) Lipoprotein sorting signals evaluated as the

LolA-dependent release of lipoproteins from the inner

membrane of Escherichia coli J Biol Chem 276,

47690–47694

6 Tokuda H & Matsuyama S (2004) Sorting of

lipo-proteins to the outer membrane in E coli Biochim

Biophys Acta 1693, 5–13

7 Yakushi T, Masuda K, Narita S, Matsuyama S & Tokuda H (2000) A new ABC transporter mediating the detachment of lipid-modified proteins from membranes Nat Cell Biol 2, 212–218

8 Matsuyama S, Tajima T & Tokuda H (1995) A novel periplasmic carrier protein involved in the sorting and transport of Escherichia coli lipoproteins destined for the outer membrane EMBO J 14, 3365–3372

9 Matsuyama S, Yokota N & Tokuda H (1997) A novel outer membrane lipoprotein, LolB (HemM), involved in the LolA (p20)-dependent localization of lipoproteins to the outer membrane of Escherichia coli EMBO J 16, 6947–6955

10 Masuda K, Matsuyama S & Tokuda H (2002) Elucida-tion of the funcElucida-tion of lipoprotein-sorting signals that determine membrane localization Proc Natl Acad Sci USA 99, 7390–7395

11 Hara T, Matsuyama S & Tokuda H (2003) Mechanism underlying the inner membrane retention of E coli lipo-proteins caused by Lol avoidance signals J Biol Chem

278, 40408–40414

12 Holland IB & Blight MA (1999) ABC-ATPases, adapta-ble energy generators fuelling transmembrane movement

of a variety of molecules in organisms from bacteria to humans J Mol Biol 293, 381–399

13 Narita S, Tanaka K, Matsuyama S & Tokuda H (2002) Disruption of lolCDE, encoding an ATP-binding-cassette transporter, is lethal for Escherichia coli and prevents the release of lipoproteins from the inner mem-brane J Bacteriol 184, 1417–1422

14 Ito Y, Matsuzawa H, Matsuyama S, Narita S & Tokuda H (2006) Genetic analysis of the mode of inter-play between an ATPase subunit and membrane sub-units of the lipoprotein-releasing ATP-binding cassette transporter LolCDE J Bacteriol 188, 2856–2864

15 Biemans-Oldehinkel E & Poolman B (2003) On the role

of the two extracytoplasmic substrate-binding domains

in the ABC transporter OpuA EMBO J 22, 5983–5993

16 Horn C, Bremer E & Schmitt L (2005) Functional over-expression and in vitro reassociation of OpuA, as osmo-tically regulated ABC-transport complex from Bacillus subtilis FEBS Lett 579, 5765–5768

17 Liu PQ & Ames GF (1998) In vitro disassembly and reassembly of an ABC transporter, the histidine per-mease Proc Natl Acad Sci USA 95, 34595–33500

18 Sharma S, Davis JA, Ayvaz T, Traxler B & Davidson

A (2005) Functional reassembly of the Escherichia coli maltose transporter following purification of a MalF– MalG subassembly J Bacteriol 187, 2908–2911

19 Schneider E & Hunke S (1998) ATP-binding-cassette (ABC) transporter systems: functional and structural aspects of the ATP-hydrolyzing subunits⁄ domains FEMS Microbiol Rev 22, 1–20

