Tài liệu Báo cáo khoa học: Transduced human PEP-1–heat shock protein 27 efficiently protects against brain ischemic insult pptx

When PEP-1–HSP27 fusion protein was added to the culture medium of astrocyte and primary neuronal cells, it rapidly entered the cells and protected them against cell death induced by oxi

protects against brain ischemic insult

Jae J An1,*, Yeom P Lee1,*, So Y Kim1, Sun H Lee1, Min J Lee1, Min S Jeong1, Dae W Kim1, Sang H Jang1, Ki-Yeon Yoo2, Moo H Won2, Tae-Cheon Kang2, Oh-Shin Kwon3, Sung-Woo Cho4, Kil S Lee1, Jinseu Park1, Won S Eum1and Soo Y Choi1

1 Department of Biomedical Science and Research Institute for Bioscience and Biotechnology, Hallym University, Chunchon, Korea

2 Department of Anatomy and Neurobiology, College of Medicine, Hallym University, Chunchon, Korea

3 Department of Biochemistry, Kyungpook National University, Taegu, Korea

4 Department of Biochemistry and Molecular Biology, University of Ulsan College of Medicine, Seoul, Korea

Reactive oxygen species (ROS) are formed as

by-prod-ucts of normal cellular processes involving interactions

with oxygen Constant exposure to the harmful actions

of ROS damages macromolecules Ultimately, these

ROS contribute significantly to the pathological

pro-cesses of various human diseases, including ischemia,

carcinogenesis, radiation injury and inflammation⁄

immune injury [1,2]

Oxidative stresses are known to cause the brain lesions that characterize neurodegenerative diseases, with neuroinflammatory processes increasing free radi-cal production [3] Ischemic injury to neurons is pri-marily due to the interruption of blood flow, lack of oxygenation, and subsequent reoxygenation after brain ischemia⁄ reperfusion [4,5] However, the exact mecha-nisms of neuronal damage in ischemia remain to be

Keywords

heat shock protein 27; ischemia; protein

therapy; protein transduction; ROS

Correspondence

S Y Choi, Department of Biomedical

Science and Research Institute for

Bioscience and Biotechnology, Hallym

University, Chunchon 200-702, Korea

Fax: +82 33 241 1463

Tel: +82 33 248 2112

E-mail: sychoi@hallym.ac.kr

W S Eum, Department of Biomedical

Science and Research Institute for

Bioscience and Biotechnology, Hallym

University, Chunchon 200-702, Korea

Fax: +82 33 241 1463

Tel: +82 33 248 2112

E-mail: wseum@hallym.ac.kr

*These authors contributed equally to this

work

(Received 30 October 2007, revised 10

January 2008, accepted 15 January 2008)

doi:10.1111/j.1742-4658.2008.06291.x

Reactive oxygen species contribute to the development of various human diseases Ischemia is characterized by both significant oxidative stress and characteristic changes in the antioxidant defense mechanism Heat shock protein 27 (HSP27) has a potent ability to increase cell survival in response

to oxidative stress In the present study, we have investigated the protective effects of PEP-1–HSP27 against cell death and ischemic insults When PEP-1–HSP27 fusion protein was added to the culture medium of astrocyte and primary neuronal cells, it rapidly entered the cells and protected them against cell death induced by oxidative stress Immunohistochemical analy-sis revealed that, when PEP-1–HSP27 fusion protein was intraperitoneally injected into gerbils, it prevented neuronal cell death in the CA1 region of the hippocampus in response to transient forebrain ischemia Our results demonstrate that transduced PEP-1–HSP27 protects against cell death

in vitro and in vivo, and suggest that transduction of PEP-1–HSP27 fusion protein provides a potential strategy for therapeutic delivery in various human diseases in which reactive oxygen species are implicated, including stroke

Abbreviations

GFP, green fluorescent protein; HSP27, heat shock protein 27; MDA, malondialdehyde; ROS, reactive oxygen species.

elucidated One hypothesis is that cellular events

involving oxidative damage mediated by ROS may

induce neurodegeneration [6] Previous studies have

also provided evidence for the occurrence of oxidative

stress in cerebral ischemia [7,8]

Heat shock proteins (HSPs) are major stress proteins

that are induced in response to a variety of stresses,

including oxidative stress [9] HSPs consist of a family

of highly conserved proteins, grouped according to

their molecular size: high-molecular-mass proteins and

small HSPs Various studies have shown that HSPs act

as modulators of disease pathology in many

neurologi-cal conditions [10–13] However, HSPs show

differ-ences in their tissue and cellular specificity and their

response to different insults [14–16]

