Tài liệu Báo cáo khoa học: Phosphorylation of cyclin dependent kinase 4 on tyrosine 17 is mediated by Src family kinases pptx

We purified tyrosine 17 kinases from HeLa cells and found that the Src family non-receptor tyro-sine kinase C-YES contributes a large fraction of the tyrotyro-sine 17 kinase activity in H

tyrosine 17 is mediated by Src family kinases

Nicholas G Martin, Peter C McAndrew, Paul D Eve and Michelle D Garrett

Cancer Research UK Centre for Cancer Therapeutics at The Institute of Cancer Research, Haddow Laboratories, Sutton, UK

Cyclin dependent kinase (CDK) 4⁄ cyclin D kinase is

an important regulator of cell cycle entry and G1

pro-gression, where it initiates inhibitory phosphorylation

of the retinoblastoma tumour suppressor protein RB

[1–3], a critical step for progression into the S-phase

[4–6] Unsurprisingly, considering its pivotal role in cell

cycle control, CDK4⁄ cyclin D kinase activity is

com-monly deregulated in cancer The majority of cancers

contain at least one genetic alteration that affects the

RB pathway [7], and a better understanding of how

CDK4⁄ cyclin D kinase is controlled could provide new

therapeutic targets and strategies for the treatment of

cancer

The activity of the CDK4⁄ cyclin D holoenzyme is

regulated by multiple mechanisms, the most important

of which is the association of CDK4 with the D-type

cyclin subunit, a requirement for kinase activity [8,9] One of the most poorly understood mechanisms by which CDK4⁄ cyclin D kinase activity is controlled is phosphorylation at tyrosine 17 (Y17) of CDK4 This site corresponds to tyrosine 15 (Y15) of CDK1 (Cdc2),

a site of inhibitory phosphorylation on this kinase [10,11] Phosphorylation on Y17 of CDK4 has been shown to occur in mammalian cells that are entering the cell cycle from quiescence, and then undergo G1 arrest induced by UV irradiation [12,13] In these stud-ies, the activation of wild-type CDK4 was inhibited by

UV irradiation, whereas a Y17F nonphosphorylatable mutant form of CDK4 was activated normally, dem-onstrating that phosphorylation of CDK4 on Y17 is inhibitory to kinase activity [12] Expression of the Y17F mutant of CDK4 abrogated the UV-induced G1

Keywords

CDK4; C-YES; Src; tyrosine phosphorylation;

WEE1

Correspondence

M D Garrett, Cancer Research UK Centre

for Cancer Therapeutics at The Institute of

Cancer Research, Haddow Laboratories, 15

Cotswold Road, Sutton, Surrey SM2 5NG,

UK

Fax: +44 020 87224126

Tel: +44 020 87224352

E-mail: michelle.garrett@icr.ac.uk

(Received 19 December 2007, revised 19

March 2008, accepted 11 April 2008)

doi:10.1111/j.1742-4658.2008.06463.x

Cyclin dependent kinase 4 is a key regulator of the cell cycle and its activ-ity is frequently deregulated in cancer The activactiv-ity of cyclin dependent kinase 4 is controlled by multiple mechanisms, including phosphorylation

of tyrosine 17 This site is equivalent to tyrosine 15 of cyclin dependent kinase 1, which undergoes inhibitory phosphorylation by WEE1 and MYT1; however, the kinases that phosphorylate cyclin dependent kinase 4

on tyrosine 17 are still unknown In the present study, we generated a phosphospecific antibody to the tyrosine 17-phosphorylated form of cyclin dependent kinase 4, and showed that this site is phosphorylated to a low level in asynchronously proliferating HCT116 cells We purified tyrosine 17 kinases from HeLa cells and found that the Src family non-receptor tyro-sine kinase C-YES contributes a large fraction of the tyrotyro-sine 17 kinase activity in HeLa lysates C-YES also phosphorylated cyclin dependent kinase 4 when transfected into HCT116 cells, and treatment of cells with Src family kinase inhibitors blocked the tyrosine 17 phosphorylation of cyclin dependent kinase 4 Taken together, the results obtained in the present study provide the first evidence that Src family kinases, but not WEE1 or MYT1, phosphorylate cyclin dependent kinase 4 on tyrosine 17, and help to resolve how the phosphorylation of this site is regulated

Abbreviations

CDK, cyclin dependent kinase; TGF, transforming growth factor; Y15, tyrosine 15; Y17, tyrosine 17.