20 Ito Y, Kanamaru K, Taniguchi N, Miyamoto S & Tokuda H (2006) A novel ligand bound ABC

transporter, LolCDE, provides insights into the

molecu-lar mechanisms underlying membrane detachment of

bacterial lipoproteins Mol Microbiol 62, 1064–1075

21 Davidson AL & Nikaido H (1991) Purification and

characterization of the membrane-associated

compo-nents of the maltose transport system from Escherichia

coli J Biol Chem 266, 8946–8951

22 Narita S, Kanamaru K, Matsuyama S & Tokuda H

(2003) A mutation in the membrane subunit of an ABC

transporter LolCDE complex causing outer membrane

localization of lipoproteins against their inner

mem-brane-specific signals Mol Microbiol 49, 167–177

23 Davidson AL & Nikaido H (1990) Overproduction,

solubilization, and reconstitution of the maltose

trans-port system from Escherichia coli J Biol Chem 265,

4254–4260

24 Panagiotidis CH, Reyes M, Sievertsen A, Boos W &

Shuman HA (1993) Characterization of the structural

requirements for assembly and nucleotide binding of

an ATP-binding cassette transporter The maltose

trans-port system of Escherichia coli J Biol Chem 268,

23685–23696

25 Akimaru J, Matsuyama S, Tokuda H & Mizushima S

(1991) Reconstitution of a protein translocation system

containing purified SecY, SecE, and SecA from

Escheri-chia coli Proc Natl Acad Sci USA 88, 6545–6549

26 Brundage L, Hendrick J, Schiebel E, Driessen AJM &

Wickner W (1990) The purified E coli integral

mem-brane protein SecY⁄ E is sufficient for reconstitution of

SecA-dependent precursor protein translocation Cell

62, 649–657

27 Liu CE & Ames GF (1997) Characterization of

trans-port through the periplasmic histidine permease using

proteoliposomes reconstituted by dialysis J Biol Chem

272, 859–866

28 Davidson AL & Chen J (2004) ATP-binding cassette

transporters in bacteria Annu Rev Biochem 73, 241–268

29 Higgins CF & Linton KJ (2004) The ATP switch

model for ABC transporters Nat Struct Mol Biol 11,

918–926

30 Miyamoto A, Matsuyama S & Tokuda H (2001)

Mutant of LolA, a lipoprotein-specific molecular

cha-perone of Escherichia coli, defective in the transfer of

lipoproteins to LolB Biochem Biophys Res Commun

287, 1125–1128

31 Wada R, Matsuyama S & Tokuda H (2004) Targeted mutagenesis of five conserved tryptophan residues of LolB involved in membrane localization of Escherichia colilipoproteins Biochim Biophys Res Commun 323, 1069–1074

32 Narita S & Tokuda H (2006) An ABC transporter mediating the membrane detachment of bacterial lipo-proteins depending on their sorting signals FEBS Lett

580, 1164–1170

33 Tokuda H, Shiozuka K & Mizushima S (1990) Recon-stitution of translocation activity for secretory proteins from solubilized components of Escherichia coli Eur

J Biochem 192, 583–589

34 Bouveret E, Derouiche R, Rigal A, Lloubes R, Lazdunski C & Benedetti H (1995) Peptidoglycan-associated lipoprotein–TolB interaction A possible key

to explaining the formation of contact sites between the inner and outer membranes of Escherichia coli J Biol Chem 270, 11071–11077

35 Stark MJ (1987) Multicopy expression vectors carrying the lac repressor gene for regulated high-level expression

of genes in Escherichia coli Gene 51, 255–267

36 Yakushi T, Tajima T, Matsuyama S & Tokuda H (1997) Lethality of the covalent linkage between mislo-calized major outer membrane lipoprotein and the peptidoglycan of Escherichia coli J Bacteriol 179, 2857–2862

37 Chifflet S, Torriglia A, Chiesa R & Tolosa S (1988) A method for the determination of inorganic phosphate in the presence of labile organic phosphate and high con-centrations of protein: application to lens ATPases Anal Biochem 168, 1–4

38 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature 227, 680–685

39 Matsuyama S, Fujita Y & Mizushima S (1993) SecD is involved in the release of translocated secretory proteins from the cytoplasmic membrane of Escherichia coli EMBO J 12, 265–270

40 Scha¨gger H, Cramer WA & von Jagow G (1994) Analysis of molecular masses and oligomeric states of protein complexes by blue native electrophoresis and isolation of membrane protein complexes by two-dimensional native electrophoresis Anal Biochem 217, 220–230