Many researchers have demonstrated the successful

delivery of full-length Tat fusion proteins by protein

transduction technology Several small regions of

pro-teins, called protein transduction domains, have been

developed to allow the delivery of exogenous protein

into living cells These include carrier peptides derived

from the HIV-1 Tat protein, Drosophila Antennapedia

(Antp) protein and herpes simplex virus VP22 protein

[17] To increase the biological activity of transduced

proteins in cells, a novel carrier is required to

trans-duce the target protein in its active native structural

form Morris et al [18] have designed a PEP-1 peptide

carrier, which consists of three domains: a

hydropho-bic tryptophan-rich motif, a spacer, and a hydrophilic

lysine-rich domain When they mixed PEP-1 peptide

and a target protein (GFP or b-galactosidase) and then

overlaid them on cultured cells, they found that

non-denatured target protein was transduced

In a previous study, we have shown that a Tat–

Cu,Zn-superoxide dismutase (SOD) fusion can be

transduced into HeLa cells, and protects the cells from

oxidative stress-induced destruction [19] PEP-1–SOD

was efficiently transduced into neuronal cells across

the blood–brain barrier and protected against ischemic

insults [20] Recently, we reported the protective effects

of transduced PEP-1–SOD in neuronal cell death and

paraquat-induced Parkinson’s disease in mice models

[21] In addition, we demonstrated that the PEP-1–

ribosomal protein S3 (rpS3) fusion protein efficiently

transduces into skin cells⁄ tissues and protects against

UV-induced skin cell death [22]

In the present study, we designed a PEP-1–HSP27

fusion protein expression vector (Fig 1) for direct

transduction in vitro and in vivo in its native active

form The results show that the PEP-1–HSP27 fusion

protein can be directly transduced into neuronal cells

and across the blood–brain barrier and can efficiently

protect against cell death Therefore, we suggest that

the PEP-1–HSP27 fusion protein could be useful as a potential therapeutic agent for transient forebrain ischemia

Results

Expression and purification of PEP-1–HSP27 fusion protein

Following induction of expression, PEP-1–HSP27 fusion proteins were purified using an Ni2+ -nitrilotri-acetic acid Sepharose affinity column and PD-10 column chromatography SDS–PAGE and western blot analysis

of the purified PEP-1–HSP27 fusion proteins were performed As shown in Fig 2A, PEP-1–HSP27 fusion proteins were highly expressed, and the purified recom-binant PEP-1–HSP27 fusion protein had an estimated molecular mass of approximately 30 kDa The PEP-1– HSP27 fusion protein was confirmed by western blot

BamH I

A

B

T7 term HSP27 PEP-1

MCS

ori

PEP-1–HSP27

PEP-1–HSP27 Control HSP27

His-Tag

His-Tag

HSP27

HSP27 PEP-1

His-Tag Lac O T7 Prom

Xho I

Fig 1 The expression vector for the PEP-1–HSP27 fusion protein (A) Construction of the PEP-1–HSP27 expression vector system based on the vector pET-15b A synthetic PEP-1 oligomer was cloned with into the NdeI and XhoI sites, and human HSP27 cDNA was cloned into the XhoI and BamHI sites of pET-15b (B) Diagram

of the expressed control HSP27 and PEP-1–HSP27 fusion proteins Each contains a His tag consisting of six histidine residues Expres-sion was induced by adding isopropyl thio-b- D -galactoside (IPTG).

analysis using antibody against rabbit polyhistidine

(Fig 2B)

Transduction of PEP-1–HSP27 fusion protein into

astrocyte and neuronal cells

The intracellular delivery of PEP-1–HSP27 fusion

proteins into astrocytes was confirmed by direct

fluorescence analysis As shown in Fig 3A, almost all

cultured cells were found to be transduced with PEP-1–

HSP27 fusion proteins However, fluorescence signals

were not detected in the negative control cells or in cells

treated with control HSP27 To exclude the possibility

that cell fixation with paraformaldehyde may have

affected detection of PEP-1–HSP27 fusion protein

transduction by direct fluorescence, we used

FITC-con-jugated PEP-1–HSP27 fusion proteins for transduction

into non-fixed or fixed astrocytes The intracellular

distribution of the PEP-1–HSP27 fluorescence signal for

non-fixed cells was similar to that for fixed cells

Under the same experimental conditions, we also

confirmed the intracellular distribution of the PEP-1–

HSP27 fluorescence signal in primary neuronal cells

(Fig 3B) These results indicate that cell fixation with

paraformaldehyde is not required for PEP-1–HSP27

fusion protein transduction

To evaluate the transduction ability of PEP-1–

HSP27 fusion proteins, we added them to astrocyte

cell-culture medium at 3 lm for various periods of

time (10–60 min), and then analyzed the transduced

protein levels by western blotting Transduced PEP-1–

HSP27 fusion proteins were detected in cells within

10 min, and the intracellular concentration gradually increased up to 60 min The dose-dependency of the transduction of PEP-1–HSP27 fusion proteins was then analyzed Various concentrations (0.5–3 lm) of PEP-1–HSP27 fusion proteins were added to astrocytes