cell cycle arrest, leading to an increase in chromosomal

aberrations and cell death, indicating that

phosphory-lation of this site is important for integrity of the G1

checkpoint [13] Phosphorylation of CDK4 on Y17

has also been detected in cells entering quiescence in

response to contact inhibition, serum starvation and

treatment with transforming growth factor (TGF) b

[12,14] Taken together, these studies suggest that Y17

phosphorylation of CDK4 regulates G1 phase cell

cycle arrest and quiescence

The available evidence suggests that the dual

speci-ficity phosphatase CDC25A controls removal of

phos-phate from Y17 of CDK4 The increase in Y17

phosphorylation brought about by TGFb corresponds

to a loss of CDC25A [14], and an increase in Y17

phosphorylation of CDK4 has been detected upon

chemical inhibition of CDC25A [15–17] Although

CDC25A may dephosphorylate the CDK4 Y17 site,

the kinase(s) that phosphorylate this residue remain

unknown The obvious candidate kinases for this role

are WEE1 and MYT1 because they phosphorylate

CDK1 on Y15; however, neither is able to

phosphory-late CDK4 on Y17 in vitro [18,19] In the present

study, we used column chromatography to purify

CDK4 Y17 kinases from HeLa cell extracts, and found

that the cellular phosphorylation of CDK4 on Y17 is

mediated by Src family kinases

Results

Detection of CDK4 Y17 phosphorylation and

kinase activity

The N-termini of CDKs 1, 2, 4 and 6 are highly

con-served and there is an equivalent residue to the Y17 site

of CDK4 in each of these kinases To allow the study of

CDK4 Y17 phosphorylation, a phosphospecific

anti-body to the Y17 site was raised using a 13mer

phospho-peptide as the immunogen (Fig 1A) The antibody was

purified and was found to be highly specific for the

phosphopeptide over the nonphosphopeptide by ELISA

(data not shown) To test the site and phosphospecificity

of the antibody against full length CDK4, Flag-tagged

CDK4 or the nonphosphorylatable Y17F mutant of

CDK4 were transfected into HCT116 cells Western

blotting using a CDK4 antibody confirmed expression

of the exogenous Flag-CDK4 and Flag-CDK4Y17F

because they migrate more slowly on the SDS⁄ PAGE

gel than the endogenous CDK4 due to the Flag-tag

(Fig 1B) Western blotting of Flag-immunoprecipitates

from these cell lysates with the CDK4 Y17

phospho-specific antibody (CDK4 pY17) revealed a low basal

level of Y17 phosphorylation that was greatly

induced by treatment of the cells with the protein tyrosine phosphatase inhibitor sodium orthovanadate

No signal was detected in the Flag-CDK4Y17F immuno-precipitates, indicating that the antibody is both phosphospecific and site specific The low basal signal of CDK4 Y17 phosphorylation is in keeping with previous reports that did not detect CDK4 Y17 phosphorylation in asynchronously proliferating cells [12,13]

A

B

C

Fig 1 Detection of CDK4 Y17 phosphorylation (A) Alignment of the N-terminal amino acids of CDKs 1, 2, 4 and 6 showing the con-served tyrosine residue (vertical box) that corresponds to Y17 of CDK4, and the peptide used to raise the pY17 antibody (horizontal box) (B) HCT116 cells were transfected with Flag-tagged CDK4 or CDK4 Y17F and were treated with or without sodium orthovanadate (200 l M ) Lysates were immunoprecipitated with the Flag antibody (Flag IP) The immunoprecipitates and lysates were western blotted with the phosphospecific CDK4 pY17, total CDK4 and aTubulin anti-bodies as indicated Long and short exposures of the CDK4 pY17 blot are shown (C) Lysates from HT29, HCT116, HeLa cells and HeLa nuclei were assayed for Y17 kinase activity using the 96-well plate format assay Each sample contained 2.5 lg of total protein Values are the average of four samples with error bars indicating the SEM.

Using the CDK4 pY17 antibody, we developed a

96-well plate format kinase assay to detect Y17 kinases

The 13mer non-phosphopeptide was used as the

substrate for the kinase(s), and phosphorylation of the

peptide was detected using the CDK4 pY17 antibody

and a Europium labelled secondary antibody Cell

lysates from a range of cell lines were tested for CDK4

Y17 kinase activity (Fig 1C), and activity was detected

in all cell lysates with no activity in the buffer control

Interestingly, a higher level of activity was detected in

HeLa nuclear lysate compared to HeLa whole cell

lysate Due to the commercial availability of suitable

quantities of HeLa nuclear pellets, these were chosen as

the starting material for a purification of CDK4 Y17

kinases

Purification of C-YES as a CDK4 Y17 kinase

A five-step procedure was used to purify Y17 kinases

from HeLa nuclei (Table 1) After each purification

step, the Y17 kinase activities and the protein

concen-trations of the resulting fractions were measured, and

a final purification of approximately 939-fold was

achieved Purification by butyl-sepharose

chromato-graphy resolved the majority of the Y17 kinase activity

as a large peak between fractions 96 and 106, towards

the end of the ammonium sulfate gradient (Fig 2A)

By contrast, western blotting of selected fractions with

a WEE1 antibody revealed that WEE1 flowed through

the column without binding to the butyl-sepharose

resin (Fig 2B) No Y17 kinase activity was detected in

the corresponding fractions (Fig 2A), consistent with

the previous reports showing that WEE1 does not

phosphorylate CDK4 on Y17 [19]

The Y17 kinase activity eluted from the

hydroxyapa-tite column as a single peak between fractions 40 and

47, at the start of the phosphate gradient (Fig 2C)

Fractions 38–49 and a sample of the input were

precip-itated using deoxycholate and trichloroacetic acid, and

the proteins were separated using SDS⁄ PAGE A

major protein band of approximately 60 kDa was

detected by staining with coomassie (Fig 2D) This

band tracked with CDK4 Y17 kinase activity with a peak in fraction 42 (Fig 2C) A sample of the band was excised and the constituent proteins were analysed

by Q-TRAP MS (Applied Biosystems, Foster City,

CA, USA) Forty-nine ions were selected from the sample and sequenced by MS⁄ MS Forty-seven of these were peptides from the chaperonin HSP60 and two were peptides from the nonreceptor tyrosine kinase C-YES Selected fractions from each of the chromatography steps were western blotted with an antibody specific for C-YES, and C-YES protein tracked with CDK4 Y17 activity over all of the chromatography columns (Fig 2B,E)

Src family kinases but not WEE1 or MYT1 phosphorylate CDK4 on Y17 in vitro

To confirm that C-YES contributes to the Y17 kinase activity found in cell lysates, C-YES was immunode-pleted from HeLa nuclear and whole cell extracts, and both the supernatants and the precipitates were assayed for Y17 kinase activity C-YES was success-fully immunodepleted from the nuclear and whole cell lysates and C-YES protein appeared in the precipitates (Fig 3A) Mock depletions where the depleting anti-body was substituted for buffer were used as negative controls The supernatants were assayed for Y17 kinase activity using both the tube (Fig 3A) and 96-well plate (Fig 3B) format assays, whereas the pre-cipitates were assayed using the tube format assay only Depletion of C-YES from both the nuclear and whole cell lysates resulted in a concomitant reduction

in kinase activity as measured by both plate and tube assays The accumulation of C-YES in the precipitates correlated with the appearance of kinase activity in those samples The level of depletion of kinase activity mirrored the level of depletion of C-YES, indicating that C-YES contributes a large fraction of the Y17 kinase activity in these lysates

Immunodepletion from lysates was repeated for the CDK1 Y15 kinases WEE1 (Fig 3C,E) and MYT1 (Fig 3D,E) In both cases, the proteins were Table 1 CDK4 Y17 kinase activity purification from HeLa nuclei.

Purification step

Activity total (counts)

Protein (mg)

Specific activity (countsÆmg)1)

Recovery (%)

Purification (fold)

successfully depleted from HeLa whole cell lysates; however, this did not result in a loss of Y17 kinase activity In addition, the WEE1 and MYT1 immuno-precipitates did not possess Y17 kinase activity These data indicate that WEE1 and MYT1 do not contribute

to the CDK4 Y17 kinase activity in these lysates and are unlikely to be CDK4 kinases in cells

As further confirmation that the Y17 kinase in HeLa whole cell lysates is a Src family kinase, we assayed its sensitivity to the Src family kinase inhibitor PP2 [20]

In comparison, we also assayed the inhibition of puri-fied recombinant kinases C-SRC, C-YES and p49WEE1

by PP2 using the 96-well plate format kinase assay p49WEE1 is a truncated form of human WEE1 that is known to have altered substrate specificity with respect

to full length WEE1 [18,21] and has CDK4 Y17 kinase activity in vitro (Fig 4A) PP2 had similar potency against C-SRC, C-YES and the HeLa lysate, but did not inhibit p49WEE1activity at any concentration This confirms that the Y17 kinase found in HeLa lysate is PP2 sensitive and likely to be a Src family kinase

To test whether CDK4 can be a substrate for Src family kinases other than C-YES, recombinant, puri-fied C-SRC, C-YES and LYN were assayed for Y17 kinase activity using full length CDK4 in a tube format kinase assay (Fig 4B) All three kinases phos-phorylated the Y17 site, demonstrating that CDK4 kinase activity is not restricted to C-YES in vitro

Src family kinases phosphorylate CDK4 on Y17

in cells

To determine whether C-YES can phosphorylate cellular CDK4, empty vector, C-YES, hyperactive C-YESY537For kinase dead C-YESK305Rwere cotrans-fected with empty vector, Flag-CDK4 or Flag-CDK4Y17F into HCT116 cells (Fig 5A,B) The Y537 residue of C-YES is equivalent to Y527 of C-SRC and

is the site of inhibitory phosphorylation by the pro-tein-tyrosine kinase CSK [22] The exogenous C-YES, C-YESY537Fand C-YESK305Rwere detected in the cell lysates by western blotting with a C-YES antibody, and appeared as a double band that migrated more slowly than endogenous C-YES due to the C-terminal Myc-His-tag The exogenous CDK4 proteins were immunoprecipitated with the Flag antibody and Y17 phosphorylation was detected with the CDK4 pY17 antibody Co-transfection of CDK4 with C-YES enhanced the level of Y17 phosphorylation compared

to vector alone, and the level was even greater when the hyperactive C-YESY537F was expressed This con-firms that C-YES can regulate the phosphorylation of

B

A

C

D

E

Fig 2 Identification of C-YES as a Y17 kinase (A) The

ammo-nium sulfate precipitated HeLa nuclear lysate was fractionated by

butyl-sepharose chromatography and the even numbered

frac-tions were assayed for Y17 kinase activity and protein content.

(B) Selected fractions from the flow-through (16), wash (48) and

gradient (80–116), along with a sample of the column input and

the HeLa nuclear lysate, were separated on a 4–12% NuPAGE

gel and western blotted with WEE1 and C-YES antibodies.

(C) The elute from the superdex 200 gel filtration column was

fractionated by hydroxyapatite chromatography and the fractions

were assayed for Y17 kinase activity and protein content.

Fractions from the gradient and a sample of the column input

were separated on 4–12% NuPAGE gels and proteins were

stained with coomassie (D) and western blotted with the C-YES

antibody (E).

CDK4 on Y17 in cells The kinase dead version of

C-YES did not increase the level of Y17

phosphoryla-tion (Fig 5B), confirming that the phosphorylaphosphoryla-tion of

CDK4 is dependent on the kinase activity of C-YES

To determine whether the Src family kinases are

responsible for the CDK4 Y17 phosphorylation

detected in cells, Flag-CDK4 and Flag-CDK4Y17F

were transfected into HCT116 cells, which were then

treated with either the vehicle (dimethylsulfoxide) or

the Src inhibitors PP2 and SU6656 [23] (Fig 5C)

Wes-tern blotting of Flag immunoprecipitates from these

cells with the CDK4 pY17 antibody revealed that both

of the Src inhibitors blocked phosphorylation of

CDK4 on Y17 Interestingly, blotting of the lysates

with a CDK1 pY15 phosphospecific antibody revealed

that the inhibitors did not block the phosphorylation

of CDK1 on this site

Discussion

The aim of the present study was to identify the kinase

or kinases that phosphorylate CDK4 on Y17, the equivalent site to Y15 on CDK1 We purified CDK4 Y17 kinase activity from HeLa cells and identified C-YES as a kinase that contributes a large fraction of the Y17 kinase activity found in HeLa lysates C-YES

is a 62 kDa nonreceptor tyrosine kinase of the Src family that is expressed in a wide range of tissues [24] The N-terminus of C-YES is dually myristoylated and palmitoylated [25], and these modifications target C-YES to intracellular membranes and exclude it from the nucleus [26] Considering that C-YES is not usually localized to the nucleus, it is interesting that we found

a higher concentration of C-YES protein and Y17 kinase activity in our nuclear lysates compared to