in culture for 60 min, and the levels of transduced pro-teins were determined by western blotting The results indicate that the fusion proteins are transduced into astrocytes in a concentration-dependent manner Figure 4A shows that PEP-1–HSP27 fusion protein was efficiently transduced into astrocytes in a time-and dose-dependent manner However, control HSP27 was not transduced into the cells (data not shown)

We also assessed the transduction of PEP-1–HSP27 fusion protein into primary neuronal cells As shown

1 2

150

75

50

37

25

Fig 2 Expression and purification of the PEP-1–HSP27 fusion

protein Protein extracts of cells and purified fusion proteins were

analyzed by 12% SDS–PAGE (A) and subjected to western blot

analysis with antibody against rabbit polyhistidine (B) Lane 1,

non-induced PEP-1–HSP27; lane 2, induced PEP-1–HSP27; lane 3,

purified PEP-1–HSP27.

A

B

Fig 3 Transduction of PEP-1–HSP27 fusion proteins into astro-cytes (A) and primary neuronal cells (B) After transduction of FITC-labeled PEP-1–HSP27 fusion proteins (3 l M ) astrocytes, the cells were washed twice with trypsin ⁄ EDTA and NaCl ⁄ P i and immedi-ately observed by fluorescence microscopy (a) Negative control cells, (b) positive control cells treated with HSP27, (c) non-fixed cells treated with PEP-1–HSP27, and (d) fixed cells treated with PEP-1–HSP27.

in Fig 4B, PEP-1–HSP27 fusion protein transduction

into primary neuronal cells was similar to that for

as-trocytes These results demonstrate that PEP-1–HSP27

fusion protein can not only be transduced into

cul-tured astrocytes but can also penetrate primary

neuro-nal cells

The intracellular stability of transduced PEP-1–

HSP27 fusion protein in astrocytes is shown in

Fig 4C The PEP-1–HSP27 fusion protein was added

to the culture medium at a concentration 3 lm for

var-ious time periods, and the resulting levels of

trans-duced protein were analyzed by western blotting

Transduced PEP-1–HSP27 was initially detected in

cells after 10 min The level declined gradually over

the period of observation However, significant levels

of transduced HSP27 fusion protein persisted in the

cells for 12 h The same patterns were obtained when

we used primary neuronal cells (data not shown)

Effect of transduced PEP-1–HSP27 fusion proteins

on the viability of cells under oxidative stress

To determine whether the transduced fusion protein

has a functional role in cells under oxidative stress, we

examined the viability of cells containing transduced fusion proteins after administration of hydrogen per-oxide When cells were exposed to 1.2 mm hydrogen peroxide, only 35% of the cells were viable The viabil-ity of cells pre-treated with PEP-1–HSP27 fusion pro-teins and then exposed to hydrogen peroxide was markedly increased up to 95% (Fig 5)

Next, we examined the effect of PEP-1–HSP27 transduction on DNA fragmentation induced by hydrogen peroxide Biological macromolecules are known to be major targets of oxidative stress As shown in Fig 6, DNA fragmentation was considerably induced by hydrogen peroxide in astrocytes; however, the levels of DNA fragmentation were significantly decreased by transduction of the PEP-1–HSP27 fusion protein We also measured cell viability and DNA fragmentation using hydrogen peroxide in primary neuronal cells Transduced PEP-1–HSP27 efficiently protects the neuronal cell viability (data not shown),

as seen for astrocytes These results indicate that trans-duced PEP-1–HSP27 fusion protein plays a defensive role against cell death induced by oxidative stress in the cells

Transduced PEP-1–HSP27 protects against ischemic damage

To determine whether transduced PEP-1–HSP27 per-forms biological roles in vivo, we tested the effects of transduced PEP-1–HSP27 fusion protein on neuronal cell viabilities after transient forebrain ischemia in a gerbil model We injected PEP-1–HSP27 fusion protein

C

C

10

A

B

C

0.5 1 2 3 (µ M )

C 0.5 1 2 3 (µ M )

C 1 6 9 12 24 (h)

20 30 45 60 (min)

C 10 20 30 45 60 (min)

Fig 4 Transduction of PEP-1–HSP27 fusion proteins into

astro-cytes (A) and primary neuronal cells (B) PEP-1–HSP27 (3 l M ) was

added to the culture medium for 10–60 min or 0.5–3 l M PEP-1–

HSP27 was added to the culture medium for 1 h (C) Cells

pretreat-ed with 3 l M PEP-1–HSP27 were incubated for 1–24 h Analysis

was performed by western blotting.

120

ol) 100

80 60 40 20 0

* +

3 (µ M )

Fig 5 Effect of transduced PEP-1–HSP27 on cell viability Hydro-gen peroxide (1.2 m M ) was added to astrocytes pretreated with 0.5–3 l M PEP-1–HSP27 for 1 h Cell viabilities were estimated using

an MTT colorimetric assay Each bar represents the mean ± SEM obtained from five experiments Asterisks and crosses denote statistical significance at P < 0.05 and P < 0.01, respectively.

30 min before ischemia At 4 and 7 days following

ischemic insult, PEP-1–HSP27-treated, vehicle-treated

and sham-operated control animals were killed and the

protective effects of PEP-1–HSP27 fusion proteins

after ischemic insult were evaluated using cresyl violet

histochemistry (Fig 7) In the vehicle-treated group,

the percentage of positive neurons detected was 11.2%

of that in the sham-operated group In the PEP-1–

HSP27 fusion protein-treated groups, 4 and 7 days

after ischemic insult, the percentages of positive

neu-rons were 78% and 70% of that in the sham-operated

group, respectively

To determine whether the PEP-1–HSP27 fusion

protein crossed the blood–brain barrier, we performed

immunohistochemistry on brain sections of PEP-1–

HSP27-treated and sham-operated control gerbils

HSP27 protein was not detected in the control

ani-mals However, HSP27 protein levels were significantly

increased throughout the brain of

PEP-1–HSP27-trea-ted animals (Fig 8) These results indicate that PEP-1–

HSP27 fusion proteins are efficiently transduced

beyond the gerbil blood–brain barrier, and effectively

protect against neuronal cell damage caused by

ische-mic insult

Effect of transduced PEP-1–HSP27 on lipid peroxidation

We examined whether PEP-1–HSP27 could inhibit ischemia-induced lipid peroxidation by the measuring levels of malondialdehyde (MDA), a marker of lipid peroxidation, in the hippocampus Three hours after ischemic insult, MDA levels were significantly elevated compared to the sham-operated control group (no ischemic insult, no PEP-1–HSP27 treatment) However, the PEP-1–HSP27-treated group showed

Fig 6 Transduced PEP-1–HSP27 fusion protein inhibits

stress-induced DNA damage Astrocytes were exposed to hydrogen

per-oxide in the absence or presence of 3 l M PEP-1–HSP27 After

hydrogen peroxide exposure, DNA fragmentation was analyzed by

agarose gel electrophoresis M represents DNA molecular mass

markers (100 bp DNA ladder) Lane 1, control cells; lane 2,

hydro-gen peroxide-exposed cells; lane 3, PEP-1–HSP27-treated hydrohydro-gen

peroxide-exposed cells.

b a

d c

f e

h g

B

A

120

Sham

Vehicle

4 days

7 days

100

80

60

v 40

20

0

NC PC 4 days 7 days

PEP-1–HSP27

Fig 7 Effects of transduced PEP-1–HSP27 on neuronal cell viabil-ity after ischemic insult (A) Representative photomicrography of the cresyl violet-stained hippocampus of the gerbil brain 4 and

7 days after ischemic insult Negative control (a,b; normal); positive control (c,d; vehicle-injected group); PEP-1–HSP27 (2 mgÆkg)1) injected into the gerbil as a single dose (e–h) Scale bars = 400 lm (a,c,e,g) and 50 lm (b,d,f,h) (B) Neuronal cell density in the hippo-campal CA1 region of gerbils injected with PEP-1–HSP27 fusion protein Each bar represents the mean ± SE obtained from seven gerbils.

significantly lower hippocampal MDA levels after

ischemic insult compared to the ischemic insult group

that was not treated with PEP-1–HSP27 (Fig 9)