C

D

E

Fig 3 C-YES, but not WEE1 or MYT1, contributes Y17 kinase activity to HeLa lysates (A) C-YES was immunodepleted from HeLa whole cell and nuclear lysates with the C-YES polyclonal antibody and protein G sepharose, and the depleted supernatants and precipitates were western blotted with the C-YES antibody The supernatants and precipitates were assayed for Y17 kinase activity using the tube format kinase assay and western blotting of samples with the phosphospecific CDK4 pY17 antibody and the total CDK4 antibody As negative controls, the samples were mock depleted by substitution of the antibody for buffer The negative controls for the kinase assay were either

no lysate (far left hand lane) or antibody and protein G but no lysate (far right hand lane) *Background caused by cross-reactivity with the depleting antibody (B) The C-YES depleted and mock depleted supernatants were assayed for Y17 kinase activity using the 96-well plate format assay Each sample contained 2.5 lg of total protein Values are the average of four samples with error bars indicating the SEM HeLa whole cell lysates were depleted with WEE1 and MYT1 antibodies as described for C-YES and the deleted supernatants were assayed for Y17 kinase activity using the tube format kinase assay (C, D) and the 96-plate format assay (E).

whole cell lysates (Fig 3A,B) Previous

immunofluo-rescence studies have shown C-YES to be located

mainly at the plasma membrane and perinuclear region

[26] It is possible that the C-YES found in our nuclear

pellets was not genuinely nuclear and was from

perinu-clear material or other C-YES containing membranes

that were not removed during the nuclear

fraction-ation; however, the potential existence of nuclear

C-YES warrants further investigation

The study then demonstrated that C-YES

phospho-rylates CDK4 on Y17 when expressed along with

CDK4 in HCT116 cells, indicating that C-YES is a

CDK4 Y17 kinase in cells Moreover, the level of Y17

phosphorylation was dependent on the activity of

C-YES because the activated C-YESY537F mutant

phosphorylated CDK4 to a higher degree than

wild-type C-YES, and the kinase dead C-YESK305Rdid not

phosphorylate CDK4 We also showed that two

struc-turally unrelated Src family kinase inhibitors block the

phosphorylation of CDK4 on Y17 As these inhibitors

have similar activity against all Src family kinases

[20,23], and we have shown that C-YES, C-SRC and

LYN can all phosphorylate CDK4 on Y17 in vitro, it

is possible that Src kinases other than C-YES are also involved in the cellular phosphorylation of CDK4 The

A

B

Fig 4 Src family kinases phosphorylate CDK4 on Y17 in vitro.

(A) HeLa lysates (2.5 lg protein per well), and recombinant purified

p49 WEE1 , C-YES and C-SRC were assayed for Y17 kinase activity

using the plate format assay at various concentrations of the Src

family kinase inhibitor PP2 Values are the average of four samples

normalized to the start activity, with error bars indicating the SEM

converted to a percentage as described in the Experimental

proce-dures (B) Recombinant purified Src family kinases C-YES, C-SRC

and LYN were assayed for Y17 kinase activity using the tube

format assay and western blotting of the samples with the

phos-phospecific CDK4 pY17 antibody and the total CDK4 antibody.

As negative controls, the kinases was heat inactivated at 95 C

for 5 min prior to the assay, as indicated.

A

B

C

Fig 5 Src family kinases phosphorylate CDK4 on Y17 in cells HCT116 cells were transfected with Flag-tagged CDK4 or CDK4Y17F along with C-YES, activated C-YES Y537F (A) or kinase dead C-YES K305R (B) and then treated with or without sodium orthovana-date as indicated Lysates were immunoprecipitated with the Flag antibody (Flag IP) The immunoprecipitates and lysates were wes-tern blotted with the phosphospecific CDK4 pY17, total CDK4 and C-YES antibodies as indicated (C) HCT116 cells were transfected with Flag-tagged CDK4 or CDK4 Y17F and treated with either vehicle (dimethylsulfoxide), PP2 (10 l M ), SU6656 (10 l M ) or sodium ortho-vanadate (200 l M ) Lysates were immunoprecipitated with the Flag antibody (Flag IP) The immunoprecipitates and lysates were wes-tern blotted with the phosphospecific CDK4 pY17 and CDK1 pY15 antibodies, total CDK4, CDK1 and C-YES antibodies as indicated Long and short exposures of the CDK4 pY17 blot are shown.

specific depletion of C-YES from cells using siRNA

did not reduce the level of Y17 phosphorylation (data

not shown); however, this result could be due to

inade-quate knockdown of C-YES or compensation by other

Src family members It is known that Src family

kinases share many substrates and show considerable

functional redundancy [27], and it is likely the Src

kinases other than C-YES contribute to Y17

phos-phorylation of CDK4 in cells

Src family kinases have recently been reported to

phosphorylate p27KIP1on two tyrosine residues [28,29]

and there is the possibility that tyrosine

phosphoryla-tion of p27KIP1 could indirectly affect the Y17

phos-phorylation of CDK4 However, it is clear that the

CDK4 pY17 antibody does not detect tyrosine

phos-phorylation of p27KIP1 because a p27KIP1band would

run at a lower molecular weight than CDK4 on a

wes-tern blot, and no signal was detected with the

CDK4Y17Fmutant Furthermore, the purified

recombi-nant cyclin D1-CDK4 complex used as a substrate for

kinase assays was dimeric and did not contain p27KIP1

(data not shown) Therefore, the data presented in

Figs 1–4 strongly suggest that Src kinases directly

phosphorylate CDK4 on Y17 and that this

phosphory-lation is independent of p27KIP1

The finding that Y17 phosphorylation is mediated

by Src family kinases is completely novel and it is

interesting to note how this fits in with the previously

published data CDK4 phosphorylation on Y17 is

con-sidered to restrain cell cycle progression in UV

irradi-ated cells undergoing G0–G1 transit [12,13], and may

play a role in TGFb mediated G1 arrest [14] In this

context, Y17 phosphorylation is thought to be

modu-lated by loss of the phosphatase CDC25A Our data

suggest that Src kinases are candidates to provide the

phosphorylation of CDK4 If this is the case, it may

be that Src family kinase activity is important for G1

arrest in these cellular situations or other Y17

depen-dent processes that are yet to be defined

It is interesting to note that this is not the first

report of Src family kinases phosphorylating CDKs

The Src kinase LYN is already known to

phosphory-late CDK1 [30,31] and CDK2 [32] on Y15 in response

to DNA damage, and it is plausible that LYN may

also phosphorylate CDK4 on Y17 in this context It is

clear, however, that the regulation of CDK4 Y17

phosphorylation differs markedly from the regulation

of CDK1 Y15 phosphorylation First, the basal level

of CDK4 Y17 phosphorylation appears to be very low

and was greatly increased by incubation with the

pro-tein tyrosine phosphatase inhibitor vanadate (Figs 1B

and 5C) By contrast, the phosphorylation of CDK1

on Y15 was increased to a much lesser degree by

vana-date treatment (Fig 5C) This is in keeping with previ-ous studies that have either reported very low or undetectable levels of Y17 phosphorylation in untreated asynchronously proliferating cells [12–14, 33–35], and suggests that Y17 phosphorylation of CDK4 plays little role in an unperturbed cell cycle Second, the kinases WEE1 and MYT, which phos-phorylate CDK1 on Y15, do not appear to phosphory-late CDK4 on Y17 Immunodepletion of WEE1 or MYT1 from cell lysates did not deplete Y17 kinase activity, suggesting that CDK4 is not a substrate for WEE1 or MYT1, in agreement with previous reports demonstrating that neither of these kinases phosphory-late CDK4 in vitro [18,19] Furthermore, we found that, although CDK4 phosphorylation on Y17 was blocked by Src family kinase inhibitors, CDK1 phos-phorylation on Y15 was not affected (Fig 5C) This suggests that Src kinases do not phosphorylate CDK1 during an unperturbed cell cycle

To conclude, we show that Src family kinases phos-phorylate CDK4 on Y17 in the cell Considering the tight regulation of CDK4 activity during the cell cycle and the critical role that CDK4 plays in human cancer, it will be interesting to investigate how this novel form of regulation affects CDK4 activity during these processes

Experimental procedures

Cell lines and cell culture Frozen whole HeLa cells and HeLa nuclei were purchased from Cil Biotech (Mons, Belgium) HCT116 and HT29 cells (ATCC, LGC Promochem, Teddington, UK) were main-tained in DMEM medium supplemented with 10% (v⁄ v) fetal calf serum in an incubator at 37C with a humidified atmosphere of 5% CO2 HCT116 cells were transfected using Effectene reagent in accordance with the manufac-turer’s instructions (Qiagen, Crawley, UK) and were lysed

or frozen 48 h later

Purified kinases and inhibitors Purified recombinant LYN and C-YES were puchased from Calbiochem (Merck Chemicals Limited, Nottingham, UK), C-SRC was obtained from Upstate (Lake Placid, NY, USA) and p49WEE1 was obtained as previously described [18] The kinase inhibitors PP2 and SU6656 were purchased from Calbiochem (Merck Chemicals Limited) and were dis-solved at 10 mm in dimethylsulfoxide The phosphatase inhibitor sodium orthovanadate (Sigma-Aldrich, Dorset, UK) was dissolved at 0.1 m in water Cells were treated with these inhibitors for 16 h

Plasmid vectors

The human CDK4 coding sequence was cloned into the

EcoRI-XbaI site of pcDNA3.1 (Invitrogen, Paisley, UK)

modified with a FLAG-tag BamHI-EcoRI Codon 17 of

CDK4 was mutated from TAT (Tyr) to TTT (Phe) using

the QuickChange kit (Stratagene, La Jolla, CA, USA)