Neuronal cell death in the hippocampal CA1

region

In the sham-operated group, ionized calcium-binding

adapter molecule 1 (iba-1)-immunoreactive cells were

detected in all layers of the CA1 region (Fig 10A) but

the iba-1 immunoreactivity in the cells was weak Four

days after ischemic insult, iba-1-immunoreactive cells

aggregated in the stratum pyramidale, and their iba-1 immunoreactivity was very strong (Fig 10C) How-ever, in the PEP-1–HSP27-treated groups (4 and

7 days), the presence of iba-1-immunoreactive cells and their iba-1 immunoreactivities were markedly decreased in the CA1 regions (Fig 10E,G)

Under the same experimental conditions, we performed Fluoro-Jade B (F-JB) histofluorescence staining In the sham-operated control group, no F-JB-positive neurons were detected in the hippocam-pal CA1 region (Fig 10B) F-JB-positive neurons were abundant in the hippocampal CA1 region 4 days after ischemic insult because of neuronal death in this region (Fig 10D) However, the numbers of F-JB-positive neurons in the hippocampal CA1 region in the PEP-1– HSP27-treated group after 4 and 7 days were signifi-cantly decreased (Fig 10F,H)

Discussion Heat shock proteins (HPSs) have very important func-tions, such as acting as molecular chaperones under physiological conditions or in response to stress The most common inducible HSPs in the nervous system are HSP70 and HSP27, and they have been shown to

be neuroprotective In particular, HSP27 belongs to the family of small heat shock proteins, which protect against apoptotic cell death triggered by various stim-uli such as oxidative stress, and increase the anti-oxidant defense of cells by decreasing the levels of reactive oxygen species (ROS) [23–25] HSPs have been implicated as modulators of disease pathology in many neurological conditions [10–13] Moreover, studies have demonstrated marked differences for each HSP

Fig 8 Transduction of PEP-1–HSP27 fusion protein across the blood–brain barrier Transduction of PEP-1–HSP27 fusion protein in gerbil brain was analyzed by immunohistochemistry using antibody against histidine Animals were treated with a single injection of PEP-1–HSP27 and killed after 8 h (A) Negative control; (B) PEP-1–HSP27-treated gerbil.

12

10

8

6

–1 )

4

2

0

Sham Ischemia PEP-1–HSP27 +

Ischemia

Fig 9 Effects of transduced PEP-1–HSP27 on brain

malondialde-hyde (MDA) level PEP-1–HSP27 was administered 30 min before

ischemia At 3 h after the ischemic insult, hippocampi were

dissected for measurement of MDA Each bar represents the

mean ± SEM obtained from five gerbils Values are significantly

dif-ferent between the sham-operated group and the ischemia group

(P < 0.001) and between the PEP-1–HSP27 + ischemia group and

the ischemia group (P < 0.01).

with regard to their tissue and cellular specificity and

their response to different insults [14–16] However,

the exact role of HSP27 in the disease process remains

unclear Although HSP27 has been considered as

hav-ing potential as a therapeutic protein, its inability to

enter cells hinders its use for this purpose Therefore,

in an effort to deliver HSP27 protein to cells and

tis-sues, we investigated the possibility of protein

trans-duction As the HSP27 has multiple roles, it may be

considered as a potential therapeutic protein against

various neuronal diseases if the protein can be

deliv-ered into cells Morris et al [18] have designed a

21-residue peptide carrier, the PEP-1 peptide, that

allows transduction of proteins in their native condi-tion

To express the cell-permeable PEP-1–HSP27 protein, the human HSP27 gene was fused to a PEP-1 peptide

in a bacterial expression vector to produce a genetic in-frame PEP-1–HSP27 fusion protein The PEP-1– HSP27 fusion protein was a major component of the total soluble proteins in cells, and was found to be nearly homogeneous and more than 95% pure by SDS–PAGE analysis The identity of the expressed and purified PEP-1–HSP27 fusion proteins was con-firmed by western blot analysis using an anti-rabbit polyhistidine antibody

B A

Sham

Vehicle

4 days

7 days

D C

F E

H G

Fig 10 iba-1 and Fluoro-Jade B (F-JB) staining in the CA1 region in sham-operated (A,B), vehicle-treated (C,D) and PEP-1– HSP27-treated groups 4 (E,F) and 7 (G,H) days after ischemic insult With F-JB stain-ing, only damaged neurons are fluorescent.

In the PEP-1–HSP27-treated groups, the numbers of iba-1- and F-JB-positive neurons were markedly decreased in the hippocam-pal CA1 region in comparison with the vehicle-treated group Scale bar = 50 lm.