and the forward primer: 3¢-GAAATTGGTGTCGGCGCC

TTTGGGACAGTGTAC-5¢ The human C-YES coding

sequence minus the termination codon was PCR amplified

from IMAGE clone 5260751 and cloned into the XbaI-NotI

site of pcDNA3.1⁄ myc-His A (Invitrogen) Codon 537 of

C-YES was mutated from TAC (Tyr) to TTC (Phe) with

the forward primer: 3¢-GTCACAGAGCCACAGTTCCAG

CCAGGA-5¢ Codon 305 of C-YES was mutated from

AAA (Lys) to AGA (Arg) with the forward primer: 3¢-GG

AACCACGAAAGTAGCAATCAGAACACTAAAACCA

GGTACAATGATGC-5¢ All vector inserts were

sequenced prior to use

CDK4 pY17 antibody generation

Murex lop-eared rabbits were injected with a

phosphopep-tide corresponding to amino acids 11–23 of human CDK4

phosphorylated on Y17 with an additional cysteine at the

C-terminus (EIGVApYGTVYKAC) conjugated to Keyhole

Limpet Haemocyanin (Pierce, Rockford, IL, USA) The

resulting antisera was affinity-purified by binding to the

phosphopeptide antigen conjugated to sulfolink media

(Pierce) The antibodies were eluted with 100 mm glycine

(pH 2.8) and dialysed into NaCl⁄ Pi The eluate was passed

over a second column of the equivalent nonphosphopeptide

(EIGVAYGTVYKAC), the flow-through was collected and

dialysed into NaCl⁄ Picontaining 50% (v⁄ v) glycerol

96-well plate format CDK4 Y17 kinase assays

Half of the wells of Immulon 2HB 96-well plates (Dynex

Technologies Limited, Worthing, UK) were coated

with 1 lg per well of the CDK4 nonphosphopeptide

(EIGVAYGTVYKAC) at 4C overnight Protein samples

were added to paired peptide-coated and noncoated wells,

and kinase buffer (50 mm Hepes, pH 7.4, 10 mm MgCl2,

1 mm EGTA, 1 mm dithiothreitol, 0.4 mm NaF, 0.4 mm

Na3VO4, 1 mm ATP) was added to a total volume of

100 lL per well The plate was incubated at 37C for

45 min and the reaction was stopped by washing the plate

three times in 0.1% (v⁄ v) Tween-20 The plate was blocked

by incubation with 5% (w⁄ v) skimmed milk powder in

TNT [50 mm Tris-Cl, pH 8.0, 150 mm NaCl, 0.1% (v⁄ v)

Tween-20] for 1 h The CDK4 pY17 antibody diluted

1 : 1000 in 5% (w⁄ v) skimmed milk powder in TNT was

added and incubated overnight at 4C The plate was

washed three times in 0.1% (v⁄ v) Tween-20 before antibody

detection using the DELFIA Europium labelled

anti-rabbit secondary sera and a Wallac Victor 2 plate reader (PerkinElmer, Waltham, MA, USA) as described by the manufacturer The counts from the nonpeptide-coated wells were subtracted from the corresponding peptide-coated wells, and the raw counts were used as the unit of kinase activity For the HeLa lysate PP2 inhibitor assay (Fig 4B), the ATP concentration was reduced to 50 lm and the dim-ethylsulfoxide concentration was kept constant in all the wells For this assay, the SEM was converted to percent of control and was calculated as: (1⁄ y)[rx2

+ (x⁄ y)2

ry2], where y is the sample set to 100%, x is the sample calcu-lated relative to y, ry is the SEM of y and rx is the SEM

of x

Tube format CDK4 Y17 kinase assay Protein samples were mixed with kinase buffer (as above) containing 5 lg of purified cyclin D1⁄ CDK4 complex [36] and were incubated at 37C for 30 min The CDK4 Y17 phosphorylation was detected by western blotting with the CDK4 pY17 antibody

Y17 kinase purification procedure All protein purification steps were carried out at 4C and all chromatography steps were performed using an AKTA FPLC (Amersham Biosciences, GE Healthcare, Amersham, UK) All chromatography columns and media were pur-chased from Amersham Biosciences unless otherwise stated After each step, the Y17 kinase activity of each fraction was measured using the 96-well plate format assay and the protein concentration was assayed using Bradford reagent (Bio-Rad, Hemel Hempstead, UK) Fractions from the Superdex 200 and Hydroxyapatite columns were analysed using the ATTO-TAG CBQCA protein assay (Invitrogen)

2· 1010

frozen HeLa Nuclei (Cil Biotech) with a mass of approximately 80 g were lysed for 30 min in 400 mL of KCl protein extraction buffer [50 mm Hepes, pH 7.4,

250 mm KCl, 1 mm EDTA, 0.1% (v⁄ v) NP-40, 1 mm dith-iothreitol] containing protease inhibitors (Complete EDTA-free Protease Inhibitor Cocktail tablets; Roche Diagnostics Ltd, Burgess Hill, UK) and phosphatase inhibi-tors (10 mm b-glycerophosphate, 1 mm NaF, 0.1 mm

Na3VO4) The lysate was clarified by centrifugation at

15 000 g for 30 min followed by centrifugation at 100 000 g for 1 h Saturated ammonium sulfate solution (200 mL) was added (33% final concentration) and incubated for

30 min The precipitated proteins were collected by centri-fugation at 2885 g for 30 min

The protein pellets were dissolved in 400 mL of buffer A [25 mm Hepes, pH 7.4, 0.6 m ammonium sulfate, 10% (v⁄ v) glycerol, 2 mm benzamidine hydrochloride, 1 mm EDTA, 1 mm dithiothreitol] and clarified by centrifugation

at 100 000 g for 1 h, prior to loading onto an XK 50⁄ 30 column packed with Butyl Sepharose 4 Fast Flow (GE

Healthcare), equilibrated in buffer A Proteins were eluted

with a 2 L linear gradient of 0.6–0 m ammonium sulfate

and 40 mL fractions were collected Fractions 99–105 were

pooled for further purification

The pooled elutes were dialysed into buffer B [25 mm

bis-tris, pH 7.0, 50 mm KCl, 10% (v⁄ v) glycerol, 2 mm

benzamidine hydrochloride, 1 mm EDTA, 1 mm

dithiothre-itol], and loaded onto an XK 16⁄ 20 column packed with Q

Sepharose Fast Flow (GE Healthcare), equilibrated in

buffer B Proteins were eluted with a 240 mL linear

gradi-ent of 50–400 mm KCl and 8 mL fractions were collected

Chaps was added to the pooled elute to a final

concen-tration of 10 mm and the sample was concentrated from

24 mL to 4 mL using two Vivaspin 15R centrifugal

concen-trators (VWR International Ltd, Lutterworth, UK) The

concentrated sample was applied to a HiLoad 26⁄ 60

Super-dex 200 pg gel filtration column (GE Healthcare)