It has been shown that protein transduction across

the cell membrane by HIV-1 Tat and (Arg)9 protein

transduction domain fusions does not occur in living

cells, and that it is an artifactual redistribution caused

by cell fixation [26] The cell fixation technique

dis-rupts the cell membrane and therefore cannot be

reli-ably used to study membrane-translocating proteins

These peptides and fusion proteins are internalized

into cells by endocytosis Thus, cell fixation should be

avoided in studies of protein transduction into living

cells [26] However, in this study, we were unable to

detect any differences in the distribution of the

fluores-cence of transduced PEP-1–HSP27 fusion proteins in

non-fixed and fixed cells These results demonstrate

that cell fixation with paraformaldehyde is not

required for PEP-1–HSP27 transduction Similar

observations have been reported indicating that

arti-facts of protein transduction are not induced by

para-formaldehyde fixation [27] Our previous studies

showed that transduction of PEP-1–SOD and PEP-1–

rpS3 fusion proteins into neuronal and skin cells was

not affected by paraformaldehyde fixation [21,22]

Purified PEP-1–HSP27 fusion proteins were

effi-ciently transduced into astrocytes in a time- and

dose-dependent manner The fusion protein was transduced

into cells within 10 min, and levels gradually increased

up to 60 min after transduction Morris et al [18]

showed that PEP-1 peptide⁄ green fluorescent protein

(GFP, 30 kDa) or b-Gal (b-galactosidase, 119 kDa)

mixtures can be transduced into a human fibroblast

cell line (HS-68) and into Cos-7 cells by incubation

with a PEP-1 peptide carrier and the GFP or b-Gal

proteins for 30 min at 37C These differences in the

time courses of transduction may depend on whether

the target protein is fused to the PEP-1 vector or

mixed with the PEP-1 peptide Fusion with the PEP-1

vector may alter the conformation, polarity or

molecu-lar shape of the target protein, improving transduction

of the fusion proteins into cells

To determine whether transduced PEP-1–HSP27

fusion proteins can play a biological role in the cells,

we tested the effect of transduced PEP-1–HSP27 fusion

proteins on cell viability under oxidative stress The

viability of cells treated with hydrogen peroxide was

significantly increased when cells were pretreated with

PEP-1–HSP27 fusion proteins Only 35% of cells

trea-ted with hydrogen peroxide without PEP-1–HSP27

were viable Next, we examined the ability of

trans-duced PEP-1–HSP27 fusion protein to inhibit

stress-induced DNA damage, and found that it efficiently

protects against such damage It is well known that

DNA damage triggers a cell-death mechanism and

induces apoptosis These results indicate that the

trans-duced PEP-1–HSP27 fusion protein efficiently protects against cell death caused by oxidative stress This pro-tective effect is in agreement with other reports indicat-ing that overexpression of HSP27 protects neuronal cells from a variety of death-inducing stimuli [12,28]

To examine the ability of transduced PEP-1–HSP27 fusion protein to protect against ischemic damage, we designed a gerbil animal model The formation of a large amount of toxic ROS in the hypoxic and ische-mic brain has been proposed to be an important step

in the sequence of events that links cerebral blood flow reduction to neuronal death ROS formation has been demonstrated during acute ischemic attack and after blood and oxygen are eventually returned to the brain by reperfusion [29] In this study, PEP-1–HSP27 was intraperitoneally administered 30 min before ischemia At 4 and 7 days following ischemia, the pro-tective effects of the fusion proteins were confirmed

by immunohistochemistry The magnitude of the pro-tective effect of PEP-1–HSP27 fusion protein was indicated by the 78% and 70% survival of CA1 neurons, respectively, after 4 and 7 days In addition,

we observed that the PEP-1–HSP27 fusion protein crossed the blood–brain barrier and the protein levels significantly increased throughout the brain Recently, Cho et al [30] demonstrated that PEP-1–cargo fusion proteins can be efficiently delivered into neurons in the ischemic hippocampus, and that PEP-1–SOD treat-ment of animals with ischemic damage (induced prior

to treatment) reduces that damage

Oxidative stress is an important underlying factor in delayed neuronal death induced by ischemic insult Release of ROS and increases in lipid peroxidation can

be detected at a very early stage [8,31,32] We observed

a significant increase in brain MDA levels, a marker of lipid peroxidation, 3 h after an ischemic insult, similar

to that reported previously [33] However, increased MDA levels were significantly reduced by pretreatment with transduced PEP-1–HSP27