equili-brated with buffer C [10 mm phosphate buffer, pH 7.0,

100 mm KCl, 10% (v⁄ v) glycerol, 1 mm dithiothreitol,

10 mm Chaps], and proteins were eluted in the same buffer

and collected in 4 mL fractions

The active Superdex 200 fractions were loaded onto a

Tricorn 5⁄ 50 column packed with 20 lm particle size Type

I CHT ceramic hydroxyapatite (Bio-Rad) equilibrated with

buffer C The proteins were eluted with a linear gradient of

10–500 mm phosphate buffer and 500 lL fractions were

collected 2.5 lL of sodium deoxycholate (2%, w⁄ v) was

added to 250 lL samples of selected fractions and the

sam-ples were incubated for 15 min 62.5 lL trichloroacetic acid

(50%, w⁄ v) was added, the samples were incubated for a

further 1 h, and the proteins collected by centrifugation at

13000 g for 10 min The precipitates were washed with

ice-cold ethanol, and the proteins were separated by

SDS⁄ PAGE on a NuPAGE 4–12% Bis-Tris gradient gel in

Mops running buffer (Invitrogen) The proteins were

stained with Coomassie brilliant blue G (Sigma-Aldrich)

and a sample from the 60 kDa band was excised The

sample was analysed using Q-TRAP MS by the Protein

Analysis Laboratory at the Cancer Research UK London

Research Institute (London, UK)

Immunoprecipitation

Cells were lysed in RIPA buffer [50 mm Hepes, pH 7.4,

150 mm NaCl, 1 mm EDTA, 1% (v⁄ v) NP-40, 0.5% (w ⁄ v)

sodium deoxycholate, 0.1% (w⁄ v) SDS, 1 mm

dithiothrei-tol] containing protease inhibitors (Complete EDTA-free

Protease Inhibitor Cocktail) and phosphatase inhibitors

(10 mm b-glycerophosphate, 1 mm NaF, 0.1 mm Na3VO4)

Insoluble debris was removed from the lysate by

centrifuga-tion at 13 000 g for 10 min and the protein concentracentrifuga-tion

was measured using Bradford reagent (Bio-Rad) Typically

lysates containing 1 mg of protein were incubated with

20 lL (bed volume) of Anti-FLAG M2 affinity gel

(Sigma-Aldrich) for 3 h at 4C, the beads were washed four times

with RIPA buffer and the precipitated proteins were resolved by SDS⁄ PAGE and western blotting

Immunodepletion Samples of HeLa whole cell and nuclear lysates prepared in KCl protein extraction buffer containing 500 lg of protein were depleted with 20 lg of anti-C-YES (Upstate), 5 lg of anti-WEE1 H-300 (Santa Cruz Biotechnology, Santa Cruz,

CA, USA) or 5 lg of anti-MYT1 N-17 (Santa Cruz Biotechnology) polyclonal sera and 15 lL (bed volume) of protein G-sepharose For mock depletions, the antibody was replaced with KCl protein extraction buffer After incubation with the beads and antibodies at 4C for 3 h, the depleted supernatants were assayed for Y17 kinase activity using both the 96-well plate format and tube format assays The beads were washed four times with KCl protein extraction buffer and twice with kinase buffer without ATP The beads were then assayed for Y17 kinase activity using the tube format assay

Western blotting Protein lysates and immunoprecipitates were resolved on standard 10% SDS⁄ PAGE gels, and chromatography frac-tions were resolved on NuPAGE 4–12% Bis-Tris gradient gels in Mops running buffer (Invitrogen) The proteins were transferred onto Immobilon-P membranes [Millipore (UK) Ltd, Watford, UK], which were blocked in 5% skimmed milk powder in TNT Membranes were incubated with primary antibodies overnight and secondary antibodies (peroxidase-conjugated goat anti-rabbit⁄ mouse antibody; Bio-Rad) for 1 h Blots were developed using ECL Western Blotting Detection Reagents and Hyperfilm (Amersham Biosciences, GE Healthcare) Primary antibodies were CDK4 C-22, WEE1 B-11, MYT1 N-17 (Santa Sruz Biotechnology), CDK1 Ab-4 (NeoMarkers, Thermo Fisher Scientific, Runcorn, UK), CDK1 phospho-Y15 (Cell Signaling Technology, New England Biolabs, Hitchin, UK), aTubulin DM1A (Sigma-Aldrich) and C-YES (BD Biosciences, Oxford, UK)

Acknowledgements

We thank Jacky Metcalfe for the peptide synthesis, Clive Lebozer for production of the rabbit antiserum, and the Protein Analysis Laboratory at the Cancer Research UK London Research Institute for perform-ing the MS We also thank the members of the Garrett laboratory for useful discussion of the manuscript This work was supported by The Institute of Cancer Research, Cancer Research UK (CUK) grant numbers C309⁄ 2187 and C309 ⁄ A8274 and by AICR grant 02-112

1 Dowdy SF, Hinds PW, Louie K, Reed SI, Arnold A &

Weinberg RA (1993) Physical interaction of the

retino-blastoma protein with human D cyclins Cell 73, 499–

511

2 Ewen ME, Sluss HK, Sherr CJ, Matsushime H, Kato J

& Livingston DM (1993) Functional interactions of the

retinoblastoma protein with mammalian D-type cyclins

Cell 73, 487–497

3 Kato J, Matsushime H, Hiebert SW, Ewen ME & Sherr

CJ (1993) Direct binding of cyclin D to the

retinoblas-toma gene product (pRb) and pRb phosphorylation by

the cyclin D-dependent kinase CDK4 Genes Dev 7,

331–342

4 Harbour JW & Dean DC (2000) The Rb⁄ E2F pathway:

expanding roles and emerging paradigms Genes Dev 14,

2393–2409

5 Knudsen ES, Buckmaster C, Chen TT, Feramisco JR &

Wang JY (1998) Inhibition of DNA synthesis by RB:

effects on G1⁄ S transition and S-phase progression

Genes Dev 12, 2278–2292

6 Lukas J, Parry D, Aagaard L, Mann DJ, Bartkova J,

Strauss M, Peters G & Bartek J (1995)

Retinoblastoma-protein-dependent cell-cycle inhibition by the tumour

suppressor p16 Nature 375, 503–506

7 Malumbres M & Barbacid M (2001) To cycle or not to

cycle: a critical decision in cancer Nat Rev Cancer 1,

222–231

8 Bockstaele L, Coulonval K, Kooken H, Paternot S &

Roger PP (2006) Regulation of CDK4 Cell Div 1, 25

9 Morgan DO (1995) Principles of CDK regulation

Nature 374, 131–134

10 McGowan CH & Russell P (1993) Human Wee1 kinase

inhibits cell division by phosphorylating p34cdc2

exclu-sively on Tyr15 EMBO J 12, 75–85

11 Parker LL & Piwnica-Worms H (1992) Inactivation of

the p34cdc2-cyclin B complex by the human WEE1

tyrosine kinase Science 257, 1955–1957

12 Jinno S, Hung SC & Okayama H (1999) Cell cycle start

from quiescence controlled by tyrosine phosphorylation

of Cdk4 Oncogene 18, 565–571

13 Terada Y, Tatsuka M, Jinno S & Okayama H (1995)

Requirement for tyrosine phosphorylation of Cdk4 in

G1 arrest induced by ultraviolet irradiation Nature 376,

358–362

14 Iavarone A & Massague J (1997) Repression of the

CDK activator Cdc25A and cell-cycle arrest by

cyto-kine TGF-beta in cells lacking the CDK inhibitor p15

Nature 387, 417–422

15 Wang Z, Southwick EC, Wang M, Kar S, Rosi KS,

Wilcox CS, Lazo JS & Carr BI (2001) Involvement of

Cdc25A phosphatase in Hep3B hepatoma cell growth

inhibition induced by novel K vitamin analogs Cancer

Res 61, 7211–7216

16 Tamura K, Southwick EC, Kerns J, Rosi K, Carr BI, Wilcox C & Lazo JS (2000) Cdc25 inhibition and cell cycle arrest by a synthetic thioalkyl vitamin K analogue Cancer Res 60, 1317–1325

17 Tamura K, Rice RL, Wipf P & Lazo JS (1999) Dual G1 and G2⁄ M phase inhibition by SC-alpha alpha delta

9, a combinatorially derived Cdc25 phosphatase inhibi-tor Oncogene 18, 6989–6996

18 Booher RN, Holman PS & Fattaey A (1997) Human Myt1 is a cell cycle-regulated kinase that inhibits Cdc2 but not Cdk2 activity J Biol Chem 272, 22300– 22306

19 Watanabe N, Broome M & Hunter T (1995) Regulation

of the human WEE1Hu CDK tyrosine 15-kinase during the cell cycle EMBO J 14, 1878–1891

20 Hanke JH, Gardner JP, Dow RL, Changelian PS, Bris-sette WH, Weringer EJ, Pollok BA & Connelly PA (1996) Discovery of a novel, potent, and Src family-selective tyrosine kinase inhibitor Study of Lck- and FynT-dependent T cell activation J Biol Chem 271, 695–701

21 Parker LL, Sylvestre PJ, Byrnes MJ III, Liu F & Piw-nica-Worms H (1995) Identification of a 95-kDa WEE1-like tyrosine kinase in HeLa cells Proc Natl Acad Sci USA 92, 9638–9642

22 Okada M, Nada S, Yamanashi Y, Yamamoto T & Nakagawa H (1991) CSK: a protein-tyrosine kinase involved in regulation of src family kinases J Biol Chem 266, 24249–24252

23 Blake RA, Broome MA, Liu X, Wu J, Gishizky M, Sun L & Courtneidge SA (2000) SU6656, a selective src family kinase inhibitor, used to probe growth factor sig-naling Mol Cell Biol 20, 9018–9027

24 Sudol M & Hanafusa H (1986) Cellular proteins homol-ogous to the viral yes gene product Mol Cell Biol 6, 2839–2846

25 Koegl M, Zlatkine P, Ley SC, Courtneidge SA & Magee AI (1994) Palmitoylation of multiple Src-family kinases at a homologous N-terminal motif Biochem J

303, 749–753

26 McCabe JB & Berthiaume LG (1999) Functional roles for fatty acylated amino-terminal domains in subcellular localization Mol Biol Cell 10, 3771–3786

27 Thomas SM & Brugge JS (1997) Cellular functions reg-ulated by Src family kinases Annu Rev Cell Dev Biol

13, 513–609

28 Chu I, Sun J, Arnaout A, Kahn H, Hanna W, Narod

S, Sun P, Tan CK, Hengst L & Slingerland J (2007) p27 phosphorylation by Src regulates inhibition of cyclin E-Cdk2 Cell 128, 281–294

29 Grimmler M, Wang Y, Mund T, Cilensek Z, Keidel

EM, Waddell MB, Jakel H, Kullmann M, Kriwacki

RW & Hengst L (2007) Cdk-inhibitory activity and sta-bility of p27Kip1 are directly regulated by oncogenic tyrosine kinases Cell 128, 269–280