Neuronal death induced by injury of the central ner-vous system causes activation of microglia It has been reported that activated microglia contribute to various neurodegenerative diseases via the production of cyto-toxic molecules such as free radicals, proinflammatory prostaglandins and cytokines [34–36] Ionized calcium-binding adaptor molecule 1 (iba-1) is a calcium-bind-ing protein that is specifically expressed in microglia in the brain and plays an important role in regulating their function iba-1 has been utilized as a microglial marker in several studies [37,38] In this study, we observed iba-1-immunoreactive cells in the hippocam-pal CA1 regions after ischemia The number of iba-1-immunoreactive cells increased significantly in the

hippocampal CA1 region 4 days after an ischemic

insult However, in the PEP-1–HSP27-treated group,

the number of iba-1-immunoreactive cells decreased

markedly in the hippocampal CA1 region at 4 and

7 days after the ischemic insult compared with the

group that was not treated with PEP-1–HSP27 We

also observed cell death using F-JB histofluorescent

staining under the same experimental conditions F-JB

staining confirmed the presence of damaged neurons in

the hippocampal CA1 region However, transduced

PEP-1–HSP27 fusion protein markedly decreased the

number of damaged neurons in the hippocampal

CA1 region These results indicate that PEP-1–HSP27

fusion protein is associated with delayed neuronal

death in the hippocampal CA1 region after ischemia,

and attenuates the neuronal damage after an ischemic

insult

HSP27 has a potent ability to increase cell survival

in response to a wide range of cellular challenges

Reports have shown that overexpression of an

individ-ual HSP using viral vectors has a protective effect in

ischemic⁄ reperfusion animal models, and demonstrated

that cell damage is reduced in hippocampus neurons

by approximately 50% in HSP27 transgenic animal

models [39,40] Recently, Kwon et al reported that

transduced Tat–HSP27 protein reduces infarct volume

(29.5%) compared with controls (39.1%) in

ische-mic⁄ reperfusion animals [41] In addition, Badin et al

[42] demonstrated that, in animal ischemia models,

herpes simplex virus carrying HSP27 reduced neuronal

cell death by 44% These results indicate that HSP27

protected against neuronal cell death induced by

ische-mia and stroke

In summary, we demonstrate here for the first time

that human HSP27 fused with PEP-1 peptide (PEP-1–

HSP27) can be efficiently transduced in vitro and

in vivo in its native conformation Moreover, PEP-1–

HSP27 fusion protein markedly protected against

stress-induced cell death and ischemic insults

Although the detailed mechanism remains to be

fur-ther elucidated, our success in protein transduction of

PEP-1–HSP27 may provide a new strategy for

protect-ing against cell destruction resultprotect-ing from ischemic

damage, and therefore may provide an opportunity for

development of therapeutic agents for the treatment of

various human diseases including stroke

Experimental procedures

Materials

purchased from Promega Co (Madison, WI, USA)

Oligo-nucleotides were synthesized from Gibco BRL custom

-nitrilo-triacetic acid Sepharose superflow column was purchased from Qiagen (Valencia, CA, USA) Isopropyl

(Haarlem, the Netherlands) Plasmid pET-15b and

(Hilden, Germany)

Expression and purification of PEP-1–HSP27 fusion proteins

The PEP-1–HSP27 fusion construct was generated by fusion

of the human HSP27 gene in-frame with the sequence encod-ing the 21-amino acid PEP-1 peptide in a bacterial expression vector (Fig 1) A PEP-1–HSP27 expression vector was con-structed to express the PEP-1 peptide (KETWWETWWT-EWSQPKKKRKV) as a fusion with human HSP27 First, two oligonucleotides 5¢-TATGAAAGAAACCTGGTGGG AAACCTGGTGGACCGAATGGTCTCAGCCGAAAAA AAAACGTAAAGTGC-3¢ (top strand) and 5¢-TCGABC ACTTTACGTTTTTTTTTCGGCTGAGACCATTCGGTC

strand) were synthesized and annealed to generate a double-stranded oligonucleotide encoding the PEP-1 peptide The double-stranded oligonucleotide was ligated into an NdeI– XhoI-digested pET-15b vector Second, two primers were synthesized on the basis of the cDNA sequence of human HSP27 The sense primer, 5¢-CTCGAGATGACCGAGCG CCGCGTCCCCTTC-3¢, contains an XhoI site, and the antisense primer, 5¢-GGATCCTTACTTGGCGGCAGTCT CATCGGA-3¢, contains a BamHI restriction site PCR was performed and the PCR product was excised with XhoI and BamHI, eluted, ligated into a pPEP-1 vector using T4 DNA ligase, and transformed into E coli DH5a cells The PEP-1–HSP27 sequences were confirmed by sequence analysis

To produce the PEP-1–HSP27 fusion proteins, the plas-mid was transformed into E coli BL21 cells The trans-formed bacterial cells were grown in 100 mL of LB media

PEP-1–HSP27 was purified by loading clarified cell extracts

(Qiagen) under native conditions After washing the column with 10 volumes of binding buffer and six volumes of a wash buffer (25 mm imidazole, 500 mm NaCl, and 20 mm

eluting buffer (0.25 m imidazole, 500 mm NaCl, 20 mm

HSP27 fusion proteins were combined, and salts were removed using PD-10 column chromatography (Amersham, Braunschweig, Germany) The protein concentration was

estimated by the Bradford procedure using BSA as the

standard [43]

Primary cell cultures

embryonic gestation of mouse embryos (day 14–15)

Ven-tral mesencephalic tissue was mechanically dissociated by

mild trituration in ice-cold calcium- and magnesium-free

Hank’s balanced saline solution and incubated with 0.05%

transferred to a neurobasal medium containing 2% B27

supplement (Gibco, Grand Island, NY, USA), 2 mm

Walkersville, MD, USA) Cells were seeded onto

poly-d-lysine-coated 24-well culture plates Cultures were

replaced with fresh medium Cells were grown for an

addi-tional 2 days and the cells were then used [44]

Transduction of PEP-1–HSP27 fusion protein

into astrocytes and primary neuronal cells

Astrocytes were cultured in Dulbecco’s modified Eagle’s

For transduction of PEP-1–HSP27, the primary neuronal

cells and astrocytes were grown to confluence on a 6-well

plate Then the culture medium was replaced with 1 mL of

fresh solution After the cells had been treated with various

concentrations of PEP-1–HSP27 for 1 h, the cells were

The cells were harvested for the preparation of cell extracts

for western blot analysis

Fluorescence analysis

For direct detection of fluorescein-labeled protein, purified

PEP-1–HSP27 was labeled using an EZ-Label fluorescein

isothiocyanate (FITC) protein labeling kit (Pierce,

Rock-ford, IL, USA) The FITC labeling was performed

according to the manufacturer’s instructions Cultured

cells were grown on glass coverslips and treated with

3 lm PEP-1–HSP27 fusion proteins Following incubation

4% paraformaldehyde for 10 min at room temperature

The distribution of fluorescence was analyzed on a

fluo-rescence microscopy (Carl Zeiss, EL-Einsatz, Goettingen,

Germany)

MTT assay

The biological activity of the transduced PEP-1–HSP27 fusion proteins was assessed by measuring the cell viability

of astrocytes treated with hydrogen peroxide The cells were seeded into 6-well plates at 70% confluence, and were pre-treated with 3 lm PEP-1–HSP27 for 1 h, then hydrogen peroxide (1.2 mm) was added to the culture medium for

4 h Cell viability was estimated by a colorimetric assay using MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-dipheyltetrazo-lium bromide) Controls cells were not pretreated with PEP-1–HSP27

Analysis of DNA fragmentation

DNA fragmentation was performed according to the method described by Iwahashi et al [45] After transduction

of PEP-1–HSP27 fusion proteins into astrocytes, the cells were exposed to hydrogen peroxide (1.2 mm) for 3 h at

RNase and proteinase K (Roche, Mannheim, Germany) The DNA was then extracted with phenol–chloroform, pre-cipitated with isopropanol, washed with ethanol, and air-dried DNA samples were separated by 1.2% agarose gel electrophoresis The gel was stained with ethidium bromide and photographed under UV light

Experimental animals and induction of cerebral forebrain ischemia

This study used the progeny of Mongolian gerbils (Meriones unguiculatus) obtained from the Experiment Animal Center

at Hallym University The animals were housed at constant

Pro-cedures involving animals and their care conformed to the institutional guidelines, which are in compliance with current NIH Guidelines for the Care and Use of Laboratory Ani-mals, and were approved by the Hallym Medical Center Institutional Animal Care and Use Committee

Male Mongolian gerbils weighing 65–75 g were placed under general anesthesia using a mixture of 2.5% isoflurane (Abbott Laboratories, Abbott Park, IL, USA) in 33% oxygen and 67% nitrous oxide To determine whether transduced PEP-1–HSP27 protects from ischemic damage, gerbils were intraperitoneally injected with PEP-1–HSP27

com-mon carotid arteries A midline ventral incision was made

in the neck The common carotid arteries were isolated, freed of nerve fibers, and occluded with non-traumatic aneurysm clips Complete interruption of blood flow was confirmed by observing the central artery in the eyeball using an ophthalmoscope After 5 min occlusion, the aneurysm clips were removed Restoration of blood flow